《The Old Man Who Got a Second Round in Another World》 Volume 1 - Chapter 0 Prologue Volume 1 Prologue : Part 1 The name of my job is Adventurer. In this world, adventurers dive into dungeons to seek the treasures within and claim them as their own. This was one of the main source of income for people who chose to become an adventurer. The only other source of income was to defeat magical beasts that are present in those very dungeons. Once these magical beasts are defeated, they will drop items which can be taken back to a town or the guild and sold for money. In terms of income, adventuring is a profitable profession, however it is as dangerous as it is profitable. I, am one of those Adventurers. A veteran who has been adventuring for over 20 years. Once again, I am entering a dungeon. This time, with the goal of hunting monsters. [Last one left.] (Man) As the man turned towards the meadows, he noticed his prey hiding within the shadow of the grass. It was a Wild Boa. Wild Boas are demons who look similar to wild boars with brown fur. It is well-known for its high-speed rush along with its sharp tusks on its head. The combination of its rush and sharp tusks poses a huge danger to adventurers facing this magical beast. However, in the mans eyes it is merely food. In fact, he cant see it as anything but food. The quest that he accepted from the guild was a request to collect meat from Wild Boas in the dungeons. Without warning, the Wild Boa performed its signature high-speed rush, rushing directly towards the man. Not feeling the need to dodge its attack, he lifted his two-handed sword and swung down towards the Wild Boa. In the midst of its attack, the Wild Boa crashes into the sword, the collision emitting a dull sound. At the end of the exchange, the Wild Boa had its head crushed, and its body laid limp on the ground. Few moments later, the body of the Wild Boa turns into blue particles, leaving behind a lump of meat with skin the color of tree bark on the ground. This phenomena was something that occurred all around the world, however even after it was studied, the only thing that was discovered is that only monsters will transform into blue particles when they die. With some luck, there is also a chance that Item Drops would drop from their blue remains. [Whether they are boars or pigs, at the end of the day they are still meat.] (Man) The man picked up the Item Drop, Meat (Average). In this world, the quality of an Item Drop increases as the level of the monster increases. Meat(Average) was similar to meat obtained from ordinary livestock. It is also possible to obtain higher quality meat such as Meat(Excellent) and Meat(Special) by hunting beasts with higher levels in dungeons with higher difficulties. Although Meat(Special) is a rare and delicious type of meat which can only be dropped by beasts of extremely high difficulty where even first-class adventurers would be in danger. [Lets see The requested amount of meat is ten. With this, the request is completed.] (Man) The man placed the lump of meat in a Magic bag (Capacity: Large). It was a magic bag that was found when he was adventuring in the past. It is a highly valued magical item capable of storing up to 200 kilograms of items. He thought of selling it many times in the past as it had cost as much as buying a house in the village, however it is so rare that the probability of it appearing in the marketplace is close to zero. It was near impossible to obtain the bag again once sold. Convinced by the convenience the bag provided, the man kept the bag and his adventures became much easier as it removed the need to carry heavy items around . As a precaution, the man took out the request form from his bag to review its content once more. Afterwards he began counting the lumps of meat obtained from his hunt to check if it matched the requested amount before leaving the dungeon. As he walked towards the magical gate in the dungeon, he thought about how he would reward himself with a good night of drinks for his work. When the man returned to the village, he went towards the butchery in the village to deliver the meat before heading over to the guild for his quest rewards. [Welcome back, Yuuya-san.] (Old Lady) A familiar face, the old lady who ran the receptionist desk smiled as she waved at him. If this was a guild from a big city, surely a beautiful girl would had been assigned at the desk as the receptionist, however for a small village like this, being able to choose who ran the desk was a luxury in itself, making it near-impossible to select a young and beautiful receptionist. The other adventurers often complained about this at the bar, although personally the man did not mind as it was merely for work. So long as the receptionist did not obstruct his work, their age or gender do not matter. [I am back. The meat collection request has already been completed, here is the certificate of completion.] (Yuuya) Yuuya handed over his status card and the certificate of the request over to the old lady who quickly removed the seal from the certificate and the quest reward was shown on his status card. As she returned the status card, Yuuya checked to ensure the quest reward matched the amount as stated in the request form. As he expected, the reward matched. [Yuuya-san, you do know that your speed in clearing requests is respected and extremely helpful to the guild? I wouldnt do anything to jeopardize your trust in the guild, regardless of the quest.] (Old Lady) [Well I am just checking because its work after all. By the way, are there still any more requests approaching their deadlines?] (Yuuya) [Ah that request was the last one. Oh right, Yuuya-san. Nikita asked me to pass you this.] (Old Lady) As she said that, she passed to Yuuya a homemade apple pie. Nikita was the showgirl of a bar that he goes to often. She was going to be 16 this year, and is quite well-liked among the men in the village. Although he ate at the bar quite often, he couldnt seem to recall asking her for an apple pie. As if she was reading his thoughts, the old lady looked at Yuuya with a gentle smile. [Do you remember about the incident where the Maltese disease spread throughout the village? Back then, you were the one who took up the request to collect Karnatta stone which was the main ingredient in brewing the potion used to cure the disease. Thanks to that, you saved her mother who was infected with the disease. By the way, arent you still single? At your age, shouldnt you be looking to settle down and start a family yourself? Why not consider Nikita? She has pretty good looks for someone her age you know.] (Old Lady) [Sorry but Ill have to pass on this one. I am just an old man who is about to retire. I am sure a girl like Nikita will have many younger and better-looking guys to choose from. I will be accepting the apple pie. I will also be dropping by tomorrow, please reserve a rewarding quest for me. It is the last time after all.] (Yuuya) Although Yuuya had just received a generous reward from completing the request earlier, he was also offered a homemade apple pie. He felt like he would be disrespecting Nikita if he rejected the offer and decided to accept the apple pie. [Yuuya-san. Are you really not going to renew your contract with the guild? The other guild staff and I would like for you to continue being an exclusive adventurer for the next year as well you know.] (Old Lady) [Sorry. But I am already 36 years old this year. It is difficult for me to continue adventuring at my age. As you can probably tell, I already have plenty of savings built up. I plan to return to the countryside and spend my retirement slowly cultivating fields. As for adventuring, you can rest assured since my successor, Beck is an excellent adventurer. After all, I was the one who raised him.] (Yuuya) Exclusive adventurers were adventurers who are bound to a guild with a contract. They were obliged to accept undesired quests that nobody would complete. In exchange, they were paid an additional salary as they continue to work as an exclusive adventurer. For quests like these, which were mainly errands put up by villagers for their needs, veterans like Yuuya were chosen to complete them. These requests were troublesome in many ways, however he did not mind completing them. Since being an exclusive adventurer also gives them the option of declining quests with higher difficulties, this allowed adventurers access to a stable income with relatively low risks as compared to the adventurous, high risk high reward lifestyle of an adventurer. This was also Yuuyas way to show appreciation to the people in the village. However, adventurers are humans too. As they grow older, their bodies grow weaker. Even as an exclusive adventurer, the idea of an being an adventurer is more or less impossible due to their old age. In his peak, Yuuya was able to call himself a first-class adventurer, however he was still unable to become one of the top-class adventurers. Similar to first-class adventurers, many top-class adventurers who were forced to give up their ambitions do not aim to conquer high difficulty dungeons but rather spend their time completing odd-jobs while nurturing the next generation. For Yuuya, he spent his days steadily completing jobs that were safe, slowly building up savings for retirement to live a quiet life that was not chasing the thrill of adventure. Volume 1 Prologue Part 2 After performing my daily maintenance for my sword and armor, I began heading out towards the bar. Whenever the thought of preparing my own dinner, I would feel depressed at the thought of preparing dinner for one. Hence, I preferred to eat out every night. I entered the bar, sitting on a table for two in the corner . As always, this was my special seat in the bar. Even if nothing was said, ale would always be delivered without fail. [Nikita. The apple pie you gave me was delicious.] (Yuuya) The one who brought the ale was Nikita, the signboard girl of the bar. She was a young girl about to hit the age of 16 this year. An energetic girl who lightens the mood just by being present. Even now, men all around the bar are looking at her as we speak. [Its nothing much. Thank you very much! I am happy that Yuuya-san ate my apple pie. My father taught me how to bake that apple pie and I tried my best to bake it to his level.] (Nikita) I couldnt help but let out a wry smile. This girl has feelings for me even though at my age, it would be more appropriate to show respect as an elder. [That was your first time baking? You definitely have talent for cooking.] (Yuuya) [It wasnt anything that special.] (Nikita) [I envy the man that will become your future husband.] (Yuuya) After hearing my response, Nikitas expression became cloudy. Looking from a different perspective, its similar to saying that I would not become her husband. It would be better for me to throw away any feelings of attachment as soon as possible. [Nikita, what is todays recommendation?] (Yuuya) [Uh..Well pork dishes are recommended today as a large batch of pork was brought in today for a cheap price.] (Nikita) That must be the batch that I delivered to the butcher this afternoon. It seems that the butcher had sold the meat immediately after it was delivered. [In that case, give me a stew and a skewer, as well as a refill please.] (Yuuya) [Yes! No problem.] (Nikita) She immediately ran into the kitchen. Whenever I am alone, I find myself coming to the bar. It was a place where many adventurers gather at. Although in a village that only has a low-leveled dungeon, it is quite the sight. There were many young adventurers. Although being an adventurer was a popular job, it was not a job a person could sustain beyond their mid thirties. Although many people pass away before they hit that point. Young people often spoke passionately about their dreams. Even now, the spirits of the young men were raising even higher. [We are definitely going to conquer the Tower of Trials someday! And we will eventually be hailed as equals to the hero Leonard!] [You say that although you are still struggling with Giant Toads.] [Hey please do not say that out loud!] Everyone in the bar laughed together. After feeling the intensity of their passion, I felt my cold heart being warmed slightly. I could see my food being carried over and I started having my dinner. The food was delicious as usual as the chef who works here had good cooking skills. Before arriving at this village, I had spent a large amount of time in a big city but that city did not have many stores that outclassed this store in terms of cooking ability. Should I ask for one more refill? As I was asking myself that question, a man sat down in-front of me. A man wearing magical armour with a silver class adventurers identity card hanging from his neck. His equipment was unfamiliar, suggesting that it was not from this village. It was however a familiar face. A face filled with youth and confidence [I have been looking for you, Yuuya-san] [I heard that you joined Blow, Ain.] (Yuuya) This person was an adventurer from this village Seven years ago, his parents begged for me to teach him the ways of the adventurer and I ended up teaching him for three years. After three years, he became a competent adventurer and left the village to challenge dungeons with higher difficulties. [Well I have been training for the past four years with the Blows and became one of them. I plan to challenge the Tower of Trials.] (Ain) I dropped my fork on the ground unintentionally. [Yuuya-san. Would you like to come with us to the Tower of Trials? We can find out how great of an adventurer you really are! I am sure someone of your caliber would be able to clear the trial easily!. Doesnt it sound like a good idea master?] (Ain) I took a deep breath and began recollecting about the past. About how I was told similar things by other people in the past. However. My answer was decided long ago. Over ten years ago. [Ain. I am grateful for the trust you have in me. However, I have to decline. I am not a chosen one.] (Yuuya) Tower of Trials It is a place where every adventurer dreams of going. It is a place where an adventurer goes if he wishes to be stronger than anyone else And more than a decade ago, it was the place I escaped from without even attempting. [Please do not say such a thing! I have two dependable companions that are coming with us. If we had the experience,skill and strength of my teacher there-] (Ain) [I told you. That I was never chosen for the trials. It was always shown on my status.] (Yuuya) I activated my status card The status card is capable of carrying money as well as function as an identity card. It was capable of revealing the stats and level of the owner. As he looks at the window that popped out, Ain said: [Master you are lying to me.] (Ain) [Ive told you this before. I was unlucky back then. There was also a time I aimed to become stronger and pass the trial. However, the more we progressed, the more I despaired. It was impossible for me. When my friends told me that they wanted to challenge the trials, I left the party. I gave up my chance at becoming strong. Since then, I have doing unreasonable jobs like this.] (Yuuya) My level is currently 50 and was the highest limit a person could go. Once a person reached this limit the person would unable to become stronger. Hence I have become as strong as the limit allowed me to be. Statuses existed in this world. Every time a person leveled up, their stat parameters increases by a value of 1~3. The expected value is 2, but there are always variations and restarting was impossible. And I had the worst possible luck. My parameters always increased in increments of 1, however I believed someday my stat parameters would increase dramatically. Believing this I continued to level up, eventually hitting my level limit. To overcome my low stat parameters, I polished my swordsmanship as much as possible throughout the decades and eventually, I found a way to obtain a power that surpassed a persons status. Through blood,sweat and tears, I managed to obtain strength that went beyond my current status. Despite this, I still reached a limit. The higher the level, the larger the difference between our stat parameters becomes, and the more apparent its effects are, making it impossible to catch up with other people who aimed to be the strongest. I could confidently say that I am a first-class adventurer, but I will never be able to reach the realm of heroes. And thus, I gave up on my dream of becoming the strongest. Like this, I chose a stable job by completing quests with lower difficulties. [Ain, good luck in clearing your trials. If its you, you might have a chance at clearing the trials. You are different from someone like me who was cursed with bad luck.] (Yuuya) Ain had the status required for someone to enter the realms of heroes. He could even be able to achieve something that is impossible for me. [I am sorry Yuuya-san. I did not know.] (Ain) [It was bad of me to talk about a depressing story to someone who cherishes his teacher. I am done with my meal. I will be making a move first.] (Yuuya) It became an atmosphere impossible to drink alcohol in. I placed a little more money than the bill on the desk, and called out to Nikita before leaving the bar. Seriously. Reminding me of bad memories. . . Although Youya gave up his dream of becoming stronger, the burning passion within his heart began to burn once more. Volume 1 - Chapter 1 – The old man remembered As the night ended, the sun could be seen in the horizon, rising into the sky. It was sunrise, and it was time for my daily training. Grasping my trusty, overused sword, I left my home. My sword wasnt a flashy sword by any means. It was merely an easy to use, thick and heavy long sword. However, it was a magical sword which possesses a highly advanced magical enchantment, Restoration, possessing the ability to recover any damage sustained to the blade. It was my trusted sword which has kept me alive until this point. I prayed that it would never break and I would continue to wield it. It was the sword that I loved, and will continue to until the very end. I began my training which became a daily routine for me every morning. I closed my eyes, pictured an imaginary enemy to battle with in my mind. Then I slowly traced the techniques and skills that were ingrained into my body during my adventuring days, slowly allowing my body to remember the sensations when I was risking my life fighting powerful enemies. In this world, things such as Levels and Stats existed. It determined a persons Attack power, Defense, Agility and Magic Power. However, a persons strength did not come just from his stat parameters or his level. It also came in the form of a persons spirit and their training. At the very least, in the most desperate of situations, only a heart of steel honed from vigorous training will a person be able to survive. If an attack is unable to land, it doesnt matter how high your attack parameters are. If a persons defense is inadequate, it does not matter how high your defensive parameters are. If an attack misses or a defense is sloppy, then it is pointless. Hence a persons status does not measure his full combat capabilities. However, with training and proper techniques, a persons combat effectiveness could surpass the limit of their status. Techniques allowed one to utilize their whole body to add weight to their attacks as well as target vital points and defend against attacks beyond their defensive parameters. I believed this. No, I had to believe it. If a persons combat effectiveness was determined by their status, then I would be the laughing stock of all warriors. An average person would have their stat parameters increase by 2 whenever they leveled up, but my stats was inferior to that. My stats had only increased by one. This went on as Youya approached the level cap of 50. Even so, I desired to get stronger and realize my dream, refining my sword techniques and training my body everyday, refusing to give up. I believed that a persons Status was just a strength that existed to compensate for the lack of training required to become stronger and training would be much more beneficial to becoming stronger and obtaining a heart as strong as steel. [Phew. Feels like my body isnt as old as I thought. I can still move pretty well.] (Yuuya) Every-time I swung my sword, I could feel my bodys senses sharpen to their limits. It was as if my nerves were connected to the tip of the sword and my whole body moved as one, following the image in my head. However, techniques wasnt enough to fill the gaping hole in my status. At level 50, the difference in my stats and an average person was so large that no amount of training and swordsmanship would be capable of filling that gap. In order to overcome that gap, I had obtained a secret power. A power that no one was aware of, a power only I possessed. I was always curious about the phenomenon known as Status. I wanted to know why and how a person became stronger as his level increases. However, curiosity killed the cat as I had found myself in a dangerous situation piqued by my curiosity. Thinking that my life was over, I closed his eyes assuming it was the end. Suddenly, I saw a door appear in front of him. When I tried to push it open, I understood that the door that signified the limit of my status. I understood the mysterious power that is the Status in the world and obtained a secret strength which no one has seen before. A power which allowed me to obtain a status on par with others, a power given to me by the world. A world, that was only for me. After completing my morning training, I headed over to the guild. I approached the reception lady to look for requests to complete. Fortunately, there wasnt any request that required my attention. However as it was my last day, I wasnt going to say it out loud as the guild staff approached me, giving me gifts and their words of thanks. Loneliness crept up into my heart, as I knew that I would miss everyone in the village. After visiting the guild, I returned home to prepare my luggage. As I was preparing my luggage I came across a set of photographs that I placed faced down when I arrived. They were the photographs depicting my party before we decided to challenge the Tower of Trials. One of the photos showed Youyas party in one of the big cities starting their adventure, with another photo showing everyone in the party. In the photos, there was a young verison of me, another young man, an Elven girl and a large Dragonoid man laughing together. It was a fairly young party who were aiming for the top and were challenging a super high difficulty dungeon at the moment. The young man and Elf were both my disciples. They were people who were brimming with talent and blessed with high statuses, surpassing me extremely quickly and becoming even stronger. [Seriously. After living in this village all these years, I never expected someone to invite me to the Tower of Trials once more. Thanks you Ain, you helped me remember things that should not be forgotten.] (Yuuya) Feeling nostalgic, I smiled towards the young man in the photograph, remembering the young mans words as he hit level 50. [Master lets challenge the Tower of Trials together! If it is us, our party, we can definitely do it! And once we do, we will finally be real heroes!] (Young man) At the time, I felt a wave of despair rush over my body. The tower was something that could only be cleared by forming a party composed of the best adventurers in the world. It was as difficult as it was rewarding. Clearing the tower would allow a person to go past level 50 as well as treasures that one could only wish for. However, that wasnt all there was to it. Entering the tower would cause the party to be cursed, preventing any of them from leaving the tower. The only way to escape the tower was to clear the trials that appeared in the tower. The tower itself had a survival rate of 2%. I refused the young mans invitation and left the party knowing that with my incompetence, I would only be dragging the party down. I was too weak to utilize my hidden gift and that would ultimately lead to the partys demise. Thus I found a substitute for myself and left the city. After that, I threw away my dream of becoming the strongest. Time passed and I became an exclusive adventurer in a secluded village, challenging intermediate dungeons for my retirement savings while looking after the novice adventurers there. However, just as I was about to enter retirement, one of my former disciples, Ain, asked me to challenge the Tower of Trials together with him, reminding me of my party mate, Leonard. The flames that were extinguished when I ran from the Tower, started burning once more. The passion that was distinguished, the urge to become stronger and the drive to move forward. The waves of emotions became stronger and stronger. [Whats this? You left your talented disciples behind. The disciples who respected and believed in you because you were afraid of challenging the Tower. Why would you behave like this now? After all these years? No, you knew the answer from the start. You knew it all along.] (Youya) As I reprimanded himself, I knew the answer in his heart was always there. I always wanted to become stronger. I always wanted to be the strongest, even with the setback of having a bad status, I wished to become stronger. It was the reason why I continued training everyday. It was impossible to maintain a persons techniques and experience without practicing everyday. It was also the reason why I did not sell my powerful magic items despite being worth a fortune. It was a necessity for me to challenge a dungeon with these items. Realizing my own weakness, I thought I gave up on my dreams, but deep down I never did. When I heard rumors about my first disciple, Leonard attempting to challenge the Tower of Trials with a new party, my feelings werent pride of having a disciple who cleared the tower, nor was it the relief of knowing my disciple survived the tower, but regret that I could not be there to challenge the trial with him. I have always felt frustrated at my status, thinking that if only I did not have such a weak status, at the very least I wished to go back to level 1. I thought that if it meant getting a better status, I would not mind restarting over. In fact I would welcome it. However it was impossible. The only other way he could compensate for his weak status was with extremely powerful magic items. At that moment, waves of emotions begun taking over my body. My hands felt hot and my head felt heavy. Unable to control the emotions, I stumbled and pushed my hands against the wall. Suddenly, several sentences appeared into Yuuyas mind A person who has reached level 50 can have their level reset in a hidden room of a dungeon When their level is reset, their stat parameters will rise and they will obtain skill points. Although the way to reset a persons level is limited, there are ways to raise a persons status to its maximum potential Based on research, the best way to increase a persons stats would be a Magic Warrior Magic Custom can create cheats and other magical numbers Using magical equipment allows a person to exploit a bug in the status system Do not challenge the Tower of Trials. The Tower is adjusted based on the assumption that the challengers are made of parties with the highest status. [HAHAHHAA. That sounds ridiculous.](Yuuya) [That is basically all I ever wanted isnt it? Despite finishing with this shitty status. I can just reset my level to increase my status!? And add the skill points I gain to become even stronger??? That sounds so ridiculous.] (Yuuya) I felt bitter. Ever since I considered the possibility that my stat increments could be fixed instead of random, I gave up. It was impossible to become the strongest. If someone was blessed with the best status in the world, obtained the strength that I took decades to obtain. The strength to compensate for my lack of status. That person would truly become the strongest. Suddenly, the image of a hidden room in a dungeon appeared in my mind. It was like a dream come true, like a delusion. A passion that could not be thrown away, after many years, was showing me visions. Is it was possible to have something this convenient? However, even so. [There is no reason for me not to go. I should go even if theirs only a 0.001% chance.] (Yuuya) I am definitely crazy. My brain is telling me that it is impossible for such a thing to exist but my heart and body are telling me otherwise. I am definitely bad at giving up. If I had truly given up adventuring then I would had stopped my daily training to maintain my body. I knew that it was futile to try and improve my status and merely accepted my bad luck as my fate. Still remembering the actions, Youya prepared himself for traveling and left the city, heading towards the dungeon containing the hidden room, convinced that he would be able to start over. Still remembering the image of the dungeon, I prepared myself to travel and left the city, heading towards the dungeon and trying to convince myself that I would get a second chance. Volume 1 - Chapter 2: The Old man who reset his level In a forest far from the village, a man could be seen riding a horse-like creature at a speed impossible for horses. The creatures species was known as Raptors. Raptors were faster and stronger than average horses as well as more useful in combat than trained horses. They were useful creatures that can be found in dungeons and were often tamed by adventurers due to the massive advantages that they provided. In their current situation, if a person were to determine their destination, that person would merely assume the adventurer to be travelling into the wilderness blindly seeking adventure. That person would never guess that the travelling adventurer destination was a room which could perform the impossible. . . . It appeared in my mind again The hidden room. Why cant I stop thinking about the room? Why do I continue to believe in a fairy tale? A room capable of resetting a persons level. I just cant imagine such a convenient room existing in this world. If it did exist, why wasnt it discovered long ago? Such a room would had been famous worldwide in the blink of an eye. If it was impossible for such a room to exist, why am I still trying to aim for the dungeon that appeared in my head? Sigh I must look like an idiot. I know that it is impossible and yet, I still want to go to that dungeon to confirm it for myself. I never realized it but I really am bad at giving up huh. Probably the worst in the whole world. I probably realized it a long time ago.. That if I had given up my dream of becoming the strongest, I would had fell into depression a long time ago. Subconsciously, I knew that even if I did obtain a power beyond my status, even with all the training I have done.. No. Even if I did have a normal status, I would not have been able to clear the Tower of Trials, and continued running from it without giving up. It feels like I have been waiting all this time, waiting for something. At this moment, something appeared in the distance and the heat in my chest started to radiate even further. For the sake of resetting my level, I continued to ride towards the entrance of the dungeon that has to contain the level reset room. . . . In this world, dungeons werent considered a national threat, but rather a form of resource. If the monsters within were defeated, they would drop items which could be used or sold for money. There were also monsters that could be tamed as well as treasure chests containing rare items. These monsters and chests would re-spawn once every week, thus dungeons were a resource that provided endless amounts of materials and treasures. Seeking this valuable resource, towns and villages were often built near dungeons. Time to time, monsters would escape from the dungeons and wreck havoc inside the towns and villages, however people were still willing to take the risk as the dungeons had provided more benefits than the risks provided. Dungeons located away from human civilization were called Wild Dungeons. These dungeons were often considered more dangerous than normal dungeons for various reasons. For domesticated dungeons, adventurers frequently enter in hopes of hunting valuable materials or discovering treasure chests. This causes the number of monsters in the dungeon to be regulated every week as adventurers continue to hunt for their income. However this wasnt the case for wild dungeons. Wild dungeons were dungeons that were uncontrolled. As there are rarely adventurers entering these dungeons, the dungeons are filled with monsters and it would be impossible to ask for help once caught in a dire situation. If the secret room existed, this is likely the reason why it was never noticed. The dungeon I arrived in appears to be a Wild Dungeon. [It seems that this dungeon is a cave-type.] (Yuuya) Cave dungeons were one of the most disliked dungeons among adventurers due to their low visibility and low efficiency. They are one of the dungeons that requires utmost diligence from any adventurers who aim to conquer them as adventurers are required to carry a light source with them, thus hindering their combat prowess. In addition, many monsters that dwell in cave dungeons typically hide in the shadows to attack unsuspecting adventurers from their blind spots or incapacitate them. With such a high difficulty rate, many adventurers often neglect cave-type dungeons as their rewards was not worth the effort that was required to conquer the dungeon. [If only I had a magic flare with me.] (Yuuya) I muttered unknowingly as I took out my magic torch and held it in my left hand. Magic torches were torches which illuminated the surroundings whereas Magic Flares were capable of serving as a similar light source while repelling monsters. Magic flares were especially effective for cave explorations as it was a light source that did not attract monsters, but rather dissuade them from approaching as monsters disliked the light it emitted. I continued my exploration of the dungeon holding a short sword in my right hand rather than my usual two-handed long sword as my left hand was currently holding the torch. Being unable to hold my trusted sword made me feel extremely uneasy as I wouldnt be able to perform at my 100%. I tightened my grip onto the short sword as I resolved myself to enter the cave. Just as I was feeling comfortable walking inside the cave, I felt a sudden chill rush down my spine. Following my instinct, I jumped to the right and turned to my original position as I regained my footing, catching something launch itself onto my previous location. It was a Tyrant Snake, a large snake the size of an adults neck which produced a paralytic poison on its fang. It was also capable of moving soundlessly and managed to enter my blind spot before launching its attack. If it was successful then I would had easily been paralyzed and slowly suffocated as the snake wrapped itself around my neck. However, I am a trained swordsman who was capable of unconsciously detecting presences entering my range, a skill which only the best swordsmen possessed. Taking advantage of the recoil from its rush, I dropped the torch onto the ground as I ran over, grabbing the snakes head with an eagles grip and forcing it onto the ground with my iron boot, immobilizing its head as its body thrashed around trying to break free. However, before that happened I swung down my short sword onto its neck severing its head from its body as its body turned into blue particles. Judging from the experience points from the battle, the dungeon seemed to be around level 20 to level 30 as I picked up my torch, continuing deeper into the dungeon. It has been four hours since I started exploring the dungeon. I could feel my fatigue accumulating as I ventured deeper into the cave. My body started to feel sluggish and my mind started to shut down as I look at the unchanging scenery around me. Whenever a persons field of vision was limited, battling becomes much more difficult as they unconsciously become more attentive to their surroundings. In this case, not just my field of vision, with my battle capabilities hindered due to the torch, I was in an uncomfortable situation where I suffered multiple handicaps whereas the monsters which dwelled in this area have the advantage as their battle capabilities werent hindered. Not to mention that the monsters would not require light to maneuver in combat and skills such as paralysis. Entering such a dungeon alone would be suicide. To make matters worse, this torch also served as a moving beacon, luring every monster in the vicinity to my location. It was as if I was serving myself to them on a silver platter. I knew this the moment I entered the cave, and my instincts were screaming at me not to lower my guard. This pressure pushed my mind into hyper drive and consumed my stamina much faster than usual. However, thanks to this pressure, I have survived thus far and I have finally arrived at the third floor of the dungeon. [This place looks exactly the same as the image back then] (Yuuya) If my memory is correct, the hidden room that contains the level reset function should be somewhere in this area. As I investigated the area, I found a pure white stone monument standing in a corner. According to the image, this monument should be the entrance to the hidden room. I walked to the side of the monument and leaned my body weight onto the monument to push it, revealing a secret door hidden in the wall. For some reason, I knew that it was a door that was sealed using magic, and that it required specific conditions before a person could open the door. I placed my hand on the door. *RUMBLE RUMBLE RUMBLE* The sealed door started to rumble and opened itself, revealing a secret room. Just how did I know, that I needed to be level 50 to open this door? In the first place, it was impossible for anyone to discover this place, much less figure out how to open this door. For an adventurer to coincidentally discover this dungeon, decide to enter the dungeon despite its difficulty and inefficiency compared to normal dungeons. After spending their energy and stamina travelling in the dungeon for over four hours, push aside a white monument that could possibly be a trap, revealing a door that can only be opened by a person who was level 50. There were too many variables and even if the person was blessed with the best luck, it was still unreasonable to expect a level 50 adventurer to enter a dungeon filled with monsters leveled 30 at best. The person would need to know about the hidden room to actually find it. Thinking about it calmly, it was even more unreasonable. In the first place, resetting their levels was every adventurers dream. If they had obtained unsatisfactory statuses like I did, they would had chosen to reset and start all over. If anyone knew about the level reset function, news about it would had spread all around the world. Which means that if it was still unknown, then the conditions was impossible to be discovered by mere coincidence. [Could this really happen??] (Yuuya) As I wondered to myself, I entered the hidden room. My heartbeats became harder and louder, and my expectation was growing more and more. [What the hell is this room?] (Yuuya) I turned off my torch as the room was illuminated by a magic stone called Photonic Crystal. At the back of the room, there was a statue of a goddess made by chalk. It was the very same statue that appeared in my mind. The vision I saw turned out to be reality, I did find the room that contained the level reset function. However, I did not know what to do. [How do I activate the level reset function.] (Yuuya) I was clueless and afraid. I knew that this place existed and what it could do, but I did not know how to activate its function. When I thought that I might not be able to reset my level despite discovering this place, I couldnt stop shivering in fear. [Wait a minute, whats that?] (Yuuya) As I looked around the room, I noticed a large transparent crystal at the side of the room. [A girl with animal ears and a tail?] (Yuuya) The crystal contained a girl around the age of 14. Her eyes were closed and she had beautiful reddish golden hair with animal ears and a tail. If they were dog ears, she would be a dog-kin, however it was obvious that her ears and tail was much larger than a dog-kin. For some reason, I felt myself being drawn to the crystal as I extended my hand and placed it on the surface of the crystal. As if I knew what would happen, I quickly extended both my hands. The crystal shattered as my hand touched the surface and I grabbed the girl in a princess carry. Any normal adventurer would never do this. It was a risk to expect the girl not to be a monster, especially when the person was alone. However, I knew that she wasnt. [Are you alright?] (Yuuya) As I carried the girl, she started to open her eyes. She sloppily turned her eyes and looked at me. [IWas..WaitingForever] (Girl) [What do you mean by that?] (Youya) [Its time to remember. The memory of your distant past.] (Girl) The girl extended her hands, placing them on the back of my neck. She pulled my face towards hers, and I felt my lips connect with hers. After kissing me, the girl went back to sleep, and I laid her on the ground. Information started flowing into my brain like an open dam. Information that felt like memories. A huge influx of memories starting swirling into my brain. Memories about a man, born into a country called Japan. He grew up and became a typical salary man. It was a normal life where the man worked everyday without any trouble, but he would not be successful in life. No matter how much he tried, his achievements would never be his. Other people would present the results he produced and gain the achievement. Even so he continued trying his best. That man felt strangely familiar, as if he was close to him. As if it was him himself. [What the hell is this?? What is going on?? This isnt me. That CANT be me.] (Youya) No.. It definitely is me, but yet it isnt. That isnt me. [Its my previous life] (Yuuya) As I came to that conclusion, the memory about the man, spending all his leisure time into playing a game flowed into my brain. A game that looked exactly the same as this world.. My world. [If that was truly my previous life, then according to the memory, I know how to activate the level reset function] (Yuuya) I took one of the light crystals that was set onto the walls of the room, and placed it into the necklace of the goddesss chest. The light crystal fit perfectly into the necklace and starts to emit a soft light. [Welcome, adventurer with power. Congratulations on your journey thus far. I am an artifact created with the goal of making adventurers stronger by sacrificing their levels. Are you willing to give up the levels you have built up thus far, in exchange for becoming stronger?] (Goddess statue) According to the memories, this statue allows a person to reset their level, in turn sacrificing all the experience gained. My journey had been a painful one. I had no choice but to stick with my weak status, fighting battles with a handicap. I wish to restart and be reborn, and be rewarded for all my hard work. [I do.] (Yuuya) [The ritual has been accepted. Adventurer Yuuya. From now on, your level will be reset back to level one, and you will be reborn.] (Goddess Statue) The soft light starts to illuminate even further, becoming harsher and hotter. The light started to overflow from the necklace and envelop my body. My body started heating up, as if I was being disintegrated. After a brief moment, the light starts to dissipate. I was reborn. [You have been reborn. You are now level one and every skill you have attained up to this point has been lost.] (Goddess Statue) A status card was displayed from the statue. My status had reset back to how it was at level 1, and I was no longer a Warrior class. I was released from the miserable status that gave me the worst stats ever possible. [Exactly the same as my memory] (Yuuya) In addition, I received a 10 point bonus for each stat and 20 skill points. Normally an average persons stats increased by 2 points and gained one skill point per level. This meant that I had a 5 level and 20 level bonus respectively. [With this, I will be able to aim for the top. To be the strongest again.] (Yuuya) I walked to the fountain in the middle of the room, and looked my reflection. I saw the same 36 years old middle-aged face. However, this time it looked full of vitality, as if it was a young adult who had the face of an old man. [I am convinced now. That the reincarnation was real.] (Yuuya) Apparently I was reincarnated into a world similar to the game that I had played, and lived without any memories of my past life. It was a blessing in disguise. If I had my memories right from the beginning, I wouldnt had been able to adapt to this world. It would had been impossible to fight monsters and endure the rice in this world. [Looks like I have finished my first round in this world.] (Yuuya) Normally it would be a disaster to have your level reset back to one as an adventurer. It would be impossible to accomplish anything and death would come before you even hit level 50 again. Normally. With my accumulated experience as an adventurer from round one, and my knowledge accumulated from my previous life. If they are used together, nothing is impossible. I will be able to become much stronger. It is about time I was rewarded for my efforts. There are many things I want to do, but for some reason, I know that I absolutely must not abandon this girl. [I wasnt planning to anyway] (Yuuya) I placed a mantle over the girls body. This was the start of my second round in another world. Volume 1 - Chapter 3: The old man who picked up a girl The Phenomenon that allows a person to reset their level back to one, with additional benefits. Their status will be reset to the values it had when the person was level one, with a boost of 10 points to all stats. An average person gains about 2 points to all stats per level, equating to a total of 98 points when they hit the level cap at 50. In comparison to the values lost to gained these 10 points, it may be insignificant. However, what made these points significant was the fact that they were bonuses, and whenever that person who manages to hit level 50, they will have an additional 10 points above everyone else. In addition, the person will be granted an additional 20 skill points. One skill point is granted every level, leading to an additional 20 levels in terms of skill points above everyone else. Both these factors give an overwhelming advantage for someone who is aiming for the top. [Although, it isnt a laughing matter for a 36 years old man to be level 1. Normally, an adventurer who is level 1 enters a dungeon for the first time at an age of 11. If that is the case, they would achieve level 50 by the age of 27. Following this rate, I would already be 52 years old by the time I achieve level 50..] (Yuuya) Although I know that wont happen. When I started adventuring, I was just a mere adventurer who was trying to earn a living. I was desperate to stay alive back then. I couldnt just throw my life away seeking adventures, there were many things I had to do besides becoming stronger. However, more than anything, I was completely clueless back then and had to learn everything from scratch. The adventuring life is not a kind one. Adventurers are competing for resources, hunting the same monsters in the same dungeons for the same items. Even completing quests that are the same just to earn a living. So newcomers are often left in the dark as veterans wouldnt teach the art of adventuring to beginners in order to secure as much resources for themselves as possible. Back when I was an exclusive adventurer, I was one of the minority who were willing to show the ropes to beginners. I wasnt too concerned about sharing the limited resources and took on the responsibility of mentoring new adventurers. Another reason why veterans avoided teaching beginners was the fact that it was just outright annoying. Newcomers had to be helped with everything and because even simple mistakes could had dire consequences. Strict supervision and multiple checks were required. However, that is not the case for me right now. I am not new to the adventuring lifestyle nor will I make simple mistakes. I have a large amount of savings as well as the equipment necessary to keep myself safe. In other words, I have the experience accumulated in this world from my first round, as well as the memories of my past life. With these, it wouldnt even take me three years to achieve level 50. After that, I will challenge the Tower of Trials. However.. Before any of that.. [What am I supposed to do with this girl..?] (Yuuya) Whether it was my experience living in this world or my past lifes memories, I have never seen nor heard about a girl who was trapped in a giant crystal. She looks just like an event character, but I dont recall an event where a girl was trapped in a gigantic crystal back in the game. Such an event didnt exist in the game. Now that I have the memories of my past life, I can tell that the girl has the tail and ears of a fox as foxes didnt exist in this world. There were many demihumans that existed in this world. Dog-kin , Cat-kin, Elves, Dwarves and dragonoids. However, fox-kins were not one of them. Well regardless, I should take her away from this room. If I were to leave a defenseless girl in the middle of a dungeon like this, I would feel guilty for the rest of my life. She probably didnt need to eat any meals when she was trapped in the crystal, but now that she isnt, whats there to say that she didnt need nutrition to survive? If she were to leave the room in search for food, and got attacked by a demon, there would be no one to help her. I took the mantle that was used to cover her body and wrapped her instead, and started carrying her. Heavy. The weight wasnt from her body, evidently by her small stature but rather the level reset has reduced my strength significantly. It has become much more difficult to perform intensive activities just due to my decrease in stats. I smiled to myself. I am glad to have this heavy body. It is proof that I will be able to become stronger from now on. Turning my head around the room, I saw a blue vortex hidden behind the statue. The magical vortex was a teleportation device which only appeared in the deepest area of the dungeon and anything that enters it will be teleported back to the entrance of the dungeon. This was convenient as adventurers who enter dungeons for hunting items can escape the cave with lesser baggage than they had when entering the dungeon. It is especially dangerous to retrace ones steps after travelling this deep into a dungeon considering the fact that all consumables would likely be depleted at this point. In my case. The situation was worse, as my level was reset to one. If I came back the way I entered, I would die one hundred percent of the time. I jumped into the vortex while carrying the girl, and felt the sensation of being teleported to another location. Leaving the dungeon is easy, but the hard part has yet to come. The path to the village is filled with demons about level 20. I have to remember to avoid them at all cost. . . . Well I made it home safely. I placed Raptor in a stable and pampered him for awhile. I pet him and fed him a lot of water as thanks for his hard work. Thanks to his hard work, we barely managed to make it back to the village. We encountered multiple demons on the way back as expected. I thought that Raptor would be able to outrun the demons easily. However, I forgot to account for the girl as his movements became much slower and we were nearly caught multiple times. I had even considered throwing the girl as bait for us to escape, but luckily it never came to that. [Well now what do I do with this sleeping beauty.] (Yuuya) It would be simple for me if i could just pushed her into an orphanage in the village, but judging by her looks, she seems to be about 13 or 14 years old. It would be impossible as the orphanage only takes children up to the age of 12. I myself was raised in the orphanage and kicked out when I was 12. As long as her age is unknown, it is impossible to give her to the orphanage. Sigh, if only the girl was capable of surviving on her own. It is likely that she wouldnt survive on her own since she had been encased in the crystal until I found her. Well no point thinking too hard about it, Ill just ask her about it afterwards. While waiting for her to wake up, I left the house in search of dinner. You know what they say. Days where you dont have time to drink, are days you enjoy a special meat pie. . . . Night came and the girl was still sleeping soundly. I was planning on waiting until the girl woke up, but my hunger started to take over as I lit a fire in the furnace and began heating up the meat pie in the oven. A delicious smell resonated throughout the house as the meat pie started to heat up. *grrgrrgrr* Suddenly I heard the sound of a stomach rumble. However it wasnt mine, but the girls stomach. [You finally woke up?] (Yuuya) The girl finally woke up. She had one hand grabbing the towel I used to cover her body and her ears twitched back and forth. It was a gesture just like a pet, and it was extremely cute. [Uncle.. Who?] (Girl) [Uncle is an adventurer. My name is Yuuya. I picked you up in a dungeon that I visited. What about you? Whats your name?] (Yuuya) [Me..? Im.uhhhwho?] (Girl) The girl started to scratch her head and wobbled back and forth. It looked as if she was a bubblehead. I expected this could happen as she appears to have amnesia. It was the worst case possible for her as she would not be able to survive alone in this harsh world. [Well this uncle doesnt know either. For the time being, lets have dinner. You are hungry arent you?] (Yuuya) I took out the hot meat pie from the oven and cut it. Afterwards I took out two wooden mugs and prepared cheap ale for myself to drink while preparing milk for the girl. I placed the mugs and the meat pie on the table. The girl noticed the food and walked over to the table sloppily, although she seems to be wary of me. Her eyes seem to be inspecting me as well as the food on the table [Uncle, can this be eaten?] (Girl) [Yes it is. It was too big for me to finish by myself so I cut it for us to share.] (Yuuya) The girl inspected the meat pie carefully before sniffing it. After seemingly confirming it was safe to eat, the girl picked up the meat pie and bit into its contents. Her eyes started to quiver and shone brightly. Her whole body was shaking and her tail moved back and forth furiously. It was extremely cute. [Is it delicious?] (Yuuya) [Yes! It is extremely delicious!!] (Girl) [Hahaha thats good. Eat up then. There is plenty more for us to eat in the kitchen.] (Yuuya) Watching the girl eat the meat pie so wholeheartedly made me hungry as I picked up a slice. This scene made me realize, how soft-hearted I have become. Back in the days, I was only trying to survive. I was so desperate that I had never looked out for others. Most likely, I would had abandoned even this cute little girl for my own life. However, I became an exclusive adventurer and learnt to nurture the new generation. When I realize that I could use my own power to save the lives of others, I felt a new sense of joy that I had never felt before. Ah wait a minute At this rate shes going to finish the meat pie Hey the meat pie is for me too. Dont finish everything by yourself!! Sigh do all girls her age eat like this?? In the end, the girl ate about 70% of the meat pie and was drinking her milk deliciously. [So did you remember anything about yourself?] (Yuuya) The girl shook her head. [Sorry, none at all.] (Girl) [Sigh I figured as much.] (Yuuya) I expected this to happen. If it was this easy to remember lost memories, amnesia would not be a serious condition. Thats why I am going to give the girl three options. [From now on, you have three options. First, you can leave this house and survive on your own] (Yuuya) The girl started to cry as I gave her the first option. She was a cute girl who had no memories and nobody to rely on. If she were to be left alone in the world, she will be in danger. The world is not so gentle that a little girl like her would be able to survive by herself. In addition, there will be many men who will be looking to chase after her, especially slave traders who would earn quite a price showcasing a new species of demihuman. [Could you please tell me the other 2 options?] (Girl) The girl is surprising perceptive, instead of crying about the first option she was able to positively ask about the other two options. [Second, with my recommendation, I can get you a job at a local bar.] (Yuuya) The owner of the bar was always complaining about the lack of personnel. If I introduced her to him, I am sure he would be pleased so long as she was a competent worker. This could also increase the sales of the bar by having two showgirls instead of one. [Bar..?] (Girl) [Do you know whats a bar?] (Yuuya) [Yes. It is a place where people go to drink and eat.] (Girl) It appears that even though she lost her memory, she still retains the basic knowledge and common sense of this world. Come to think of it, the reason why I managed to remember my memories was because she kissed me back in that room. It is pretty unfortunate that the person who helped me remembered ended up forgetting. [Dont worry. The father who owns the bar is a good person. He has a daughter about your age called Nikita. They will definitely welcome you with open arms so long as you try your best and dont cause any trouble there.] (Yuuya) Although I was introducing her to the bar, the introduction would be useless if she wasnt a competent worker and caused more harm than good. [I see.. It is definitely much better than the first option. May I know the last option?] (Girl) [The last option is to be an adventurer together with me. Earn a living by getting items from dungeons or searching for treasure chests. Well since we are both level one, it would be as if we were a novice party starting from scratch.] (Yuuya) It sounded less ridiculous in my head. Normally I would never invite a person to my party without accessing their abilities first. I also know firsthand how dangerous it is to allow incompetent members into my party. However, I felt that I needed to be in a party with this girl for some reason. In addition, there is a chance that she is an event character outside of my previous lifes knowledge. If that was the case I would definitely like to keep her close to me. However. [Obviously this option is much more dangerous than the second. It is also a fact that it would be difficult for a young girl like you to be in the same starting party as an old man. So I do not plan to force you onto any decision. You have to make the choice yourself. Choose any of the options you deem fit.] (Yuuya) The girl started to consider her options. With the lack of knowledge about the outside world, this decision could be considered harsh to force onto her. Irregardless, 9 out of 10 people would choose the bar. It is the safest route without any risks to the persons life. [I choose to be an adventurer. I will try my best to be a good adventurer!] (Girl) [May I ask the reason why?] (Youya) [Uhh.. I am afraid of being alone.. I dont know anything about the man at the bar but I know that you are a good person!] (Girl) Because I am a good person huh. Her trust in me is feels overwhelming to be honest. [It also looks like the most fun option!] (Girl) [Hahaha so thats it.] (Yuuya) Her response was so unexpected that I couldnt help but laugh. An adventurer actively seeking adventure for the sake of enjoyment. That is the number one quality that all adventurers should have. Or rather, it is the best quality an adventurer can have. An adventurer who seeks enjoyment in adventuring the unknown is an adventurer who can truly call themselves as one. [Then it is decided. We will leave the village at dawn tomorrow and travel to a dungeon that is better suited for our levels.] (Yuuya) The dungeon in this village was too difficult for a level one party to attempt. Even though my level was reset, it doesnt qualify me as the strongest yet. I still require time to train and increase my levels before I can truly become the strongest. [Our destination will be Rumberg. It is a town for adventurers who are just starting out and there is also a facility that allows us to choose our class.] (Yuuya) Rumberg is a town considered sacred by all adventurers as that is everyones starting point. The town contains a facility that allows a person to choose a class such as Warrior and Magician. Such a facility would never be present in a small village like this. In addition, there is a secret room in one of the dungeons there that fixes a persons stat increments to three points every levels. It is a room that I definitely want to go before I grind out my levels. [Okay I understand. Sounds fun.] (Girl) [Lets rest until our departure tomorrow. I am tired now. You sleep on the bed and I sleep on the sofa] (Yuuya) [Hmm? Not together on the bed?] (girl) [Only lovers sleep together on the same bed, we should not sleep on the same bed.] (Youya) [Really? I dont mind if it is you though!] (Girl) [I am an old man you know. I will not and never plan to lay a hand on a girl as young as you. Do I look like a paedophile to you?] (Yuuya) [Nope! I just thought that all men were like that] (Girl) [You are you sure you dont remember anything?] (Yuuya) For a cute girl to say such outrageous things, I am starting to doubt she hasnt recalled anything at this point. Sigh. Whatever, I am tired. I couldnt even think of laying a hand on a child. I lie on the sofa and turn my back towards her. [Hey Yuuya~] (Girl) [What. I am tired] (Yuuya) [I want a name. I dont want you to call me You You You everyday from now on. It would be more convenient to give me a name.] (Girl) [A name huh. I didnt think of that What about Luna?] (Yuuya) I could not think of any names to give her. The only thing of was the meat pie that she ate earlier. It was a specialty of a bar and it had the same name as the shop. [Its a cute name! I like it! From now on, my name is Luna!] (Luna) Well looks like shes satisfied with the name. I am glad she likes it [Well then, now that you got your name, its time to sleep] (Yuuya) We have to wake up early tomorrow, and as adventurers we should rest up as much as we can. Volume 1 - Chapter 4 - The old man heads to the city of beginnings Yesterday, I traveled into a wild cave dungeon in search of a hidden room that was capable of resetting a persons level. In that same room, there was a girl around the age of 13 encased in a giant crystal. After releasing her from the crystal, I brought her home where we discovered that she suffered from amnesia. Unable to recall her name, she requested for me to name her. Now, that girl is called Luna. She was satisfied with her name, saying that it was a cute name. I should probably avoid letting her know that I got the name from a meat pie. Fast forward to the next morning, I am sleeping soundly in my own bed. Originally, the plan was to have Luna sleep on the bed while I slept on the sofa. However, Luna was so adamant about sleeping together that she even crawled onto the sofa while I was sleeping. In the end, I carried her to the bed and got into the bed together with her. After I got into the bed, I turned my back towards her and fell asleep. This girl is either really shameless or just outright bold, wanting to sleep with a man that she had just met the very same day. Could it be that all girls her age are this bold? Well, regardless of her behavior, she wasnt an ordinary girl. She was a girl whom I found encased in a crystal and suffered from amnesia. If anything, she was far from ordinary. Not to mention the crystal she was trapped in was located in a hidden room within a random wild dungeon. Even if coincidentally the entrance to the room was discovered by an adventurer, the person would have to satisfy the requirement to unlock the room. Any adventurer who was level 50, would not have discovered the room as the dungeon level was estimated to be around level 30. Thus, for someone to locate the hidden room, they would require information about the room beforehand. Anyone who had access to such information is definitely not normal. If the person who located the room wasnt normal, there is no doubt that the person trapped inside is not normal too. At this point, I am fairly certain that Luna was a special existence. The very fact that she was a Fox Beastman is proof enough. Foxes didnt exist in this world, and that confused me when I first discovered her. However, once I remembered the memories of my past life, I could determine that her ears and tail resembled a fox. Well that is still a superficial reason though. Truth was I wanted to be in the same party as Luna. My instincts were telling me that this girl must not left alone. As a veteran adventurer, the more experience you have, the harder it is to ignore your intuition. For breakfast, we ate some preserved food that was stored at home for emergencies. After breakfast, we waited outside the front door as I was expecting a carriage to arrive. After waiting for several minutes, a carriage could be seen turning the corner before arriving at my doorstep. Initially, I planned to leave this village and return to the countryside. However, I only intended to bring the essentials as well as my valuable magic items such as my Magic bag (Capacity:Large) and my Magic Sword. It was a routine for adventurers who were changing their base of operations or retiring to sell off their furniture and other items to merchants in the area. In my case, it was the latter. This was a well-accepted practice as it allowed the adventurer to earn a large sum of money while the merchant obtained excellent second-hand goods that were more likely to be beneficial to the merchant either for resale purposes or for quality of life purposes as items that are picked up from dungeons are generally classified as Magic items. When I was an adventurer, I had obtained many valuable items from venturing into the dungeons. Although there werent any intentions to use most of the items, it was the norm to hoard as much items as possible as there was a chance for the items to be useful in the future. This does not mean that I did not sell any Magic items as there were still items that were useless for adventurers. I sold many items on the marketplace in my time, however the stockpile that I possessed had never diminished as they were always replenished whenever I entered into a dungeon. I kept valuable items such as my Magic Sword and Magic Bag as they were rare items that almost never appear on the marketplace. These types of items are worth a fortune, however they were not items that could easily be obtained by having money. Normally, I would deliver the goods to the merchant using my Magic Bag as it was capable of storing up to 100 kilograms of items, however as I was also selling heavier items such as furniture, my Magic Bag wasnt able to store all the items, thus I had to ask the merchant to collect the items personally using a carriage. [Good morning, Yuuya-san. As we agreed, I am here to pick up the goods.] (Merchant) [Oyassan, I leave the collection to you, the items are all in the living room.] (Yuuya) The merchant proceeded to collect all the items that I had prepared in the living room and loaded them onto his carriage. [Yosh, thats the last of them. As far as I can tell, all the items that we agreed on are present. Heres the payment.] (Merchant) The merchant handed over a small pouch as well as the parchment detailing the transaction. As I was about to sign the parchment, I spotted an item in the corner of my eye. [Oyassan, sorry but could I keep that dagger?] (Yuuya) [Well its just one dagger. The goods that you sold me were mostly first-class items. That one dagger doesnt matter that much. Go ahead. Ill let it slide as a sign of our friendship.] (Merchant) [Thank you.] (Yuuya) The merchant returned the dagger that I asked for and I took the dagger graciously. After being an adventurer for decades, this was the second best dagger I have ever come across. Its name was Bazerato. Its a lightweight dagger that was crafted from the Fang of a monster. It inherited its offensive properties and durability from the monster it belonged to, possessing offensive capabilities and a durability that was on par to a normal long sword despite being a dagger. For your information, I kept the best dagger in a compartment on my breastplate for emergencies such as my Magic Sword breaking in the middle of combat. I kept it there instead of my Magic Bag as the few seconds required to find the dagger in my bag is a matter of life or death in the midst of combat. It wa also useful for other situations outside of combat. [Here Luna, take this dagger.] (Yuuya) I passed Bazerato to Luna. [This dagger looks expensive.. Yuuya I cant take this dagger, I dont have any money on me.] (Luna) Sigh this girl. She couldnt just receive the dagger without any worries can she. [The money doesnt matter. If you want to be an adventurer, you will pay me with your body.] (Youya) So long as you work hard as my party member, that much is fine. [Huh? Okay.. If that is fine with you. I dont remember anything so its my first time. I dont have any experience so Ill try my best!] (Luna) Lunas face started to turn red as she started fidgeting around. The tip of her tail was sweeping the ground as it moved back and forth. [Eh? You? To such a small child?] (Merchant) [Sigh. Please dont cause any misunderstandings. And you of all people should know that I will never lay a hand on a child. Luna, I meant that you will be working as an adventurer to pay back the money.] (Yuuya) [Phew. Then I will do my best! Together with Bazerato!] (Luna) Luna seems to be excited about using Bazerato. Its a good thing that she has taken a liking to it. Based on her body structure, it would had been difficult for her to handle a normal sword. So it was best for her to utilize a short dagger which is easier to use. Bazerato is a powerful dagger because it does not have any level requirement, meaning that even a level 1 adventurer could equip it. Although the dagger itself is powerful, I need to remember to teach her how to properly handle the dagger as well as sword techniques. [Anyway, it appears that you have picked up another brat again. You never change even as time passes by huh.] (Merchant) [Well that is how I am, I cant help it.] (Yuuya) My relationship with the merchant goes back to my adventuring days. Back in those days, I was a relatively well-known adventurer. Once, I had participated in a quest to rescue an Elven village from pillagers. We were both in the same group and in the end, the quest was successful with us managing to save a bunch of elven girls from being kidnapped. Among those elven girls, was Phil. The clothes that Luna is wearing now were the exact same clothes I gave to Phil that day. Phil grew up as an adventurer, in the same party as me, alongside Leonard who is revered as hero in the current era. The same party that I had abandoned. [Well then I wish you guys good luck in your future endeavors. Oh before I leave, remember to sign the parchment.] (Merchant) After quickly revising the contents of the parchment and the pouch, I signed the parchment and returned the parchment to the merchant. [Now then, I hope to see you again, Yuuya.] (Merchant) [You too. Oyassan. I wish your business runs smoothly. Isnt it time for you to leave the business to your son?] (Yuuya) [Dont be crazy. I am still up and active you know. Different from a certain someone.] (Merchant) I smiled bitterly at the merchants retort. I forgot that I told him I was retiring today. However, my retirement plans ended yesterday. Now I will be restarting my adventures. Part 2 Before heading over to Rumberg, Luna and I travelled on Raptor to a neighboring town where we paid for a caravan that was heading towards our destination. The distance to Rumberg was too far for us to rely on Raptor for any battles that might occur, so I decided to travel there with a caravan instead. For caravans, although we were required to pay a fee, we had escorts that served as our bodyguards during the trip. So our safety during the trip was guaranteed. However the downside was that the caravan travels at a slow pace. Most likely, it would take us two days to arrive at Rumberg. As I looked back from the carriage, the village could no longer be seen in the distance. When I left the village, one of the people who came to see me off was Nikita. She cried as I was preparing to leave, telling me that she wanted to follow me. She was willing to leave behind her family and the bar to accompany me on my journey. However, I could not allow such a child to abandon her family and their business just to follow me. After trying to convince her for half an hour, she finally gave in and accepted my departure. After arriving at the town, Luna and I joined the caravan where I was offered a high price for Raptor. Although the amount was tempting, the bond I had with Raptor was priceless and rejected the offer. I feel that I am starting to become sentimental. Is this because of my age? [Yuuyaaa. Imm boreddddd.] (Luna) While I was lost in thought, Luna was fed up with the journey. [The trip will only last two days. It wont be long.] (Yuuya) [But the trip is boring!!!] (Luna) Well this caravan is unusually large, and there is a large number of escorts. So its expected that the journey will take quite a while. For a child like Luna, it would be quite a dull trip. [Well then let me explain to you about what we will be doing when we arrive at Rumberg. We will have to do a bunch of administrative matters, attending classes and meeting other people as well as select our class.] (Yuuya) [Tell me about the classes!] (Luna) Luna whose tail looked like it was about to fall asleep became lively as it stood up in anticipation. [Adventurers are capable of raising their levels by defeating monsters to earn experience points. However, they will be unable to gain experience points unless they have a class. Thus a class has to be chosen before an adventurer can start increasing their levels. Normally the class chosen will be set for life, meaning that the class will be the persons specialization for the rest of their life. It cannot be changed so it should be chosen carefully.] (Yuuya) [The status for each classes differ accordingly to their battle styles. There will be a class correction value added to a persons status depending on their class, adding additional values into various stat parameters. These class correction values added on top of the persons basic status determines their final status.] (Yuuya) [Each classes serve a specific role in a party. Generally speaking, there is the vanguard, and the rear guard. Vanguard classes serve as the front line for the party, directly confronting monsters and serving as a wall for the back line whereas the rear guard classes directly attack the monsters as well as cover the front line.] (Yuuya) [Easy to understand. Luna wants to be a vanguard! Youya gave me a dagger, I want to use it!] (Luna) Truth be told, Luna is suited to be in the front lines. Back when I was playing the game, Beastmen were characters that were only NPCs and unusable for players. It was possible to become friends with NPCs, and the characteristics for NPCs was discovered. Beastmen had increased physical capabilities whereas their magical abilities were decreased. These were stat corrections that are well suited for the vanguard. [Since you want to be a part of the vanguard, I will explain the different classes for the vanguard. Generally, the vanguard have weak magical capabilities but high physical capabilities. The common classes are Warrior, Fighter and Thieves. Warriors specialize in attacking and defending, with high values in their Attack and Defensive parameters. However, as a result their Speed parameters are decreased. Fighters specialize in hand-to-hand combat, having higher Attack parameters and Speed but only to a limited extent. Thus, even if they equip powerful weapons or strong armor, their overall capabilities does not change that much. On the other hand, Thieves have high Speed parameters but their Defense and Attack parameters are decreased. In exchange, they are given special class skills called Exploration Skills.] (Yuuya) [eehhhh.] (Luna) Luna looked as if her brain was overloaded and unable to take in the information. She tilted her head as she tried to understand the information and failed. [Youya~, are there any other classes?] (Luna) [There is another class called Magic Knight. It is a class that has a high Attack parameter and is the only class capable of using magic.] (Youya) [Thats the class! It looks like the strongest class to take!] (Luna) [I am going to stop you right here. That class is out of the question for you. Although it is a class with high Attack parameters and capable of casting magic, that class has a lower Defense parameter as well as physical capabilities as compared to the other classes. It cant use Wall either. And although magic can be used, the spells it can used are limited to Intermediate tier. Intermediate magic is far weaker than Advanced magic used by Magic Casters in the back lines. Magic Knights are capable of using offensive magic as well as supportive magic, but they cant cast recovery magic, making their supportive magic far inferior to a normal healer. It is a class capable of doing everything, yet it is weaker than every other class. It is merely a half-baked profession that cant be used in any role.] (Yuuya) The job of the vanguard is to protect the rear guard, while the rear guard covers the vanguard. Magic knights are unable to act as a shield for the rear guard due to its low defensive capabilities as well as the inability to use Wall. However even if the magic knights was delegated to the rear guard, it is merely an inferior magician. In that case it would be better to choose a full-fledged Magician. Thus magic knights are looked down upon as a weak class and no parties will be willing to accept them into their party. [I understand. Only choose from Thief, Warrior and Fighter. Hey Yuuya..] (Luna) Luna dropped on all fours, and crawled towards me while looking me dead in the eyes. [What class do you want Luna to pick? I want to serve Youya. I want to be useful to you.] (Luna) What is this girl doing? Telling me that she wants to serve me with such a cute face. Well if its a class I would like [If its a class I want in my party, it would be a Thief. Venturing into the dungeons become more convenient if our party has a person with exploration skills.] (Yuuya) [I understand, then when we arrive at Rumberg, I will choose the Thief class. Then I can be useful to you!] (Luna) [Yeah, I would be happy if you did so. I very much would like you to be the Thief in my party.] (Youya) *Bun**Bun* Lunas ears fluttered up and down. [Pleasing Yuuya is my number one joy!] (Luna) Shes a good kid isnt she. Although what is with her choice of words? Is she sure that she doesnt remember anything? Anyway, I am glad that I gave this girl a dagger back in the village. Thieves typically utilize daggers as their main weapons, thus their attacking capabilities are naturally lower as compared to a normal sword. Especially with her compatibility with daggers, I felt that Luna was well-suited to being a Thief. My thoughts were interrupted by the sight of a town appearing in the distance. [Hey Luna, look outside the window.] (Yuuya) [Hmm? Whats outside?] (Luna) Luna opened the windows and tried to squeezed her head out of the window. Her fox ears fluttered in the wind as she stuck her head outside. [Ah! I can see a large city. It is soooo much bigger than the village Yuuya was in! And the wall surrounding it is so large too!] (Luna) [Thats our destination. Its the beginning town of Rumberg.] (Yuuya) Rumberg is not just the beginning town for adventurers. It is essentially the essence of the country. The country itself revolves around the nurturing of adventurers, and most adventurers start out here to get their classes before becoming actual adventurers. Although there are other beginning towns for adventurers, there is an important reason why I chose this popular town. Based on my memories of the previous life, there is a hidden room in one of the dungeons here which fixes the level bonus for all stats to the maximum, 3 points per level. Finally, I can free myself from my cursed status. As I was staring at Lunas fox tail shaking back and forth rapidly, Luna pulled her head back into the carriage. [Yuuya, what class are you choosing?] (Luna) [Magic Knight.] (Yuuya) [Eh? But didnt you tell me that Magic Knights had the weakest class?] (Luna) [Yes I did, and its the truth. Magic knights have the weakest class regardless of their role. They are too fragile for the front line, and too weak for the rear guard. It is the class that can do everything but cant do anything. It is the weakest class. If the person wasnt me.] (Yuuya) Even when I was playing the game, the main player base had deemed Magic Knight to be the weakest class without a doubt. Although they were given recognition for the fact that they were able to cast supportive magic, it wasnt anything too spectacular. That is, until the Level Reset function was discovered. When it was discovered that a persons level could be reset, another hidden feature was discovered. That feature, was given the name Magic Customization. As a result of that feature, the Magic Knights popularity rose tremendously. It was the class that had the potential to become the strongest in the hands of a skilled player. However, because of this, more people avoided inviting magic knights into their party. The class popularity grew as more people wanted to try out the class. As a result, there were many Magic knights who were still weaker than an average player using a common class. It was basically a gamble, and Magic knights was an all-in. [Well even if the class is weak, Yuuya is still strong!] (Luna) I am glad that Luna was just being Luna. If it was anyone else, I would had been abandoned on the spot. I am lucky for the presence called Luna. We were about to arrive at the city. Now, is truly the start of my second round. Volume 1 - Chapter 5: The old man finds a piece of the strongest weapon I opened the door to the Temple of the Primal Flame located at the bottom of the dungeon. Unlike the display at the entrance of the dungeon, there werent any monsters waiting to ambush its door but rather, a mysterious organ began to play as a candlestick in the center of the temple decorated with jewels emitting an ominous red light. [Its beautiful.] (Selene) Selene let out her voice in astonishment at the Primal Flame. That was the item that would allow Flaregards forge to continue running, however, we couldnt immediately retrieve the candlestick early. Reason being, that the last test hasnt begun yet. [Everyone. This is the last test. Dont forget that you wont be able to receive any help for this test.] (Yuuya) [Uhn. We understand. Luna has plenty of training from Yuuya so shell be fine alone.] (Luna) [Uhn uhn. Based on what we heard from Yuuya-niisan theres no way we cant clear the exam.] (TIl) [Thats right. Itll definitely be cleared easily.] (Selene) [Yuuya, Itll be embarrassing if they were the ones to clear before we did.] (Phil) I let out a wry smile as it seems I was too worried. It was time to put my faith in these children. [How reliable. In that case, lets go!] (Yuuya) As we approached the candlestick, the music of the organ became louder and louder as the Primal Flame became stronger and stronger, forming the figure of a goddess as she appeared to smile. [Welcome. Adventurers who have cleared the six trials. The seventh trial shall be the final trial to see if you are worthy of possessing the flames of god.] Just as expected, the previous floors were trials which led up to this moment. [The seventh trial tests your inner will. Now display your strength to your hearts content.] As soon as the goddesss monologue ended, the earth began to rumble as I felt the strange sensation of floating in the air as if we were being transferred. In the next moment, I found myself not within the temple but in a black room as I was all alone. This was a test of the individual will, and whoever that passed would be granted the right to bring the Primal Flame home whereas those that fail would lose their lives. [I cant afford to be the last one to clear the trial. Its about time for me to get ready to clear this.] (Yuuya) I sharpened my senses as I tightened my grip on my blade, staring at the person standing in front of me. He had equipment much similar to mine and even had the same face. He was also holding a sword however he had a complete difference stance from me despite possessing the same status as me. Just as the goddess said, this wasnt a test of the persons strength or status, but rather the experience, tactics and discipline, the persons inner strength. Fighting someone who had the exact same skills and abilities you did. As if you were fighting a perfect AI-controlled character in a game, weeding out any adventurers who relied on their powerful equipment and superior abilities to overwhelm their enemies but doing the same back to them. That wasnt the way I had raised the girls which were why they, as well as I, had faith in their ability to clear the trial. There wasnt any way they would lose to themselves who relied on their skills instead of their own innate abilities. Without any hesitation, tricks up our sleeves or secrets between us, we rushed to each other head-on. As we brought our swords up towards each other, the copy activated a skill which was I was extremely familiar with Bash. However efficient it was, it was an extremely predictable skill as its attack trajectory and timing was telegraphed during its activation. At the end of the day, it was still a beginners skill and wasnt a skill used frequently by the top adventurers aside from situations where it would be guaranteed to land. It was all about reading and countering the attack. Rushing into close-quarter combat, I dodged the attack by taking a step diagonally letting the attack pass right past me, raising my blade up to the copys neckline causing blood to sprout out of his neck like a fountain. The copy immediately rose its blade to attempt a second attack as I stuck my blade to the ground, placing my palm onto its chest. [Napalm Strike.] (Yuuya) Heat erupted in an explosion from my palm as the entire copys entire body blew off into smithereens. [There was zero chance of me losing to my own status.] (Yuuya) Even if they had my own status, I wouldnt lose to my own mirror image as they would have died a hundred times over back in the day. In order to survive, I had to possess skills far greater than my status. The face of my copy distorted as a monster-like lump appeared, turning into blue particles. It was a special monster which could only be found in the Temple of the Primal Flame, Mirror Clayman who was capable of replicating its opponent down to their equipment. It was impossible to use the weapons replicated by them though I did hope that I would get their item drop. However, it didnt drop it as I hoped that one of the other girls would be able to obtain it. Just as I was thinking that my thoughts were disrupted by the strange sensation of teleportation as I was transferred back to the temple. Now then, I wonder if everyone made it safely. . . . Feeling the sensation of teleportation on my skin, it seems that I was the first to appear back into the temple. I sighed a sigh of relief as I managed to maintain my dignity as the teacher of essentially the entire party. Shortly after, I saw a second silhouette as Phil returned to the temple. Although she only took slightly longer than I did to return, her condition was so tattered that I wouldnt call it a clean victory. [Are you okay? I thought that if it was you, then you would clear the trial relatively easily.] (Yuuya) [If I was even half a step slower, Im sure that I would have been dead.. Speaking of which I was surprised. I didnt think that it would start the battle with that technique.] (Phil) [Is that technique something I should know of?] (Yuuya) [Druids arent just capable of granting attributes and supportive magics. There are also lethal techniques that could be used against others and the image tried to use it at the beginning. In hindsight Im glad I got to see it although I myself didnt get to experiment with it.] (Phil) In regards to Druids, I am completely clueless. I have never seen a druid even back in the game era. [If its that strong, then itll be a waste if you dont experiment with it. Theres no meaning in learning a skill you wont use.] (Yuuya) [Thats the point. I may not be able to use it but its just an insurance in the event that it is necessary. What it is though, is still a secret~.] (Phil) The fact that the ability nearly took down a first-class combatant like Phil meant that it had quite a significant impact on the battle. I look forward to the moment when she unveils her ability. While I was pondering about Phils ability, my thoughts were interrupted as it was Selenes turn this time to appear. [As expected of Yuuya-ojisama and Phil-san. You finished your battles even quicker than I did.] (Selene) [Im just glad that you ended up completing the trial safely.] (Yuuya) [Most likely, my battle ended up to be the easiest among our party since Renoirs shield was a special equipment, its functions couldnt be replicated.] (Selene) I was worried that her battle would be the tightest battle among the four of them but it seems that hers was the easiest unexpectedly. [As expected of the shield of the battle princess Renoir. Ill have to become a knight worthy of the shield as soon as possible.] (Selene) Selene strokes her shield as she let out a slight smile. [By the way, did the Mirror Clayman drop any item for both of you?] (Yuuya) [There was none for me.] (Selene) [None for me too.] (Phil) [As I thought. The drop rate is horrible after all.] (Yuuya) Based on probability, theres no helping it but theres still a chance as I waited expectedly for the two girls returns. And finally, the two girls returned almost simultaneously as Luna was slightly quicker, causing Til to be upset. [Yuuya, Luna got a souvenir! Look look!] (Luna) Luna ran up to me holding a lump of clay in her hand. The lump of clay was an item called Physical Clay which retains the same properties of the Mirror Clayman, allowing it to change into anything. That is the reason why it was a special item. By making use of its unique property, you could produce a material allowing you to forge a powerful weapon. However, in order to produce the property that I desire, it has to be processed in a specific location and once we arrive at that city, Ill be sure to do it myself. [Well done Luna. As expected of your Increased Drop Rate, its an amazing ability. Thanks to this Ill be able to forge a powerful dagger especially for you to wield. [I look forward to it! Although I still want to use Bazerato even then, can Luna be a dual wielder?] (Luna) I let out a wry smile as she has taken good care of that dagger, however shes far too obsessed with it. [Dual-wielding has its benefits and disadvantages. One critical con is that it is incompatible with the Assassinate style of attacking that uses a persons full body strength. Besides, the new dagger could be created using Bazerato as its base. Since the dagger will be made using bazerato, itll be the same as bazerato being recreated.] (Yuuya) [That is fine! Bazerato is Lunas treasured item from Yuuya to Luna and Luna wants to use it forever!] (Luna) Lunas tail shakes back and forth as she hugged her own fluffy tail. As usual, Lunas gestures are always adorable. Behind her was Til who was rushing towards us. [Ugg, I cant believe Im last place.] (Til) [Its more important that you won the battle. Its proof that youve become a first-rate adventurer.] (Yuuya) [But I still feel bitter! Next time Ill be the first! Lets leave the temple and restart the trial!] (Til) [Unfortunately, this trial can only be taken once in your entire life.] (Yuuya) Hence why the Mirror Claymans item drop is precious. With a drop rate of 20% there was a chance we would never get it. [Speaking of which, I got an item drop too.] (TIl) [Thats great news. Its possible for the item to turn into a material for something other than a dagger. Since you got the item, is there any specific equipment you want to use it for?] (Yuuya) [In that case, something that improves my attacks!] (TIl) [Ill have to find something that works then.] (Yuuya) Luna and Til began their strange dance as their expectations to their future equipment skyrocketed. Now then, since everyone is back its about time for the main event to start. Just as I thought, the goddess of flame appeared in front of us once again. [Brilliant work. Congratulations on succeeding against all of the trials placed for you. The primal flame shines bright onto your future.] The goddess begins to fade as the candlestick shines brighter and brighter. After picking it up, the candlestick disappears as a blue vortex appears to take its place. [Now then, lets go back. After completing the quest, shall we head to the hot spring one last time? Since were departing tomorrow, it feels fitting for us to enter the hot springs one last time.] (Yuuya) [Lets go! ] (Luna) [That sounds great! I want to soak in the hot springs and drink a refreshing cool glass of juice!] (Til) [On the other hand, I want to perform some maintenance on my armour since this time I had received a large number of attacks. My armour is about to be unusable if it isnt repaired.] (Selene) [In that case, its probably better for you to get a whole new set of armour. Since theres a large variety of rewards possible for us, we could probably get a bunch of first-class armours for ourselves.] (Phil) It has been a difficult battle but its great that everyone was managed to get through safely. Although Im sure that the guild would be surprised that we managed to clear the dungeon in two days, we may even be able to meet the next party of adventurers who were waiting for us to return with the Return Stone. Volume 1 - Chapter 6: The old man leaves Flaregard We managed to get our hands on the Primal Flame from a dungeon that was equivalent to an expert dungeon for the best adventurers. Not only is the True Clay valuable, but more importantly the experience we got from successfully clearing a dungeon of this magnitude. With this item, we will be able to increase the quality of Lunas equipment by another level. Although I wasnt quite fond of the progress we made in that dungeon level-wise as only Phil managed to gain a level despite the fact that this special intermediate dungeon had earnt us a least a month-worth of experience if we remained in Flaregard. Entering the blue vortex, we were returned to the entrance of the dungeon. In other words, back in the guild. The guild staff who were present at our arrival instructed us to wait as they rushed back to the offices, coming out not with the usual receptionist but an executive of the guild. [How far did you make it? Please tell me that youve at least made it to the fourth floor. Itll be a huge relief on us if you did since itll make the rest of the dungeon much easier once you return.] (Executive) I knew that he wasnt being disrespectful, I couldnt help but feel offended by his words. Although it seems that were the only party be tasked to complete the request. The number of monsters in the dungeon was much higher than a usual dungeon which meant that a partys resources would be used up much quicker. Even with Me and Phil leading the way, finishing each battle as efficiently as possible while relying on Lunas Presence Detection to avoid any unnecessary battles, we still used up all our resources before reaching the end of the dungeon by being frugal. Such was the level of a dungeon similar to advanced dungeons. [Ill answer that question.] (Yuuya) In response, I took out the Primal Flame from my magic bag. Note: The flame itself is actually a lantern but I felt that it would be easier to just omit the lantern. [I never thought that you would clear it in two days..] (Executive) [Its the opposite. I cleared it because I only had two days.] (Yuuya) Since I didnt have that much time to remain in Flaregard, we only had two days to finish the request to catch up with the caravan. Additionally life in an advanced dungeon was a stressful one. The only proof one needed was to witness how sluggish the girls aside from Phil were behaving right now at the end of the second day as they barely managed to clear the dungeon. Hence this was an irreplaceable experience for us to have right before breaking through the intermediate to advanced rank. After listening to my response, the guild members found themselves tongue tied as they began to smile. [Hahaha. Im sorry. It seems that Ive been misjudging you from the beginning. From the bottom of my heart, Im sorry and thank you. Now then, lets talk about the rewards for this request. FIrstly, you can keep the return stones. Truly thank you. As expected of the hero Leonard, only someone like him could introduce someone to become the new saviour of our city.] (Executive) [Sorry..? Could you tell me the details?] (Yuuya) Did I just hear something outrageous? The person who recommended us was Leonard? [Didnt you hear about this? Initially we had requested for the Heros party, Leonard to fulfill the request. However he gave me a counter proposal, stating that there was a party in the city that was capable enough of completing the request. And that if they were to fail, they could send another message and they would travel here to finish the request themselves. The rest happened as youve seen. Now that youve cleared the dungeon, there isnt any reason for the heros party to step up. I hadnt had any faith up until now but your party actually managed to clear the dungeon at your levels.] (Executive) How much about us does Leonard actually know? I cant figure out whats his objective either. However this does answer some lingering questions I had towards the guild. Why wasnt the guild surprised at the fact that we had five members in our party, why they hadnt advised us on the riddle in the dungeon and most importantly, why did they delegate such an important request to a party that had relatively low levels to the dungeon itself. [That was the situation. Even if you had failed to complete the mission, we would be able to rely on hero Leonard to complete the dungeon which was why I ordered the receptionist to hand you a Return Stone. Lets head over there to settle your reward as well as the matter about your raptor carriage.] (Executive) Frankly speaking, this situation doesnt appear as appealing to be as before, but I wont be complaining either. It was still a quest with an attractive reward, and I am about to receive that reward. .. And Ill be sure to send Leonard a letter myself. One of the services provided by the guild is to contact other adventurers after all. Itll be difficult for adventurers themselves to locate other adventurers throughout the year since we had an extremely mobile lifestyle. However parties had to register themselves at a guild to complete or accept a request, and that information is being shared throughout the guild making it much easier for the organisation to contact a specific adventurer. . . . After obtaining the rewards, we proceeded towards the shopping district. I went around replenishing our supplies such as recovery potions while Til bought an accessory which originated from the dungeon, providing its user an increased resistance against stuns and improved concentration. Selene had went to the armorsmith to purchase a new set of armour rather than repair her old broken set. Her new set of armour was rather spectacular in performance as well. It was a set made of leather from a monster which was rather flexible and resistant against flames that covered the whole body. Not only is the leather strong against sharp weapons and attacks, even her vital spots were protected by another layer of magic metal which were rather lightweight and durable as well. It was a seriously impressive set of armour, allowing its wearer to move around easily and fight much longer due to its lightweight. Im sure you wouldnt find anywhere else but Flaregard. Thus, shortly after obtaining our rewards, we had already spent all of it. In fact, I even had to take a chunk out of my savings in order to supplement our shopping spree although it was fine since it was unusual for a single request to cover the cost of a full-body armour and a magic accessory. Now that we were done with our shopping, we carried our exhausted bodies towards the hot springs where we ate a delicious meal. [This is happiness~ Delicious food and hot springs. Luna wants to stay here forever~.] (Luna) [Me too~. Its like heaven here.] (Til) The two girls seem to enjoy Flaregard as I smiled wryly. [Its true that their hot springs are the best. But if we travel around the world, well be able to find other hot springs and even delicious food that you would never be able to find here. So long as we keep moving, well be able to discover more blissful things in other towns.] (Yuuya) [Luna looks forward to it! Luna, wants to find even more wonderful things!] (Luna) [As expected, it was a great idea to escape from the village! Although they had plenty of amazing things there, there are even more amazing things outside of the forest! Speaking of which, if we ever come across my home village, Ill be sure to introduce everyone to all the best food youll ever eat!] (Til) [Til, there are delicious food there too? Luna is interested!] (Luna) [Fufufu. They are many things that youll never find outside of an elfs village. If we ever travel to an elven village, well bring you plenty of delicious food! Well oneechan will!] (Til) Til looked towards Phil with a smug look as she pushed the responsibility towards her sister. Luna began sticking her body out towards Phil as she looks directly at her with drool flowing down her mouth. [Looks like I dont have a choice. If we come across our village, then Ill be sure to prepare all sorts of elven dishes. Please look forward to it.] (Phil) [Thats great! Since I specialise in eating.] (Til) [Sigh, I wonder what will happen once I get a brother-in-law.] (Phil) [No way, that will never happen. Our journey isnt over yet! Until our adventures are over Ill be by yours and nii-sans side!] (Til) [Luna too!] (Luna) Are they freeloaders!? They seem so excited and frankly enjoying themselves like this. Although looking at this spectacle, Selene seemed to have a glint of loneliness around her. [Selene, its too early for you to worry about the future.] (Yuuya) [Thats true. But I cant help but think that itll be great if this could go on and on without ending. Is that weird of me to think so?] (Selene) [No. That isnt weird in the slightest. At the very least I dont think so.] (Yuuya) Our current party was the most enjoyable party I have ever had. However even this would come to an end soon. At that moment, well have to choose the option that will leave behind the least regrets.. . . . On our way back towards the guild, it seems that there were several people following us from a distance. Im surprised the children hadnt noticed them, especially Luna who not only had the ability to detect nearby presences, but was also the sharpest naturally. However, it seems that they were still unable to fool Phil as Phil sent a glance towards me. [Yuuya, once we return please brush Lunas tail! Everytime you brush Lunas tail, it becomes so light and fluffy!] (Luna) [In that case I want a lap pillow!] (Til) The two girls continued their rowdy requests ignorant of our guests as Phil sent subtle signs while continuing the conversation. According to her, it seems that the targets were Luna and Til. At this rate, itll be rather tiring to continue towards the guild while being mindful of their movements. Perhaps displaying an opening here might be for the best. [This way, I know a shortcut.] (Yuuya) I deliberately led the girls towards a less crowded area as I wondered whether they would follow us. The answer to my question came quickly after as I felt their presence quickly approaching us. This persons presence feels familiar.. Oh. It seems that my warning wasnt sufficient then. The years must have been mellowing me out as I grabbed across Lunas shoulder with my arm, rotating a full 180 degrees as I threw the dagger holstered under my armpit. A scream came out as I turned around, the boss of the Crimson Hounds was standing there with a dagger imbedded into his hand, and another on the ground. The instant I turned around, he had already began rushing towards me, however, it was already too late. I took a step forward as I pulled my sword out of its sheath and raised it. Before anybody realised what happened, a right hand could be seen flying through the air. Meanwhile his two lackeys who were behind him had began their escape. [I thought I had already warned you. That the next time you try to lay a hand on any of my girls, Ill kill you. It wasnt an empty threat.] (Yuuya) [HIIEEE. Stop it please, I ju- just want to talk.] The boss began pleading as he held where his right arm should be. [Let me understand your intentions then. Rushing towards someones back with a knife in their hand is your way of starting a conversation? In that case, let me give you my greetings.] (Yuuya) [No.. please. I dont want to die.. Someone save me.] [Im a naive person. However Im not stupid. Once I get bitten, Im twice as shy.] (Yuuya) It seemed that he reached his limit as he tried to escape.. But he couldnt even take a step as his waist was separated from his torso. [Is everyone okay?] (Yuuya) [Luna is okay.] (luna) [Im alright too, Yuuya-niisan.] (Til) Although their words said one thing, their faces showed another as I hugged both of them tightly and began stroking their heads. The shock of having someone cut down in front of them must have been difficult. [Yuuya-ojisama. Shouldnt he be arrested right now? Why did he even consider attacking you despite the gap he should have experienced in the dungeon. He knew that he couldnt win.] (Selene) [By paying a large sum of money, you could be released on parole. And Im sure you know what was on his mind.] (Yuuya) I let out a huge sigh. As a veteran who has led numerous adventurers, I believed that everyone made mistakes. That was what made them human, which was why I believed that they could learn from their mistakes as well. However, people like him were the reason I decided that one chance was all they would get. Rather than learn from his mistake and changing his ways, he fell even further, becoming hellbent on revenge. Hence paying what he could afford to be placed on bail and tried to retaliate against me who had humiliated him. He understood the difference between us from the previous battle and decided to aim for a hostage instead, aiming for Luna. Ideally he was waiting for the moment when Luna was alone in order to defeat her with numbers, however he realised that it was never going to happen and decided to attack. [Im sorry, Luna and Til. For not settling matters properly, and having to show you something like this.] (Yuuya) [Yuuya doesnt need to apologise. Yuuya protected Luna.] (Yuuya) [Were adventurers too. We should be used to this sort of things. We dont mind.] (Til) Although their words made me happy, this was an incident that shouldnt have happened in front of them. [.. Thank you. In any case, lets head back to our room in the guild. Ill report to the guild about what happened today. Although something unexpected happened today, lets rest well tonight and prepare for our departure tomorrow.] (Yuuya) Being conscious of my tone, I lightened up my tone as everyone continued walking to the guild. Even now, I hoped that my policy of second chances was right.. I dont want to change it as it was what I believed in. However, if I have to go against that policy to keep these girls safe, then Ill do it to avoid any unnecessary risk. I would never be able to forgive myself otherwise. . . . The next day, I received news from the guild regarding the incident with the Crimson Hounds boss and it seems that my actions were deemed as self-defense as he didnt actually pay the bail, but escaped from the authorities. The Crimson Hounds had attacked his envoy as he was being transferred somewhere. The envoy was critically wounded and thus a bounty was placed. Through a surprising chain of events, we unexpectedly earned ourselves an extra reward. For this reward, I intend to use it solely for Luna and Til considering what they witnessed yesterday. Regarding his lackeys, it seems that they had turned themselves in and confessed to everything. After I made my last report to the guild about our departure, they told me that arrangements had been made in our next stop as a consolation about this entire incident. Free of charge of course. Thus, we entered our carriage and finally left Flaregard. [Yuuya, the carriage is so much faster than the caravan!] (Luna) [Yuuya-niisan, the wind feels incredibly good yo~.] (Til) Luna and Til stuck their heads out the window of the carriage and narrowed their eyes. [We should make it to the next city quite quickly with the carriage. So Ill take this time to explain to everyone what well be doing at the next city.] (Yuuya) The two girls energetically returned their heads to the carriage as I began my briefing. Our next destination was a city in the southern area of the Laluzulu Kingdom. However, with our carriage the distance between that city and the capital is quite short. In this town, I wont be raising our levels but rather focus on teaching everything I know to Selene and whatever time remaining will be spent making our journey an enjoyable one. Our journey together will be one remembered with laughter even as we part. Im quite rusty on this so do let me know if there is anything that could be improved on. Just to clarify Lunas speech patterns, she typically speaks in third person, Luna looks forward to it however there are instances where she speaks in first person, I look forward to it. This is because in Japanese they often omit the noun and just mention their actions/ thoughts. Eg: B! (I will do my best). I thought that adding the first person noun here would be more accurate as compared to Do my best!. Luna does this often but the times where she does refer to herself, she does it with her name. There are probably other things that I should clarify (if you read the raws) but I did this as direct translating certain aspects of the novel is awkward in english (such as above). So if there is anything you find unsatisfying. Do let me know! Volume 1 - Chapter 7 This is a dungeon that can only be entered by low level adventurers And it is necessary to have the level reset to open the door Even if the room was found, it would be impossible to enter the room High level adventurers couldnt enter the dungeon in the first place It is obvious that the person who found this room wasnt normal. Just how did he discover all this different rooms. For your information, the guy who discovered this room was the same as the level reset room After entering the room, I realised the room looks exactly the same as the level reset room It was a stone room illuminated by light crystals. There was a fountain in the center of the room and a statue of a goddess at the back. No way, there wont be another one here, will it? [Youya, why are you trembling?] (Luna) [Dont worry about it, Im fine. I am just looking for something like a monster around.] (Youya) [Its okay! Lunas doesnt sense any monster near us!] (Luna) Luna bangs her chest proudly as she announced that. I made a bitter smile as I looked at luna She doesnt realise that I was wary of another Luna trapped in a crystal. Although Luna is easy to take care of, if there were two of her I would be in serious trouble. Now then, time to begin the ritual. Looking at the layout, it seems that the lore behind the hidden rooms is that the same goddess made the hidden rooms. The activation for the ritual is the same. I removed one light crystal from the wall and placed it in the necklace of the goddess statue. The goddess statue started to illuminate with a soft glow, and a voice started appearing in my head. It was the same voice back in the level reset room. [Those who have fought countless battles and encountered obstacles one after another. Congratulations on finding me. I praise your relentless determination adventurer. I will grant you a special power as a means to push the darkness back with this power.] (Goddess) Similar to back then, the glow from the necklace enveloped my body. My body felt warm and light, it was like I was reeling in power. I can feel that I have definitely gotten the blessings of the goddess. Shortly after, the light disappeared. Finally, it is over. My cursed status will never come back. My status increase every level will be three points from this point forward. Ive been struggling so much thanks to my bad luck, only gaining one point per level. That meant that I had to put in so much more effort just to keep up with everyone elses growth. Eventually, I encountered an unbreakable limit. However, with effort I still managed to overcome it and continued to follow everyones path of becoming stronger, eventually obtaining the power to open the door. But this wasnt the end. I still encountered another obstacle that I couldnt overcome. I couldnt swallow the fact that I would never be rewarded for my hard work. I couldnt accept that and chose to run away. However, its different now. As long as you put in the hard work, you will be rewarded. [Youya, why are you crying?] (Luna) [Sorry, I showed you an unsightly side. I couldnt help it, I have finally been freed from my curse.] (Youya) My status was cursed. I couldnt count how much bitterness I had to swallow thanks to it. [Youya, sit down.] (Luna) Luna started walking towards me. I didnt understand so I just listened to her and sat down. Then Luna hugged me. [Good boy Good boy~.] (Luna) [Uhh.. Luna-san, what are you doing?] (Youya) [Somehow, I felt like whenever I was sad, I would like someone to do this to me.] (Luna) [Although you lost your memories, you do say weird things you know.] (Youya) [Youya, why were you sad?] (Luna) [Im not sad anymore thanks to Luna. Thank you.] (Youya) [Im relieved. If you are ever sad again, Luna will be there to comfort you! Good boy~ Good boy~.] (Luna) This child.. I am glad to be in the same party as her. [Luna, why dont you try the same thing I did?] (Youya) Although I feel like it wouldnt succeed since she didnt reset her level, we could still try it. In the slight chance that it does succeed, Lunas combat strength will increase drastically. [Uhn.I will try it. Luna just has to put the stones there into the necklace?] (Luna) [Yeah.] (Youya) Luna took a light crystal from the wall and fit it into the necklace. But nothing happened. [The statue isnt shining like when Youya did it.] (Luna) [Well its okay, dont worry about it. Its time to enjoy ourselves. Lets go back to the hunting grounds and begin raising our levels.] (Youya) [Lets do it! I will defeat many monsters and become stronger!] (Luna) Now. There isnt anything to stop us from leveling anymore. Lets defeat all the monsters in the dungeon . . . After exiting the room, we climbed up the cliff back to the hunting area. It was difficult for was to do a round trip on a cliff with just a single rope, however it was worth the effort. Oh right, I nearly forgot something. [Luna, make sure to memorise the location of the hidden room. Next time when you return here, I wont be able to follow you so make sure that you remember the location of this cliff.] (Youya) [I understand. I may have forgotten alot of things but I have a good memory.] (Luna) When Luna hits level 50 and performs a level reset, she will have to come back here to perform the ritual once more. This dungeon has a level cap, making it difficult to reset my level once more to match hers. Thats why she has to remember this place. . . . In the Iwayama dungeon, the higher you climb the mountain, the rougher the terrain becomes, leading to stronger monsters. And stronger monsters yield better experience. That is why we must climb higher. [Youya, the path ahead of feels dangerous. We were told to never enter the top of the mountain.] (Luna) [Well youre not wrong. The Rock Golem will start spawning once we enter this area. A low-level adventurer wouldnt be able to land even a scratch on the golem. The guild is worried that there would be naive adventurers who will challenge the monster. Look behind you, there are signs placed to prevent anyone from entering.] (Youya) Rock golems have high defensive stats, nullifying effectively all physical attacks. Although its Magic Defense isnt as high, it is high enough for low-level adventurers to not leave a dent. It isnt a monster that a new adventurer can challenge and win. Fortunately, the monster can be easily avoided as it only spawns at the summit of the mountain. Thats why this dungeon is suitable for training novices. [Then lets turn back.] (Luna) [On the contrary, lets continue forward. If its me, the golem shouldnt be a problem. It is a slow monster who is weaker to magic attacks than physical attacks. It is the perfect prey for mystic knights. Plus, its a slow monster. To me, slow monsters are merely sitting ducks.] (Youya) Rock golems are good fodder for raising our levels. It is a strong monster that gives a lot of experience as well as drop unique items that are highly valuable. The unique items it drops are rare to find as it can only be obtained from this dungeon, but because the Rock golem is near impossible to defeat, the item is considered extremely rare. [Maa. If Youya says that its fine, then I guess we are fine.] (Luna) [Although I can beat them, right now I can only beat a golem on a one on one battle. If there is more than one, we will have to flee. For that, Im relying on your Presence Detection Luna.] (Youya) [Leave it to me!] (Luna) Shes a reliable child. The two of us were lucky on our path to the summit, we arrived at our destination without encountering a single monster. Then, I ate my words. [Its the idiot trio.] (Youya) The three chicks who didnt want anything to do with me were up here as well. This is likely the reason why we didnt encounter a single monster. We took the exact same route as these three idiots did. They probably defeated all the monsters easily, and became overconfident of their abilities. Being overconfident of their abilities, they decided to come to the summit thinking they could defeat the golem. Hold and behold, they were currently fighting a Rock Golem. That is a common mistake made by novice adventurers. Unfortunately, one mistake as an adventurer, and that would likely cost your life. Most adventurers who mess up dont even have the opportunity to learn from them. Those who do survive are considered quite lucky. [HELP. SOMEBODY HELP USS.] The three of them has a well-balanced party for a novice party. A Warrior, Magician and a Hunter. The warrior acts as the vanguard while the magician and hunter attacks the monsters from the back. But the warrior was unable to withstand the attacks from the golem and got blown away. He is breathing but the his bones are most likely broken and wont be able to continue battling. After the vanguard was defeated, the golem started rushing towards the magician and the hunter. The magician and hunter desperately attacked the golem but the golem is unaffected by the attacks. At this rate, they will be annihilated. [Luna, wait here. I will go and save those three. I wont be able to protect you so I want you to stay out of the battle.] (Youya) [Why would you bother saving them? They are disgusting people who talked bad about you. You should just leave them.] (Luna) [Luna. I have the power to help people. I wouldnt be able to sleep at night if I knew i left those three to die. And also, its an adults job to guide chicks like them on the right path.] (Youya) From my point of view in the guild, those three were merely puppies. They may bark a lot but it wasnt menacing in the slightest. Not to mention, its a waste that most adventurers lose their lives with just one mistake in the dungeons. Adventurers are humans too, and mistakes are inevitable. Without mistakes, people wont be able to become a real adventurer. If i can help someone learn from my mistake, then I will give them that chance. I ran towards the golem. Now then, its time to take action. Time to give my juniors a second chance. Volume 1 - Chapter 8 Rock Golem For low-level adventurers, it is a monster equivalent to a grim reaper. Unless you are an idiot, it is a monster which you run away from on sight. It is common for novice adventurers to go against that rule and challenge the golem. Likewise it is common to get their asses handed to them. I found it unusual that the path to the summit was clear of monsters It seems that the trio had defeated all the monsters on their way here. Perhaps the expensive equipment their parents bought them were too effective, they ended up overestimating their actual abilities and attempted to challenge the summit of the mountain. For adventurers who try to jump ahead of the pack, a single mistake could cause them their life. Unless an amazing person appears to save them. [SOMEBODY. SOMEBODY PLEASE HELPPP.] (One of the trio) The rock golem was chasing a man who was crawling on all fours in an attempt to run away Although the rock golems movements was slow and dull, it had a large stride, resulting in a surprisingly high speed. It caught up in an instant and raised its arm If that attack lands on that boy, that boy will not survive. I placed more strength into my legs. At this rate, even with the bonus points in my status, i will not make it in time. Looks like Ill have to use my trump card. I increased my concentration, and opened the door. For an instant, i increased my leg power to increase my speed for two steps. In the moment before the attack connected, i arrived next to the chick. The moment i arrived, i immediately closed the door. Opening it for too long places a strain on my body. [If youre afraid, just close your eyes!] (Youya) I raised my sword, interrupting the golems fist as it was descending. It is easy for me to avoid the attack, but if i were to avoid it the boy would be crushed under its weight. On the other hand, if i were to receive the brunt of the blow, i wouldnt survive either thanks to my weak defense So ill choose the third option. I swung up my sword following the rock golems attack, avoiding intercepting it directly as I would be crushed 100%. I swung my sword at the edge of his fist, shifting the angle of the attack. Ugh. Its too heavy. The shift wasnt enough to save the boy. I slid the sword diagonally upwards and placed my palm on the sword to support the weight of the fist. The fist follows along the slanted blade, landing on the ground next to me. The earth was blown away along with me and the boy, surrounding the area in dust. I landed on the ground properly and kept my sword in its sheath The angle and position of the sword as well as the act of supporting the weight of the fist. The ability to guide and slide the fist away from its intended target. If there was any mistake, I would had been crushed without a doubt. But I didnt hesitate in the slightest. If i couldnt perform this kind of trick i would had been dead long ago. Before i reset my level, i was a warrior. My role was to be a wall for the party. With my low status, i had a weak defense and low speed, so i made up for it with techniques to receive all kind of attacks to complete my role. Recalling the past reminded me of the strength and speed of the high-levelled monsters. Compared to them, the golem might as well not be moving. [You can still crawl. Youre in my way, get out of here.] (Youya) [Ah. Its you.. Why would you-?] [I came to help. If you understand now then get away quickly. We wont be able to escape if you dont get moving.] (Youya) The golem threw another fist at us. I guided the fist with a similar technique once more. Two attacks. Followed by a third. Multiple attacks rained onto us as I deflected them one after another. [Why would you help us. Ossan its impossible for us to escape. The golem is too strong we cant win.] [Dont worry. I will definitely save you guys. I am experienced at this. I am capable of beating monsters even twenty times my strength.] (Youya) To prove my point, I countered the golems attacks whenever it failed to land a blow. The counters honed by years of training was capable of cutting into the hard golem. Just because the monster had better stats than my own, does not mean that the battle was impossible. If that was the case, every adventurer would had died a thousand times over. Well in the first place, I have beaten monsters and even other adventurers with statuses several times stronger than my own. The handicap of a cursed status became a blessing, sharpening my techniques and senses to the limit, allowing me to overcome many foes stronger than myself. It was only because I was weak, that I obtained strength through honing my techniques. The only thing that was holding me back was my cursed status. [Im sorry Ossan, Im very sorry.] The boy started crying on a fours as he crawled away. Finally, the boy escaped. With the boy gone, I can finally go on the offensive. The reason why i chose to become a mystic knight was to obtain the special skill. But that skill was too risky to release with a young man to my back. Watching the golems movements, it looked as if it was going to swing its fist down, however I know that the fist is just a feint, and the real attack will be its kick. Its kick is powerful but his movements are far too telegraphed. Its kick is probably too powerful for me to defend against. However, I dont have to defend anymore. I can afford to dodge with the baggage gone. Its kick is a powerful attack, but in exchange it leaves his body exposed. It is the perfect time. I began casting my magic. The privillege that only mystic knights had was the ability to cast magic in close combat. I approached the rock golem as i began my chants. The benefits of casting magic was the ability to attack from a distance. The basic movement would be to increase the distance from the target when casting magic. It was irrelevant, so I threw that concept away My spell is different as its range was incredibly short. This meant that it was only usable in close combat. It was a spell suitable for mystic knights who fought in the avant-garde. The golems leg swept past my body and i felt the wind on my cheeks. My chant was almost completed, and I felt my magic power rise. The hidden factor, that causes the power of the mystic knight to rise exponentially, becoming the strongest class from being the weakest. That factor, was the special magic given to mystic knights. Customized Magic. When a person performs a level reset as well as the status gain ritual. A special ability is given to a person who chose the weakest job. That ability was the ability to create your own magic. This discovery led to a huge influx of mystic knights as the player base was excited about a potential buff to the weakest class. Thanks to customising your own magic, the feature given to a mystic knight could be properly evaluated. In this world, every spell consists of four fundemental concepts. Range: how far can the spell reach. Area and Duration: how large of an area can the spell affect or how long does the magic last if it was a spell buff. Power: how effective will the spell be. Cast time: how long the casting time will be. With Customized Magic, these concepts can be adjusted. For this situation, I used the intermediate fire magic Fire Storm. Originally, Fire Storm had an effective range of about 20metres, with an average area, casting time and power. Using Customized Magic, i altered that magic to my liking. I dropped its range down to nearly zero, and its duration was also minimized. Its casting time was also lengthened. Every possible concept was effectively weakened to strengthen its power. The result was.. A powerful magic spell that could only be used in extremely close range. As the casting was completed, my left hand started to glow orange like a flame, and started to shiver. Intermediate fire magic Fire Storm. Customized. [Napalm Strike] (Youya) While moving forward, I performed a motion that closely resembles Chinese martial arts, focusing my bodys kinetic energy onto my left hand, thrusting my left palm onto the belly of the golem. As a result of my customisation, Flame Storm became a left strike wrapped in flames. The heat from the explosive strike penetrates into the body of the rock golem that boasted extreme hardness, burning its body from the inside. [Gwaooo] (Golem) The golem collapsed. Although I had the bonus points from my level reset, it is still unusual to be able to defeat a rock golem with a single blow. It was possible because of Napalm Strike. A technique which sacrifices everything for raw power. The Rock golem started to turn into blue particles and dropped an item. Lucky. Its a Karakuri Heart. It is a useful item that can be used for various reasons. I felt my body swell up with power and looked at my status card. My levels increased by two and i achieved level three. The golem yielded a lot more experience than expected because of the level difference. When there is a level difference, the experience yielded increases. [That magic earlier was amazing.. I have never seen any magic like that. How could Mystic Knight be weak with that kind of magic?] [That Ossan.. He stopped the golems attack with a sword, and even managed to cut it.] [Youre wrong.. He didnt stop the golems attack. He deflected it. I heard that it was only possible by a master in swordsmanship and he really did it.] It appears that the young man who ran away helped his companions recover using potions. Well they appear energetic at least. I started walking towards the trio. [You three. You may have had good luck this time because I was in the area, but do not come back here again. The next time you attempt to fight these monsters, you may as well be dead.] (Youya) This was the trios chance to reflect on their actions. This was a test to see if they can learn from their mistakes and reflect on their actions. It is without a doubt, one of the most important aspect for an adventurer. [We understand] It seems that the trios attitude towards me has changed after I have become their benefactor. They started listening to me obediently now that i have saved their life. [Ossan I mean Youya-san. Would you like to have a drink with us sometime?] [I dont mind.] (Youya) [Thank you for saving our lives.] The boys left while giving me their thanks. I pray for their safety in the future. In the distance, I see Luna running towards me while her tail shakes back and forth. [Youya, that was amazing! Mystic Knight is strong!] (Luna) Her eyes were shining brightly as she looked at me. [Well.. That is a magic that only I can use.] (Youya) A mystic knight is extremely useless if there isnt Customized Magic to augment his magic spells. In the situation earlier, Fire Storm would had have no effect as its range and power are both second-tier. When a person with half baked magic capabilties cast a second-tier spell, its effect would be laughable at best. However, by focusing all its concepts into power, it becomes usable as an attack by combining it with a physical strike. I talked a little bit with the trio. They were capable of returning to the entrance by themselves, so i didnt bother with sending them. [Well now that the problem has been removed, lets begin hunting monsters this time Luna.] (Youya) [Uhn! The goal is level 50 by tonight!] (Luna) [Uhh.. Luna-san. Thats impossible you know.] (Youya) [Aww thats too bad.] (Luna) Well continue hunting for Rock Golems untill my mana runs out. Since the mystic knights mana correction isnt very impressive, I only have about three more shots untill my mana is depleted. Lets do our best to kill about three more golems. I do have other magic spells that were customized but only Napalm Strike is effective on the Rock Golem. I look forward to the day where i can show Luna more spells. Volume 1 Chapter 9 With the discovery of the level reset function as well as the fixed status increase, the magic knight class was said to be industrialized. Along with these two discoveries, a third discovery was made for Magic knights. That was Magic Customization. Initially, the magic knight was rated as a weak class due to its inability to cast magic above the intermediate tier. The only benefit to choosing the class was the ability to cast magic despite being part of the front-line, however this benefit was considered a weakness rather than a privilege. Magic knights were unable to cast Wall and thus unable to be the tank in the frontlines. In this world, there are three tiers of magic. Basic, Intermediate and Advanced Basic tier magic was considered a useful magic to have due to its quick cast time and high power for its cost. Advanced magic was magic with a large area of effect with a long cast time. However, despite this it was still easy and effective to use as it also has extremely high firepower. However, unlike the other two tiers which were highly regarded, Intermediate magic was looked down upon as an irrelevant tier to master. Basic and Advanced tier magic were extremely efficient in terms of their consumption as well as effects, producing good results for relatively low cost. Whereas Intermediate tier magic was inefficient in results. Intermediate tier magic has a reasonable area of effect with range and its cast time wasnt very long but not short either. Its power wasnt spectacular for its cost, making it a tier that had many niche uses. High-levelled magicians often taught others that Basic magic was effective in dealing with weaker monsters while Advanced magic should be used when the number of monsters are too many or too powerful. Thanks to this, there werent many uses for Intermediate magic and was considered a waste of skill points to invest in. They werent wrong. Intermediate tier magic was indeed useless when compared to the other tiers available. However, Intermediate magic was superior in one aspect. Customization. If it was possible to place the level of each spells fundamental concepts in numeric values, the values of Intermediate tier magic was more efficient compared to other tiers. When Magic Customization was discovered, magic knights were given an ability that magicians did not have. That was the flexibility to customize their spells to provide powerful attack spells as well as supportive magic. Magicians didnt have the ability to sacrifice their range and cast time to increase the power of their attack spells. However, that wasnt the true benefit of Magic Customization. Its true potential lies in its supportive magic. When magic knights power level was reevaluated, it wasnt the flexibility nor the attacking magic that caused them to be rated highly. It was the ability to freely alter the blessings that they provided to the party. This characteristic alone was enough for the class to be deemed as the strongest. [This makes three!] (Luna) After the trio had left, Luna and I continued to look for rock golems in order to raise our levels. The subsequent battles were much easier once the baggage was gone. After defeating our third golem, I became Level 6. It was an incredible leveling pace as there was a huge level difference between the monsters and us, giving us a bonus gain in experience as a reward. Since Luna was in my party, the experience was evenly distributed between the two of us, so Lunas was currently Level 6 as well. [Alright its time to head back, Ive pretty much drained all my mana.] (Youya) [Youya, Luna wants to fight. Theres no point if Luna doesnt fight.] (Luna) [Its because Luna is here that I can focus on my battles. If Luna wasnt here, I would worry about multiple golems appear once the battle was over.] (Youya) [I understand. But still] (Luna) It seems that Luna was dissatisfied that she did not have a chance to enter the battle. However, even if Luna did join in the battle, she would not be able to land a scratch on the golem. Its defensive stats were far too high for adventurers with our levels. That being said, she was still crucial in our battles as she was constantly on the lookout for monsters that would join in on the battle. That alone saved me a lot of energy and was an important role, but it seems that she is still dissatisfied. [Dont worry, tomorrow youll get a chance to fight monsters. Now that were Level 6, you should have at least 5 skill points. Lets use this opportunity to level an attack skill. Ill recommend the optimals skills and youll choose which skill you wish to use.] (Youya) [Yay!] (Luna) Luna smiled happily as her tail shook back and forth. She seems happy that shell finally get an attack skill. Could she be a battle maniac? For thieves, there arent any actual attacking skills although offensive skills do exist. For offensive skills, there are two styles that can be used. One was a style that specialises in critical hits while the other specialises in abnormality effects. The former has a high skill floor, requiring talent and technical ability. If successfully executed, it will provide the user with tremendous explosive power whereas the latter requires knowledge and battle sense. Once the user has enough experience with his abilities, he will become an important asset in future battles. Although it is certain that Luna will choose the first option, I will have to determine whether she has the talent for Critical specialization. Although having the ablity to land critical hits packs a huge punch, if the user doesnt have the talent for critical strikes, the skills learnt would become dead skills as they wouldnt be used in any other way. Relying on Lunas Presence Detection, we successfully evaded monsters as we travelled down the mountain towards the exit. . . . For our first adventure, it is impressive that we managed to level up five times while obtaining a rare drop at the same time. We headed towards the guild hall as we returned from the dungeon The guild plays three important roles. Firstly, the guild serves as a consultant for adventurers. When inquired, the guild staff will explain specific details about dungeons including the level and monsters that will appear. Secondly, the guild serves as a store that collects drop items from dungeons. Everything that is dropped by monsters can be sold at the guild. Using its huge network, anything can be sold and delivered to anywhere around the country. Lastly, the guild is the distributor of quests in the countries. Quests accepted from all around the world are shown here for adventurers to accept. The guild is a crucial lynchpin for the lives of adventurers as they were arguably the main source of income for us. Without them, it would be difficult for us to sell the items from dungeons to other vendors. The guild also takes a commission depending on the amount given for the drop items. Depending on the commission, guild points are given and once the amount of points reaches a certain amount, the adventurer will be promoted to a higher rank. The higher the adventurers rank, the more advantageous it would be when travelling around the country. There are special privileges that are only given in certain countries and cities once you are at a high enough rank. Therefore it is rare for adventurers to avoid cashing out their items at the guild unless it was an absurd amount. However, there was something strange that caught my eye. When I took a look at my status back in the dungeon, I realized that my rank was currently Bronze, the lowest rank for adventurers. Back then, I was at the top rank, White. Although I expected my status to completely reset thanks to the goddess statue, I didnt expect the statue to reset my guild points as well. Looks like Ill have to raise my guild rank as well as my level this time. I sneaked a peek at the quest board before heading to the cashier. Just as I hoped, I found a quest that requested for the Karakuri heart from the Rock Golem. After defeating three golems, two Karakuri hearts were dropped. Ill be submitting only one of the hearts for the quest and the other will be kept for crafting magical items in the future. Turning in items for quests were much more beneficial than simply cashing them in for money. By completing quests, not only do you earn a bonus, but you also earn the original price of the item back in cash as well as guild points. The amount that we had earned was quite a hefty sum for a beginner dungeon. It seems that lady luck has been smiling upon me ever since i met Luna. [Luna, lets head over to the bar tonight. We earned a lot more money than expected today, thanks to that we can afford to eat more of the meat you liked.] (Youya) The glint in Lunas eyes shined brightly. However, that glint quickly disappeared as Luna began to shake her head. [Its okay, the new skill is more important. Luna wants to become stronger.] (Luna) I widened my eyes at Lunas statement. I cant deny that I was looking forward to eating good food tonight, but watching Luna give up the food for training gave me a bit of a shock. [Alright, then lets settle for a sandwich tonight then. Well drop by the store later and get the ingredients for the sandwich. That way we can enjoy a delicious dinner while training.] (Youya) [ As expected of Youya! Youya is so smart! I like smart Youya!] (Luna) Afterwards, we bought plenty of meat as well as other ingredients before returning to the inn. . . . Me and Luna were facing each other in the courtyard of the inn. Both of us held a wooden dagger in our hands [The skill I want Luna to learn is Assassinate. It was the same skill with a cool name that you liked.] (Youya) [Yay! Luna can finally look cool! I want to assassin!] (Luna) Her sentence was strange for sure, but somehow I know what she means. Being an assassin is a difficult task. It depends purely on Luna whether or not she can successfully pull it off. [Assassinate is a powerful but difficult skill to pull off] (Youya) [I want to learn! Teach me please.] (Luna) Luna ears begin to perk up as she began to listen. I started to recall the list of skills available in the game in my previous life. As a former player, I have more or less memorised every single skill in the game. Although I havent really memorised the explanation for every skill, I have or less grasped the mechanics and effects of the skills. Although it wasnt very impactful in the game, it is important to understand the skill that you are learning so that you avoid learning dead skills as much as possible. Dead skills are prevalent in this world as many beginner adventurers learn skills without understanding their skills effects and ending up regretting their decisions. Generally, adventurers should have a general idea of what skills do they wish to obtain, and narrow down skill tree that they wish to learn. Furthermore, the skills that are present within the skill tree should be narrowed down only to the most important skills as skill points are scarce in this world. Not a single point can be wasted. In the game, Assassinate was a skill that has the highest damage multiplier that also has the highest power correction value when the attack lands as a critical hit. However, if the attack doesnt land as a critical, it turns into a basic attack without any bonuses. [Assassinate is an attack that mainly relies on landing critical hits. You have to land the attack on the opponents weak spot otherwise the skill will not activate.] (Youya) The activation condition speaks for itself. That was how difficult this skill is. An adventurer who is trained to land critical hits is talented, however it was a tall order for adventurers to land a critical hit to activate their skill. Even possibly leading to their death as their attacks will drain mana even on basic attacks. [I guess the main difficulty in adding this skill, would be being able to land critical hits consistently?] (Youya) During the game, it was easy to raise our critical chance by increasing the speed stat. However it was still a percentage chance to land the skill. In this world, that was the most important question when obtaining this skill. Critical hits did not rely on luck, but rather on talent. Everything in this world has a weak spot, if you do not land the attack on their weak spot then it will not activate a critical hit. [Landing critical hits is an important skill for adventurers to grasp. The weak points vary based on the monster, but generally the weak spot for each monster are soft. When you land a full-power strike onto the weak spot, the damage will be amplified and reverbrate throughout the body. It is an easy idea to understand, it isnt easy to execute. Even with training, only people with talent are capable of performing it. There are some who are unable to execute it even after years of experience.] (Youya) In order to land a critical hit, the skill and knowledge of the monsters weakpoint would be required. For the skill required to land a critical hit, the person would need a sense of swordsmanship and martial arts to transfer power from their whole body into their attacks. [Sounds incredibly difficult. Can you do it Youya?] (Luna) [I can almost always land critical hits, especially against monsters.] (Youya) Actually, I had zero sense on how to detect a monsters weak point. However after continuing to hone my swordsmanship for several decades, Ive managed to sharpen my concentration. Along with my combat experience, I became able to land a critical hit whenever and wherever I could. [Youya, I want to try it. I wont be able to learn just by listening.] (Luna) [I feel the same way.] (Youya) I took out a wooden doll from my magic bag and stabbed it into the ground. The magic doll was a magic item, the invincible Scarecrow-kun. It has incredible durability along with automatic regeneration, making it the perfect practice dummy for battles. [First we will work on your techniques. An average adventurer often swing their sword using their arm strength. However contrary to what people think, that isnt the most effective way to attack.] (Youya) I swung the wooden dagger against Scarecrow-kun, producing a dull wooden sound. [The most effective way of landing an attack, would be to utilise your whole body, releasing the power of your whole body into the swing.] (Youya) I stepped forward while twisting my waist, bending my arms accordingly while swinging my dagger forward. The impact was a few notches higher than before, producing an explosive ringing sound. [Wow, they are totally different.] (Luna) [Naturally. The first blow was performed with my arm strength while the second used my entire body. Needless to say, the second blow is required for a critical hit to register.] (Youya) Based on my experience, there isnt even a single adventurer out of a hundred that can perform this as more emphasis was placed on a persons status than their techniques. [Luna. I am giving you a warning. You will give up on learning Assassinate if you arent able to land a critical hit on Scarecrow-kun who isnt even moving by tomorrow morning. Simply put, you dont have the talent if you cant even do this. Then, you will have to choose a skill that is easier to execute.] (Youya) [Difficult. Theres only one night] (Luna) Ho.. She understood that performing that attack wasnt as easy as it looked just from that one attack. It may look simple to perform, but that was because I have been doing it for years. Asking a novice to perform the attack in one night might be too harsh. But I cant afford to wait for Luna to grow. [Dont worry about failing to perform the strike. Even if you cant perform the cirtical hit, you can still specialize on attribute anomalies. Well that is if you fail before the time limit.] (Youya) I faced Scarecrow-kun and released nine consecutive attacks. Each of these attacks were nine different slashes that can be performed with a blade. Diagonal. Left. Right. Up and down. The different slashes were Karatake, Kesaki, Miginagi, Migikiue, Gyakufuu, Hidarikiue, Hidarinagi, Gyaku,Togetsuki. TLN note: I dont know what these terms are, but I am assuming they are names. [Eventually you will have to learn how to perform all nine slashes. Otherwise, performing critical hits will merely be a dream. In a battle, not only do you have to understand which slash would to perform, but the opponent will be moving as well. This is how much you have to prepare in order to master Assassinate. If you cant even land a critical hit on a stationary target, it is better to just give up entirely.] (Youya) I am being too harsh on Luna, but if I dont do so, it could be detrimental to her rather than beneficial if she ends up learning the skill without being prepared. [I understand. Ill do it!] (Luna) Lunas fox tail began to bounce up and down. [Now then, try to choose one slash among the nine that you think is comfortable for you and give it your best.] (Youya) [Uhn. Just watch me do it!] (Luna) Luna held her dagger and swung it at Scarecrow-kun with various patterns that resemble the nine strikes. Her strikes arent accurate in the slightest but it looks like she is trying to find her most comfortable strike. Itll probably be too difficult for her to find a comfortable strike as well as learn how to perform it properly. If it was Luna.. i guess the attack would have to be a thrust. [Luna, try to perform a thrust.] (Youya) I took my dagger and performed a thrust onto the wooden dummy. [Amazing.. Youya is awesome! Luna wants to do a thrust just like Youya!] (Luna) Luna looks at me with shining eyes as she saw me perform a thrust on the wooden dummy [If you can imitate this thrust by tomorrow morning, then you pass.] (Youya) [Ok!] (Luna) Luna wasted no time in performing a thrust that looks similar to my demonstration. I could see myself in her actions. It is clear that she was trying to imitate my movements from earlier. [Luna. Drop your waist a little lower and try not to hyperextend your arms. Stop stretching right before your arm is straight.] (Youya) I stepped behind Luna and grabbed her waist from behind, correcting her posture. [Lets do the thrust slowly with my assistance. Well correct your posture after each try.] (Youya) [hhnn? Uhm.. Youya.. Nevermind.] (Luna) After listening to her weird reply, I realized that her face started to turn red. Is she getting excited from swinging a sword? After performing the movement multiple times, Lunas movement became much more fluid and she could perform the thrust on her own. She continued to perform the same action after I removed my assistance, then her action started to change, becoming much more personalized for herself. As expected of Luna, she has an incredible sense when it comes to battle techniques. Thrust after thrust, her movements became cleaner and the wasted movements were being minimized. At this rate, it looks like her attack may be perfected by tonight. I continued to advise Luna on her actions while cheering for her in my mind. Honestly I hope Luna clears this trial as the skill she likes is a skill i would like to have in my party, but that depends on her. Good luck Luna! Volume 1 Chapter 10 At that moment, the atmosphere around Luna changed. Her stance became extremely refined. She rushed forward with a smooth movement as the muscles in her entire body was activated. The force generated from her body was consolidated into her dagger and she thrust her dagger forward. It was a beautiful thrust with zero wasted movement. Lunas dagger pierced Scarecrow-kun, producing a sound completely different from earlier. It was a ringing sound that reverberated throughout the courtyard. Lunas face shone brightly listening to the ringing. Watching Lunas bright smile while the sun was rising in the background was a beautiful sight that I wont forget. [That was amazing! Together with Youya! Were you watching?] (Luna) [Congratulations. I was surprised that you managed to perform a perfect thrust in just one night. You passed the requirement.] (Youya) [Hurray! Now Luna wont be dragging Youya down. Luna can properly battle and be together with Youya!] (Luna) At that moment, Luna became to sway and collapsed. I was right next to Luna as I was carrying out special training alongside her throughout the night, Luna had overworked herself and collapsed due to fatigue. I hurriedly grabbed Luna to prevent her from falling. It could be due to that last thrust that caused Luna to use more stamina than expected, causing her to exceed her physical limits. I stopped my training and headed back to the inn. I had to bring Luna back to our room to recover. It would be reckless to enter a dungeon with her current state. Luna is definitely talented, but her enthusiasm was more than I expected to the point that she passed out. [You did great. Well done, Luna.] (Youya) I stroked Lunas head. Although she is asleep, it looked like she was smiling slightly. She is definitely a cute girl. That is what has been bothering me. . . The afternoon passed by in a flash. I was reading a book while sitting next to Lunas bed. The author of the book is one of my favourite authors. While I was enjoying the book, Lunas eyelids started to move. [Good morning.] (Youya) I smiled at Luna as I greeted her. Then she rubbed her eyes and her fox ears began to twitch. [*Yawn* Good morning Youya.] (Luna) Lunas stomach began to grumble and her face started to turn red. Although she is pretty daring, she is surprisingly shy when it comes to her stomach. [Eat this for now. In addition, remember to drink this potion to recover your stamina.] (Youya) [Thank you.. Its delicious.] (Luna) The fruit I passed over to Luna was a banana. In this world, it was a fruit that grew primarily in the south. It is easy to consume and digest and our body converts it to energy quickly, making it a good stamina food. It is fairly expensive but it is still the best fruit to eat when you are tired. After eating the banana and drinking the potion, colour started to return to Lunas face. Luna looked outside the window and her fox ears began to fidget. [Youya, it is not nighttime yet. Can we go to the dungeon?] (Luna) [I think you should rest for the day.] (Youya) [I dont wanna. It felt great when I performed the thrust. If I dont try it once more I may forget how to do it] (Luna) I understand how Luna feels. When you master a new technique or learn something new, until you master it you would want to practice it until it is perfected. Sigh it cant be helped. [I understand. Well leave in an hour, be prepared to leave by then.] (Youya) [Uhn. I will prepare myself asap.] (Luna) I quickly averted my eyes as Luna took off her clothes while finishing her sentence. [I have thought this from the start, but arent you a little too brazen?] (Youya) Luna proceeded to change her clothes without any restraint. Although I dont feel any attraction towards Luna who is about 13 or 14, I still feel guilty looking at her naked body. [But its Youya. Its fine even if you look at Luna.] (Luna) When I heard that Luna was done changing, I turned my head and saw her wearing the adventurer clothes that I bought for her with Bazerato hanging on her waist. [Youya, lets head out immediately!] (Luna) Luna grabbed my hand and pulled me out of the room. Although the hour was supposed to be a break for her to rest, if she feels that shes up to it then we could leave immediately. [I understand. Lets go. Its time for you to learn Assassinate. You can go ahead and place all your skill points and level it to 5.] (Youya) Since it was decided that she was going to learn Assassinate, that would be the only attacking skill shell ever have as a Thief so it should be leveled to the maximum. Ideally, a Thiefs skillset should consist of exploration skills, relying only on Assassinate for battles. There were many exploration skills that were useful besides Presence Detection such as Treasure Hunt, Stealing Art and Shadow Walk. These skills gave the user the ability to detect treasures, increase the drop rate of items and hide the partys presence respectively. However, such a skill set would only be possible if the user was capable of utilizing Assassinate effectively. Otherwise, regular thieves would have to put more points into combat skills to raise their fighting capabilities while having minimum exploration skills. They were required to take multiple debuff skills such as Poison,Sleep and Paralysis. There were also other debuffs that can be learnt. I am glad that Luna was capable of utilizing critical hits as this allowed her to learn more exploration skills. [Skill obtained! Now Luna can use Assassinate and defeat monsters with the thrust Youya taught!. I will assassin all of them.] (Luna) Note: This was intentional. Luna was very energetic in utilizing her new skill. Her motivation even affected her tail as the fur on her tail were standing, causing her tail to look larger and softer, making her tail look even cuter. Unable to resist the urge, I grabbed her tail in my hand. [Hiikk.] (Luna) Luna let out a strange voice before jumping a distance away, looking at me with face full of disdain. [Uhm. Sorry that was my bad.] (Youya) [Youya perverted. You cant just suddenly grab a girls tail.] (Luna) I really dont understand what Luna is saying. She casually changes her clothes in front of me and embraces me during our sleep while snuggling herself onto my chest in bed, so why does grabbing the tail make me perverted? [I didnt mean it that way. Humans dont have a tail so we dont know the importance of a tail. Thats it. Is it similar to stroking a persons head? If its bad then Ill never touch it again.] (Youya) [Ill forgive you for now. But next time, you will have to take responsibility for it! Only the persons lover can touch the tail.] (Luna) How does she remember such a thing when she has amnesia. I had no energy to continue this conversation, so I just nodded back at her reply. Although.. Her tail felt really nice to touch, it was smooth and fluffy. Eh? Does it mean that if I become her husband, Ill get to touch her tail? Ugh. Calm down Youya. She is just a girl, what on earth are you thinking. . . . We dived into the another dungeon from the entrance at the guild. There were several dungeons meant for beginners. This time, we entered a jungle-type dungeon. The reason why we entered a different dungeon was because of the difficulty in the monsters weak spots. It is difficult to land a critical hit on the monsters in the rocky mountain dungeon. However, there were many monsters in this dungeon with weak points that were easy to target. At the distance, I saw the figure of a monster hiding in the shadow of the tree. The monster was a goblin. [Luna, its your turn now. You should have no problem with a goblin at your current level. Ideally, Thieves battle by utilising their speed, quickly rushing their targets and defeating the monsters with a single blow.] (Youya) [Got it. Ill try it!] (Luna) When I took a look at her status, her stats werent as bad as mine before the level reset. At her level, she shouldnt have any problem dealing with the goblin. On the contrary, her Attack and Speed on average increased by 3 every level. I dont believe that this was based on luck. I have a feeling that her status increase was fixed from the start. She was a fox-beastman that didnt exist in this world who was trapped in a crystal inside a hidden room. I wouldnt be surprised if she was the only one in the world who had a fixed status increase from the start. [Kikiki] The goblin came out of his hiding spot holding a stick. It was a green monster smaller than Luna, with a bulging stomach. Goblins have low offensive capabilities and low-speed, making them easy prey. If you approach cautiously, the chance of defeat is low. Note: Anyone having Goblin-slayer deja vus here? Luna rushed the goblin the instant it appeared. She was fast. Much faster than her status had implied. As expected of a beastman. She had mastered her body much more than an average person could. However, the situation was bad. She is rushing too much into the battle. Even though the goblin was right in front of her, she showed no signs of slowing down. If it was me, I would had already slowed down to prepare my stance before throwing out a thrust against the goblin. Luna continued to prepare her thrust while maintaining her speed, barely achieving the form required for the critical to register. It is impossible for her to transit into the stance for her thrust with that kind of momentum. However, she did not show any intention of slowing down her momentum. Even if she fails here, it will come back to her as a lesson and experience to reflect upon. As Luna rapidly approaches the goblin, her stride was further increased on her last step directly in front of the goblin. Surprisingly, instead of slowing down her momentum and transiting into a stance, Luna had transitted directly into her thrust while increasing her speed. The goblin did not expect to be rushed at such a high-speed and stiffened at Lunas rush. Taking this opportunity, Luna aimed at the goblins heart which is its weak point. [Assassinate.] (Luna) Luna threw out her thrust towards the goblin. It was a perfect thrust with the entire body working together with its momentum, concentrating its power into the dagger. The skill with the highest power multiplier among all the classes was activated, and a distinct ringing sound resonated. The goblin whose breast was gouged out by the thrust turned into blue particles with a single blow. [What talent.. It doesnt seem balanced for someone to be this talented] (Youya) Despite just learning the basic thrust this morning, she applied the thrust in addition to a rushing technique. This combination was a powerful combination, be able to perform this meant that her offensive power much higher. [Youya, I did it!] (Luna) [I have no words. That was a perfect thrust if Ive seen one. Be sure to master that thrust by practicing it.] (Youya) Luna continued searching for enemies with Presence Detection while humming happily. Despite her looks, she is a frightening girl. [Luna. Let me teach you how to utilize Presence Detection offensively. Use it to find moving enemies nearby and approach them from the back. Surprise them with a surprise attack. This is the safest way to ensure you land your attack.] (Youya) [Got it!] (Luna) This was another one of Lunas amazing traits. Flexibility only possible to a Beastman that allows them to run in a way different from humans. She was capable of running without making a single sound as well as hide her presence. Initially i wanted her to obtain skills to help her stealth movements, however it seems that it wasnt necessary. Once again, Luna defeated another goblin. She followed my instructions and rushed the goblin with a surprise attack. It didnt realise Luna had approached it up untill it died. I doubt even an average adventurer would notice Luna approaching him. She had a talent befitting of the worlds best assassin. [Youya, were you watching me!?] (Luna) [Yeah I was watching. Its a good move, do not forget that feeling.] (Youya) [Uhn! I will work even harder!] (Luna) While I was watching Lunas movements, I was thinking about how I could learn from her movements. Just how much more could this girl grow? I cant wait to watch her growth from now on. However, I cant let myself be defeated by her. Her training is sufficient for now. Its about time for me to start my training. I still have much room to grow. We both, can grow much stronger from now on. Volume 1 Chapter 11 [As expected, it is a risky move to activate Napalm Strike.] (Youya) The weak point of Napalm Strike was that its activation window was too short whereas its casting time was too long. If I dont land the attack right after casting it, the spell will expire. Its casting time and activation window is much more severe than I thought. Normally, when a spells level is increased, its overall effectiveness increases and its casting time gets shorter. For some spells, its even possible to have an instantaneous activation. However, customized magic spells function differently. Spells that were customized with Magic Customization can neither be reverted or customized, requiring the user to have foresight to customize a spell that can be used in the future. Ill have to take responsibility for customizing such a difficult spell. I have no choice but take some time to adapt to the spells timing. It may be difficult, but this spell will be worth it. This are the kind of challenges that I do not dislike. I will practice activating Napalm Strike today until my mana runs dry. Although we have only been practicing against goblins so far, we will be returning once our mana runs dry. Goblins could easily be beaten without skills, making them good target practice for us. In addition, we left the inn in the afternoon, and its getting close to night. Its too dangerous for us to stay in the jungle during the night. [Luna, its about time we head back to the inn.] (Youya) [Uhn. Im worn out but content with my progress today.] (Luna) [Dont be too happy. Your thrusts were getting sloppy towards the end. You still need more practice.] (Youya) [O-tsu! Luna will try her best.] (Luna) I was watching Luna the entire day while she was battling goblins. Physical fatigue started to kick in towards the second half, causing her precision to fall. Her critical rate had fell to about 70%. Her success rate will fall in an actual battle when she is getting pressured by her opponent. It will continue to fall further if she was surrounded by multiple enemies. Her skill is still insufficient, but she still has a lot of room to improve. After watching her performance these past two days, it shouldnt take too long before she completely masters Assassinate. [Luna. Can you pass me the drop items that you picked up from your battles.] (Youya) [Uhn. Only this was dropped.] (Luna) Luna took the item out of her magic bag and passed it over to me. Her bag could hold about 10 kilograms of items. It was only a fraction of my bags capacity, but it is better than having a normal bag. Without the magic bag, she would have to carry a large backpack with her in the dungeon. Even a 10 kilograms magic bag would cost about 2 million giru. For comparison, bread in this world cost 100 giru. There was a huge demand for magic bags in the marketplace. Adventurers werent the only people who wanted a magic bag, but so do peddlers and merchants. The market price for Magic Bags were constantly on the rise due to the increasing number of merchants in the industry. Thus, whenever a bag was discovered, adventurers would often sell them for a high price. [Alright, quest completed. There was a quest that requested for an item dropped by goblins. Since we were going to train, I accepted the quest before we entered.] (Youya) The item that the goblins dropped was the Sage. Sage is an herb commonly used in the brewing of potions. Since the demand for potions is always present, collection quests for these kind of herbs are common. Checking the quest board before departing is one of the basics for being an adventurer. [Alright, now our guild points will increase again.] (Luna) [And we get some money as a reward too.] (Youya) Me and Luna did a high-five. Luna got to practice her secret attack while we made progress as a party. Today was a good day. . . . When we returned to the guild, there was a crowd gathering around the reception desk at the front of the guild. Lets find out what happened. At the center of the crowd, were two elven girls. Originally, Elfs lived in their villages deep in the forest and were rarely seen outside of their forests. Two of such elfs were currently quarreling with each other. [Why is my elder sister such an idiot! Why cant I be an adventurer?] (Elf no.1) [Being an adventurer is a dangerous job. Its normal for an average countryman to become an adventurer. However, whether it is being deceived by others or losing your life to monsters, it is still a dangerous job. Furthermore, you are a girl. A cute girl with a good body.] (Phil) One of the elves is a well-known figure in this guild who used to be my party member, Phill while the other appears to be her sister. They were both beautiful girls with long ears, blonde hair and jade-colored eyes. [If my sister can do it, then so can I.] (Phils sister) [I was just lucky. If that person didnt pick me up, I would have been sold as a slave and most likely end up dead. Please listen to me.] (Phil) I remembered the time when I first met Phil. I had taken up a quest that asked for adventurers to save an elven village from pillagers. That quest turned out to be a success and the village was saved. It was supposed to be a happy ending but what ended up happening was Phil requesting to become an adventurer after being saved. At the time, she was merely a cute elf who admired adventurers. There were many adventurers who were eyeing her and tried to take advantage of that admiration. At the time, I was a solo adventurer who didnt have a party. Watching the scene unfold, in order to save her, I decided to recruit her into a party with me. At the time, if I did not help Phil, she would have likely been sold as a slave. Elves who are always beautiful and would never grow old are rare and would fetch a high price. After that, Phil became my disciple and we adventured alone for awhile. After awhile, the extremely talented Leonard and veteran thief Lyle joined our party. Together we conquered a variety of dungeons, and our party became famous. In a way, that was the peak of my adventuring life. [Stop with this nonsense and listen to me. I will talk to the people in the guild and cancel the class tomorrow. Ill take a day off and I am bringing you back to the village.] (Phil) [Big sis is an idiot!!] (Phils sister) Tears started to form in her eyes as Phils sister ran in our direction. This is bad. The girl was rubbing her eyes as she ran without watching where shes running. I am too deep into the crowd, there isnt any room for me to evade or hide. If I cant evade, then Ill take the blow. She continued running in my direction, until she crashed against my body. Anticipating her movements, I caught her softly as she ran into me. Phil followed right after, chasing after her sister. [I am sorry, please excuse my sisters actions..wait. That face.. Ive met you somewhere.] (Phil) I was wearing the hat that I used as cover to hide my face. However, even with the hat, if she is this close up the hat wouldnt do any good. The girl who bumped into me earlier looked up. [Ah! Its my sisters boyfriend! Its the guy whose face was on the letter you sent to the village a long time ago!] (Elf sister) I screwed up. I shouldnt had let this happen. Although its nice to know that Phil had pictures of me, its especially careless of me since Phil must have been talking about me to her little sister. [Eh? That cant be. Could you be Youya..? But your level is too low to be him..] (Phil) Based on what she said, looks like she had suspicions about my identity up until now. However, because she was able to see my level, she probably thought that I was someone who was similar to me. Phil was getting closer and closer. I took my hat off and looked at her. [Huh!? Why are you in Rumberg? And your level How?] (Phil) [Well.. things happened and here I am.] (Youya) My identity was finally exposed. I always knew it would happen, but I hadnt expected it to happen so soon. The girl who bumped into me let out a sly smile. [Hey.. Youya-san. You are onee-chans boyfriend arent you. She was always talking about you back in the village, that you are the most reliable person in the world. Then would you accept a quest from me? Ill give you the treasure of the Elves, and in exchange, please accept me into your party!] (Elf sister) The girl was asking for an unreasonable request. Phil placed her hand on her face and looked down towards the ground while the surrounding adventurers started becoming noisy. [Boyfriend!? To THAT Phil?] [Thats a lie.. He is just an old man.] [Laying a hand on our idol.. You wanna die?] [I just wish for Phil-chans happiness] As expected, Phil is extremely popular as the beautiful elf receptionist in the guild. I felt my hands being pulled by someone. I looked behind and saw that it was Luna. Luna interlocked her fingers with mine and looked at the elf sisters. [Youya is Lunas. Luna wont give Youya away.] (Luna) Suddenly, the guild turned into total silence. Few moments later, whispers could be heard. [To such a small child..] [Hes a devil.] [They could be considered parent and child..] Everyone was clearly misunderstanding the situation. [Hey, Youya. You cant be doing such things to a small child.. Right?] (Phil) Oie. Phil. Not you too. [Isnt it obvious? You of all people know what Im like. Its the same case with you. Im just taking up the troublesome role of looking after her.] (Youya) [Ah. Thats right.. Theres no way the Youya who didnt lay a hand on me all those years even though I gave him plenty of opportunities would lay a hand on such a small child.] (Phil) For some reason, Luna was puffing her chest out proudly. [Youya played with Lunas most important place.] (Luna) Phil looks directly at my face with a menacing look. It is blatantly written on her face. [Sigh. Lets just talk outside later before any other misunderstandings happen. Phil. Well be waiting for you after your job is over.] (Youya) [Its already after hours. Its my personal time now.] (Phil) [Then lets change the location.] (Phil) [Well. Leaving this aside. There are things that I want to ask and talk about.] (Phill) The conversation resulted in a drinking session with an old colleague. Well with a bunch of new faces though. Luna was staring intently at Phils sister. Lets just leave the rumors as it is for the time being. Ive always been weak to pushy people in the past. Seems like that hasnt changed. Volume 1 Chapter 12 When we came back to the guild, I got involved in a quarrel between the two elf sisters, resulting in my identity being exposed. Although it was unexpectedly troublesome, it was a blessing in disguise. I got a chance to reconcile with one of my ex-party members, my disciple Phil. She was one of the two disciples that I left behind whom I treated like my own daughter. The other disciple was Leonard, who was in love with Phil. Currently, there was a group of four people who were the center of attention walking on the streets. There were three beautiful teenage girls. First was Phil who looks like a teenager approaching her twenties. Her actual age was around late twenties while her sister and Luna look like a teenager, with their actual ages being in their teens. And there was me. An old man in his thirties. There were many men who wanted to approach the girls on our way to the bar, however the moment they noticed that Phil among the girls, they immediately backed off. On the outside, Phil may have a pretty face. But on the inside, Phil was a first class adventurer who has reached Level 50, the level cap for adventurers without completing the Tower of Trials. She was the real thing who had accumulated various experiences as an adventurer. An average adventurer would try their best to avoid angering her thanks to her reputation. [It seems that the old Phil has grown to be a bit more adult-like.] (Youya) The old Phil was much worse at dealing with men, and would often hide behind me whenever she was approached. [How many years ago are you talking about? As a female adventurer, I had to become strong if I was to live on my own. I learnt that the moment Youya left, leaving only a letter for each of us. I was terrified and miserable when you left without saying a word and couldnt stop crying when I realised you werent coming back.] (Phil) It seems that the matter about Phil surviving on her own wasnt a lie. She mentioned that she left the party after I chose to abandon them. Lets be sure to listen to her circumstances afterwards. . . . We were guided to a tavern by Phils recommendation since she was most familiar with the area. The tavern she brought us to had an amazing ambience that drew me in that made me crave for the food here even more. When we arrived at the bar, each of us ordered our drinks. I ordered a mug of ale, honey sake for Phil while her sister and Luna ordered grape juice. Although her sister looked almost the same age as her, Phil was much older than her as elves grew at a different rate from humans. Elves had a unique characteristic where they would age much slower once they were 11 years old. [So, why is your level so low, and why are you here acting as a fresh adventurer?] (Phil) Phil went straight to the point. [I was adventuring in a wild dungeon when I encountered a huge caterpillar demon that I have never seen before. Furthermore, it was capable of performing Level Drain, and my level dropped to level one.] (Youya) [Level Drain So it does exist..] (Phil) [Yes, and thanks to it I ended up with a second chance to start over from scratch. Do not even think about using it to reduce your levels. Who knows what will happen when you are reduced to a mere Level one adventurer in the middle of an intermediate level dungeon?] (Youya) I hid the fact that a hidden room with a level reset function exists. Level Reset is a dangerous function. Ive known Phil ever since she was young, needless to say that I would entrust my life to her if needed. However, it is dangerous to allow the information about the hidden rooms to spread. The information should be contained as much as possible. [It must have been tough.. Losing your levels despite working so hard to raise it to 50..] (Phil) [In my case, it wasnt that bad.] (Youya) Phil had a miserable face as we talked about my lost levels. She was one of the people who understood how much I had lamented my status back when we were in the same party. My status was the worst enemy I had to face back then. [Dont make a face like that, Phil. Honestly, I feel that losing my levels has been a blessing so far. Thats why I came to Rumberg. To start over. Maybe its because I had to suffer with a low status for so long that my status right now is better than ever.] (Youya) [As always, Youya is always optimistic.. Looking towards the future rather than the past.] (Phil) Phil let out a slight smile. The waiter who was carrying our drinks arrived while asking for our orders. The specialty around here was their fish and chips. I ordered a set of fish and chips as it also went well with alcohol. [So, how did you end up working here as a receptionist? I had thought that you would end up adventuring together with Leonard.] (Youya) Leonard and Phil were excellent adventurers even back when we were adventuring together. Blessed with a good status and talent that exceeded even their status. Not to mention that they are my disciples. When I left the party, I had made sure that I had taught the two of them everything that I knew. I wouldnt be surprised if their swordsmanship has surpassed me at this point. [When you abandoned the party, I too left the party.] (Phil) [That is surprising. I always thought that you and Leonard would never separate from each other, regardless of the situation.] (Youya) Leonard was the member that joined our party after Phil. Initially he was a reckless guy who only was all talk with no substance. However, he had grown exponentially after becoming my disciple, eventually surpassing me in combat prowess. And although he did not mention it, it was obvious that he was in love with Phil. In order to support their relationship, I left the party while leaving a letter behind knowing that Phil would follow me even when I intended to leave all of them behind. I hoped that Phil would be happier with the young and talented Leonard rather than chasing after this old man. [After you left the party, Leonard decided to propose to me. Because of that, I left the party.] (Phil) I accidentally spat my ale out onto the table. Although I expected Leonard to confess after I left, it seems he jumped the gun much faster than I thought. [You didnt have to leave the party just because you rejected his proposal though.] (Youya) [A lot of things had happened after you left the party. More than the rejection, I was afraid of being in the same party as Leonard. When Youya left the party, I felt that my motivation dissipate and I needed a break from adventuring entirely. So I went on a journey alone. While I was on the journey, I thought about what Youya did for me when we first met, and realised that I wanted to help people who were in trouble with my strength just as you did for me.] (Phil) Phil was a receptionist who was once a veteran adventurer. With her experience and strength, it isnt surprising that many adventurers had benefited from her good will. In addition, she is smart and gentle. She was perfect as a receptionist. There are definitely many lives that were saved thanks to Phil. [Wowww. Onee-chan is putting up such a strong front. Even though you mentioned many horrible things in the letter you sent.] (Phils sister) Phils sister started grinning. [That sounds interesting. Please elaborate.] (Youya) [Various things happened when I became a receptionist such as suffering sexual harassment during my work hours.. Frequently being forced to work overtime, harassment by my boss and my seniors at work. I was even advised to go on an adventure every three days, just to get ambushed on my way home every time.] (Phil) [Sounds like life as a receptionist is tough.] (Youya) Life as a receptionist sounds totally different from an adventurer. Although I am worried about her situation, she appears totally unaffected without a hint of anxiety. [Dont worry about it.. Although this child mentioned a bunch of unnecessary things, there are still many things that make working as a receptionist worthwhile.] (Youya) [If its you, I know you can do it. ] (Youya) Me and Phil started smiling as we continued to catch up about what happened after the party was dissolved. It seems that her life as a receptionist is doing really well. I am glad that her life is going well after everything that happened. I hadnt enjoy a meal like this ever since I escaped from the Tower of Trials. Throughout the meal, Luna was glancing at my face every now and then. She was probably feeling anxious about Phils presence. [Now that we have the chance, I should formally introduce myself. My name is Youya and I used to travel together with Phil. This girl is my current party member, her name is Luna.] (Youya) [Lunas name is Luna. Luna is fighting together with Youya.] (Luna) The introduction was directly mainly at Phils sister, but it was also to introduce Luna to Phil. [My name is Phil Ether Lance, Youyas former party member and the guild receptionist.] (Phil) [My name is Till Ether Lance. I am Phils younger sister and I came to Rumberg to be an adventurer.] (Till) Although Phil gave off an impression of a mature adult, her sister Till gave off an impression of a lively young girl. Both of them looked similar with jade eyes, blonde hair and long ears. [How old are you Till? I am asking because I know that the age of an elf cant be determined by their appearance.] (Youya) [I am fourteen this year!] (Till) [Hmm.. Thats a good age to become an adventurer. Although I dont recommend it. Especially for a cute girl like you. If a man found you inside an isolated area such as a dungeon, that person would most likely be more dangerous than any beast you could find in a dungeon.] (Youya) It is dangerous for a party consisting of girls, not to mention a solo female adventurer since in the dungeon, a persons strength was the only thing that mattered. [Then why didnt you say the same thing to my elder sister?] (Till) [I am not opposing it just because you are my younger sister. If a girl came up to me asking to become an adventurer, I would advise against it. During my adventuring days, I was more afraid of other adventurers than I was towards monsters in the dungeons, much more than you think.] (Phil) In reality, Phil had always struggled when it came to interacting with other adventurers. She was often targeted by other people as a beautiful elf. Me and Leonard often had to protect her in desperate situations. Thinking back, I can understand why Phil would refuse Leonards proposal and chose to leave the party. If Leonard had decided to assault Phil in the dungeon, she wouldnt be able to stop him. Being in the same party would just be exposing herself to that possibility. [That is why I made a request to Youya. Please accept my quest.] (Till) Til bowed her heads towards me. Now that you mention it, she mentioned giving away the treasure of the elves if I accepted her into my party. [I wont allow that. Till. Youya is still a man. You will never know when he may give in to his desires.] (Phil) Ouch. Those were some harsh words. However, Till is not convinced. [Its okay isnt it? Although you were in his party for the longest time, nothing happened right? The two of you have even slept in the same bed together. You were essentially a couple outside of the dungeon. Its obvious that he isnt dangerous at all.] (Till) [Wh,wh,wh.. Why did you have to say it like that?] (Phil) [Could it be.. You ended up doing couple stuff together?] (Till) [Theres no way that happened.] (Phil) Phil started to deny that we were a couple back then. Its true that we werent though. Our relationship wasnt that of a couple, but rather a parent and a child. [Then its okay right! Its up to Youya whether he wants to accept my quest or not.] (Till) Up to now, the only person who Ive seen with an exclusive class was Phil. It was probably an Elf-exclusive class. Its highly likely that Till would be able to choose that class as well. If she does end up selecting that class, it could be a valuable asset to the party thanks to its war potential. Honestly speaking, the number of members currently isnt ideal. It would be better to find more allies as soon as possible to have four people in the party. [Well Ill consider the request. But first, what is the treasure of the elves that you offered?] (Youya) [Its the Drop of the World Tree. Its a special liquid that can only be made by elves. It takes about five years to produce enough for a bottle.] (Til) [Drop of the World Tree!? The liquid that can prevent a person from aging?] (Youya) [If its a human, just merely drinking a drop everyday is enough to stop the person from aging.] (Til) Til was looking at me while explaining about the treasure. It is a rather famous medicine known for its anti-aging effects. It was because of this medicine that elf villages were often targeted. Although, the desire to live forever is mostly existent among human beings. If I were to possess a bottle of the drop, I could halt my aging for up to two years by drinking a drop per day. It is something that I really want to have to prolong my body as much as possible. My body is already on the decline now that I am 36 years old. If I were to accept her request, I would be able to halt my aging, obtain a new party member with the possibility of taking up a powerful exclusive class. There were many benefits to accepting her request. I want to accept her request.. However. I do not want to support this girls rebellious actions. [Ok. If you are able to obtain Phils permission, then I will accept your request. My party does not accept anybody who runs away from their families without permission.] (Youya) Everyones attention shifted over to Phil who had the final say. [Til, Why do you want to become an adventurer so badly? Ill make my decision depending on your answer.] (Phil) Phil looked straight into Tils eyes as she asked about her intentions. [Because my sister looked like she was having so much fun being an adventurer. Back when I was in the village, I longed to see my older sister so badly that I decided to leave the village in order to see what she saw and experience what she experienced! I want to be like my sister who got to explore the world! Compared to being an adventurer, it is boring to stay in the village where I would only be able to see the forest!] (Til) That was a good reason. Curiosity is the best driving force as well as the best possible trait of an adventurer. Phil started laughing after she heard her answer. [I understand. Its also because Youya is a good person, Ill permit you to adventure together with him. Ill give in this time, and let you become an adventurer.] (Phil) [Yay I love you big sis!] (Til) Til widened her arms and hugged Phil. A pair of elves hugging would make for an beautiful painting. [If you are going to be in Youyas party, I will ask the guild to prepare a special class for you to attend tomorrow. Needless to say, I will only allow you to be an adventurer if you stay in his party. Youya, please take care of my sister.] (Phil) Phil bowed her head towards me [Leave it to me. Ill protect Til with my life.] (Youya) I will not let Phil down if it is a special request from her. However, Luna seems dissatisfied with the current situation. [Luna, dont pout like that because Til is our party member. Its not like Til is taking me away from you. Think of it as having an extra friend in our party.] (Youya) [Really? Will you not leave Luna behind because Til is here?] (Luna) [I promise.] (Youya) [Then maybe it is fine. Nice to meet you Til] (Luna) [Nice to meet you too, Luna-chan] (Til) Luna and Til shook hands as they greeted each other. It appears that we have come to a resolution. Now its time for us to celebrate with a meal. [Tonights meal will be my treat. Its a celebration for a new party member, everyone help yourself to the menu.] (Youya) With this, the number of people in our party has increased to three. Unlike before, there are a variety of things that we can attempt to do that we couldnt do before. Tomorrow, Til will attend the class and obtain her class. Immediately after, we will dive into a dungeon and evaluate her strength. The exclusive class given to elves is extremely overpowered. Although it existed during the game era, it was a class that could only be obtained by NPCs. In addition, that class was extremely compatible with my Magic Customization. Im looking forward to entering the dungeon tomorrow. The food here tasted even more delicious with alcohol. Its been a while since I let loose in a bar. [Why Youya. Why did you leave me behind?] (Phil) [I thought that Phil would be happier with Leonard rather than an old man like me.] (Youya) [Its just like Youya to decide things by himself~~.The one that I like is not Leonad.Ahways. We were ahlways together, sho why~~?] (Phil) It seems that the Phil has drank too much and collapsed on the spot. The other two girls were observing the situation closely on the side lines. [Luna, do you know the way back to the inn?] (Youya) [Yesh I do.] (Luna) [Ill carry Phil home while you bring Til back to our room at the Inn. On the way back to the inn, there will be an alleyway that is a shortcut back to the Inn. If you find the alleyway, you should end up back at the inn.] (Youya) [Okay.] (Luna) For now, lets settle the matter with Phil before I can think about diving into the dungeon tomorrow. Although she appears to be more of an adult than before, it seems that she is just a child who has just grown a little. Volume 1 Chapter 13 [You drank too much. Remember to pace yourself next time when you are drinking.] (Youya) Phil was dead drunk. Even though she should be aware of her own limits, she still ended up getting drunk. Well Im not completely free of blame this time. It was a reunion after such a long time and I ended up being careless. I nearly got myself drunk as well, but I managed to sober up and drank plenty of water. [Im sorry.] (Phil) [Is this the right place?] (Youya) [Yeah, this is my home.] (Phil) I could feel the warmth of Phils body on my back. Its a nostalgic feeling. I used to carry her like this so often back then. Although Phil is a first class adventurer right now, back when we just started adventuring together, it was so different. I was tired of carrying her back then. She would often fall down in the middle of the streets, or get injured unnecessarily. [In the past I often carried you around like this. It was tough work considering how many times I had to do that.] (Youya) [Uhn. How nostalgic. Youyas back is as comfortable as always. It feels like Im safe so long as Im here] (Phil) Phil started to place more weight onto my back, transmitting more of her temperature and even her smell onto my body. Shes been trying hard, and I kinda get the message. Although Phils outer appearance hasnt changed that much because of the elves racial characteristics, the Phil I knew and the Phil I know now are different. She has grown up to be a wonderful woman. . . . I carried Phil towards her room. It was clean and neatly organized. She was always the one in charge of housework, even back when we were living together. She was a great cook too. Back then I often told her she would make a good bride, earning me weird looks from her. I placed her down onto her bed and loosened her clothes by removing the buttons on her shirt. Now that she is home safely, its time for me to get back to the inn. There are various things that I have to teach till before her special course. The only time we have left is tonight and tomorrow morning, which isnt a lot of time since we will be entering the dungeon immediately after her class selection. Although that is if I get to leave the room. [Phil, could you please let go of my hand?] (Youya) Phil forcefully turned my head and gently gazed into my eyes. Thanks to the level reset, I do not have the power to resist her force. Its impossible for me to escape unless she lets me go. [Why, why do you leave me back then. You left without a word, just leaving a letter for us to read Do you know how sad. How lonely I was when you left?] (Phil) [If I remained, we would had definitely failed to complete the Tower of Trials. There was no way we werent going to attempt it with how enthusiastic Leonard and Lyle was about the tower. I couldnt bear to drag you and Leonard behind, who could become stronger. Because if it was someone who was stronger than me in the party, you guys could definitely clear the trials.] (Youya) The Tower of Trials has a survival rate of 2%. It is impossible to survive the tower with someone like me back then. Especially when the tower was designed to only be cleared by a party of four people who had reset their level. Clearing the tower yields multiple rare items and increases the level cap to 70, so that degree of difficulty is natural. In fact, Leonard was the ridiculous one who managed to clear the tower without the bonuses from a level reset. [You know that is not what I meant. Why didnt you ask me back then? Why didnt you take me with you? We were always together werent we? If you didnt want to attempt the trials, I would had followed behind you. I couldnt care less about aiming for the top. That wasnt the reason why I was in that party.] (Phil) Phils eyes starting to become moist. She had never shown those eyes when we were together back then. She is properly growing up, both in heart and body. [I have always longed for the Youya who rescued the village, who introduced the idea of being an adventurer to explore the outside world. The same man who saved me when I was about to be taken advantage of by other adventurers. The same person who Ive spend forever with. As time went by, my feelings just grew stronger and stronger. I thought that we would be together forever. Thanks to Youya, I felt like the happiest person in the world. But even then. Even so. Why did you abandon me? ] (Phil) It felt like my chest was stabbed by her words. At that moment, I wanted to tell Phil everything. [I didnt think about what I wanted to do after leaving the party. All I wanted was Phil to be happy with Leonard. If I were to consult the party about me leaving, Phil would surely leave with me, to me that wouldnt make you happy.] (YOuya) I thought that it would be best for Phil to be together with Leonard who had loved her deeply. Together the two of them would be able to soar to greater heights. So I decided to leave only the letter behind and disappear on my own. [Dont go off deciding peoples future on your own. We were always together, so why didnt you notice? It was not Leonard. It was never him.] (Phil) Her voice carried a strange tone while her jade eyes caught my eye without relinquishing control. Her entire body seemed to carry an alluring tone. I swallowed my saliva in nervousness [Im sorry.] (Youya) [Are you still going to pretend not to notice? Im not a child anymore.] (Phil) I didnt notice anything back then because I have always treated Phil as a daughter. Now that we havent met in a long time, I couldnt help but notice how mature she has become. [Phil, do you know what you are saying?] (Youya) [I do. Thats why.] (Phil) You told me so far, I understand what you are trying to say. However.. [Ouch~] (Phil) I did a hard flick onto phils forward with my finger. [Im not desperate enough to lay a hand on a drunken woman, nor am I hungry for a woman.] (Youya) [Meanie..] (Phil) [Sorry.] (Youya) [But Im relieved. I thought that you had come to dislike me thats why you left me behind. I was anxious thinking that I had done something bad. Thats why, could you sleep together with me tonight? Just sleeping. Its lonely to sleep by myself.] (Phil) [Alright. I will.] (Youya) [You have always treated me as a daughter, and I was fine with that. Because Youya was always taking care of me. You were always my first love.] (Phil) Phil closed her eyes, leaving herself defenseless with a man like me. I smiled nervously. I didnt expect to be shaken up this much with her confession. I had a hard time falling asleep. Phil wasnt the cute little girl I knew back then. She has grown up into a fine woman. An idea suddenly popped back into my mind. I could tell everything to Phil. Have her reset her level and fixing her status gain to the maximum, and go on adventures together again. It was extremely tempting. I spent most of the night watching Phils sleeping face and before I knew it, I fell asleep. . . . I returned to the inn at dawn. Luna was scolding me for being late while Til was teasing me the entire time. However, once they knew that I spent the night at Phils place, they calmed down. After that, we ordered room service and the owner of the inn delivered our breakfast to our room. While we were eating breakfast, we were explaining the basics of adventurers to Til. This went on until noon. [Lets start heading towards the guild. If Til misses her class, we wont be able to go into the dungeon afterwards.] (Youya) [Finally I can choose a class! I can become an adventurer now!] (Til) Til seems excited for her class selection. Now its just up to Phil to hold the class for Til. While we were talking about such things, the three of us prepared for our departure. . . . When we arrived at the guild, we went straight towards the receptionist desk to look for Phil. Since special classes aside from the weekly lectures arent considered official lessons, we have to look for Phil in order to attend the class. Strangely enough, Phil wasnt at the receptionist desk. [Where are you looking?] (Phil) I heard Phils voice from behind me, and there stood a Phil in her personal clothes. She looks much better in her private clothes as compared to the guild uniform. [Now that I think about it, today was your day off.] (Youya) [Initially I was supposed to deliver Til back to the village today, but the situation has changed. Ive talked to my superiors about the circumstances and the procedure has been approved.] (Phil) Despite just drinking yesterday night, Phil still managed to get the class approved. Her makeup looks much better than usual today. [Thank you big sister!! I will make you proud as an adventurer!] (Til) [Ill be supporting you as a sister and a receptionist, so try your best alright. Im sure youll do fine since Youya is around.] (Phil) [Leave it to me, I will make sure to keep your sister safe.] (Youya) Although Im protecting Til as a responsibility towards Phil, Im also doing it for my own benefit. As a reward, Til will be supplying me Drops of the World Tree. A liquid that stops the body from aging. With just a drop, a human body can stop aging for a day. Today was the first day I was given the drop, and I took it before we departed. Apparently the drop can only be obtained by elves, I wonder where did the drop come from..? [Follow me, Ill lead you to the classroom.] (Phil) Following Phils lead, we went into the room at the back of the guild towards the same room where me and Luna got our classes. . . . As expected, the place Phil lead us to was the same classroom. After the special class ended, Til is standing in front of the statue. She appears totally stiff as she stood still. It seems that she was more excited rather than nervous. Her enthusiasm was overflowing so much that I could feel myself getting excited as well. [Til remember to let me know what are the classes that appear in your mind.] (Youya) [Uhn. I know.] (Til) Right now, it was in the middle of the afternoon. We spent the entire time explaining the different classes to Til. There wasnt any specific class that I wanted Til to take, however if the exclusive class that Phil had was present for Til, I will ask her to take that class. If she doesnt have the class, Ill ask her to be a Magic Caster. Our party lacks a dedicated attacker. A party needs to have someone capable of dealing with large number of monsters. If a group of monsters were to appear infront of me and Luna, it would be a difficult battle as we had no range attackers who could attack from the back. There were also monsters who could render physical attacks ineffective, and my mana pool isnt large enough to sustain multiple spell casts for each battle. Hence, a Magic Caster would be ideal for our party. If the party member was a human, the Magic Caster would be ideal. However, Til was an Elf. For elves, the exclusive class that was present is a class that has priority over the Wizard class. It was a powerful class that was limited to NPCs back in the game era, players even thought that the class was unbalanced even in the hands of an NPC. Til started to pray in front of the statue. [The classes that appeared were Warrior, Fighter, Magic Knight, Thief, Magic Caster, Monk, Ranger and the Spirit Archer.] (Til) There it is. The exclusive class that can only be taken by an elf. [Take the Spirit Arche.] (Youya) [Hurray! Will this class let me becoming an amazing adventurer?] (Til) [Thats a special class that cant be taken by ordinary adventurers. It will make you a top tier adventurer if you can master it. I guarantee it.] (Youya) [Then, lets take it!] (Til) Tils body was covered in a familiar glow. The light enveloping her body caused her body to become slightly transparent. Her body started to change back to normal after the glow dissipated. Til is now officially a Spirit Archer. [I am the Spirit Archer Til now!. Please take care of me from now on!] (Til) [Ill do my best to meet your expectations.] (Youya) Spirit Archer is a powerful class as its a combination of the Ranger class and the Magic Caster class. Rangers are capable of attacking from long distance using a bow while utilizing exploration skills. Magic Casters were capable of casting magic spells of all three attributes: Fire, Water (Ice), Wind (Lightning). Spirit Archers were capable of utilising bows for long-ranged attacks while having the ability to cast magic of the Wind (Lightning) attribute, giving them two different forms of attacks. Although the Spirit Archer appears to be similar to the Magic Knight, magic knights did not have the same status correction that spirit archers have. Spirit archers have improved mana pools, attack power, speed and magic power with a decent increase in physical capabilities. This meant that they have similar benefits in status corrections to rangers and magic casters without the downsides. The classs greatest strength wasnt the ability to utilize two types of attacks, but the ability to use two types of attacks simultaneously, showcasing its ability as an exclusive class. Its ability is much more amazing than it appears to be. When I was watching Phils battles back then as a spirit archer, there were many instances where I wished I could be a spirit archer. Similar to Phils case, it would be better to have Til experience the strength of her class rather than explaining it in words. Im sure Til will be as surprised as Phil was back then. I cant wait to watch Til showcase her power. Volume 1 Chapter 14 [By the way, how good are you with a bow?] (Youya) I was so engrossed in the fact that our new member was a spirit archer that I forgot the most important thing, whether Til was capable of using a bow. In reality, a bow is a difficult weapon to use and master. It usually requires several years of training before a person can accurately hit a target from a distance. However for people who are unable to master a bow, they end up using a crossbow stead. As compared to bows, crossbows sacrifice range and power for higher accuracy and ease of usage. Majority of rangers and other bow users in this world end up using a crossbow. [Fufufu.. Dont be foolish. To an elf like me, a bow is merely a toy. I could hit a bullseye from 200 metres away. In the archery tournament back in my village, I won first place easily.] (Til) [Thats amazing.] (Youya) The original range of Fire Storm was 20 metres. Her range was ten times of that. It is impossible for spells to hit a target over 50 metres away unless the spell was altered by Magic Customization. The effectiveness of an attack is directly proportional to the attacks distance. Having the ability to attack a target from a distance was a huge advantage. I seem to recall Phil mentioning that elves had the ability to read the flow of the wind, allowing elves to perform precise long distance shots that is impossible for humans who are unable to accurately detect changes in the atmosphere. Back in the days, Phils precision in her shots has helped us on many occasions. [So where is the bow that you are boasting about?] (Youya) [Of course its in my house. Where else could it be. Eh?] (Til) Tils face turned pale. I thought so. Yesterday, Til mentioned that she had came to this town by stowing away on Phils chariot that left the village. That meant that she didnt have the space to carry along her bow, possibly exposing her. [Before we head to the dungeon, we have to equip ourselves with proper equipment. Lets head towards an arms shop for now. We cant enter a dungeon with an archer without a bow can we? I was thinking that itll be good for Luna to get a spare dagger as well.] (Youya) [Luna doesnt need it. Because Luna has this.] (Luna) Luna rubbed her cheeks against Bazerato. She has always been taking good care of that child, treating it like a treasure and properly maintaining it everyday. [It is important to carry a spare weapon. Weapons will inevitable be destroyed in the future. Whether that happens during a battle, is a matter of life or death if you do not have another weapon. No matter how much you maintain your weapon, it will still break eventually.] (Youya) [I understand. Ill carry a spare dagger from now on.] (Luna) Luna reluctantly agreed. Bazerato is a tough dagger, however its durability will inevitably drop over time. Its an adventurers drop to prepare for the unexpected. If even the slightest possibilities are neglected, it could lead to our death. [Youya, Ill pay for my younger sisters equipment. Its doesnt feel right to have you pay for her equipment.] (Phil) [No can do. She is already part of my party. When I said that Ill get a bow for her, I meant what I said. For the money, I will subtract it from her portion of the rewards in the future. Furthermore, it isnt good for her to rely on her elder sister all the time.] (Youya) [Youya hasnt changed at all. This is definitely something you would do. I understand.] (Phil) Phil laughed as she talked about the past. Looking at her laugh reminded me of our past together, and I decided to ask her what I was thinking about yesterday. [Hey Phil. Do you enjoy being a receptionist?] (Youya) I had a motive to asking her this question. If she didnt enjoy working as a receptionist, or felt that she didnt belong here, I would invite her to my party on the spot. She would be a valuable asset to the party if she joined. Besides, I wanted to travel with her once again. [Yes I do. Very much.] (Phil) Phil let out a smile from the bottom of her heart. I guess that Phil has finally found where she belonged. It isnt up to me force her out of something she enjoys. At the very least, I wont be inviting her to the party for now. If in the future, she ever thought otherwise, I would invite her to my party once more. [Why are you asking that out of the blue?] (Phil) [Its nothing. I just wanted to hear you say it.] (Youya) The conversation ended there. After completing various procedures, the three of us headed towards the downtown area. This is the city of beginnings. There should be plenty of stores that are selling equipments for adventurers. . . . In the downtown area, there was a group of adventurers who were catching a lot of attention. The group consisted of two beautiful girls, one beastman and an Elf, and an old man. When choosing a weapon, it is important not to waste time entering each store and looking through each of them to see their goods. Instead, you should start by choosing a shop that looks decent.I can mostly tell if the shop is good depending on how the store looks like from the street. As Rumberg is a town that is extremely popular, there are many people who come to the town. In this world, if you can raise your level, you will become stronger and you will become much safer, making it advantageous to raise your level. Many nobles and rich aristocrats often send their children to the starting towns to get a class and raise their levels. In order to secure their childrens safety, they often buy the most expensive equipment if it meant that it would protect their children even more. As such, many stores often aim to deceive these people and squeeze out as much money as possible. After being an adventurer for so long, Im able to distinguish the decent stores from the scam stores. [That store looks good.] (Youya) The entrance of the store is clean and the air inside smells of anti corrosion oil as well as moisture removal solution. Unlike the other stores which doesnt have the same smell. [Lets go. Not only are we looking for weapons for you two, I too look forward to searching for any decent equipment.] (Youya) [Have to choose the best equipment.] (Luna) [fufufu. I can hear my future bow calling out to me] (Til) Feeling motivated, the three of us entered the store. There was an old man sitting at the counter performing maintenance on a sword, appearing to be the owner of the store. As he noticed us entering the store, he sloppily gave us a glance before focusing on his work. [This isnt a store for sightseeing. So hurry up and leave.] (Storekeeper) Although his voice was soft, his words carried a lot of weight. [I dont mean to intrude, but we came here to find weapons that we can entrust our lives to.] (Youya) I looked at the old man as I tried to convince him of our patronage. Our eyes were in a deadlock before his facial expression became softer. [Hoh.. I thought that you were mere tourists because you brought two children here, but it seems that you are more interesting than I thought. I would be damned if I let my weapons be ill-treated.] (Storekeeper) [Have faith in these children. They will take good care of your weapons for sure.] (Youya) The storekeeper complied with me and returned to his work. [Luna,Til, look around and choose the weapon you feel is best.] (Youya) [Okay.] (Luna) [Well then, time to begin shopping.] (Til) The two of them went to their respective sections of the store to look for a weapon. Luna went towards a shelf containing a dagger. It seems that she had a target from the start. She immediately took a dagger from the shelf and started to test its weight and center of gravity. She has a good sense when it came to battles and the like. When searching for a spare weapon, the important thing is to have a weapon that is similar to your current weapon rather than its performance. If you were to swap between two difference weapons mid fight, you could be thrown off by the difference in your own weapon. This is even more important for Luna as her main mode of attacks were critical hits that required precision. [Youya, Luna likes this dagger.] (Luna) [Thats a good choice. The dagger is made of a mithril and mercury alloy, making it light and strong. Furthermore, it has a fine craftsmanship. Thats a keeper.] (Youya) Although that dagger looks plain, it is surprisingly well made. If it was me, I would have chosen the same dagger. Looking at Til, she was currently stroking a bow with her hand while her jade eyes were examining the bow carefully. She gave off a serious atmosphere that felt like she was in her own world, making it difficult for me to approach her. Til was the champion of an archery contest back in her village. Being the best archer of the race that specializes in the bow, it seems that all that talk wasnt just for show. After examining all the bows present in the store, Til finally selected a bow. It looks like a plain wooden bow but mana could be sensed being emitted from it. It was probably made from a magical tree that could absorb mana. Such bows could serve both as a bow and a wand to amplify the users magic power. It was the best weapon possible for a spirit archer that incorporates both archery and spells in their attacks. [This bow is good. I can feel that this bow is well crafted. It will be a fitting bow for a top tier archer.] (Til) [I may not be able to determine the quality of the bow, but I do agree that that bow feels excellent.] (Youya) The truth is that I knew nothing about the quality of a bow. I am capable of determining whether the material used was of high quality, however there are more aspects to a bow than its material making it impossible for me to determine the performance of the bow. Unlike me, Til is a master at archery. Even if I couldnt tell, I am sure she wont be mistaken in the performance of a bow. I took the dagger and bow chosen by Luna and placed them on the counter. Their weapons cost quite a hefty sum but I am sure the weapons will last for quite a while. While I was preparing to pay the storekeeper, he started to laugh. [Hahaha. Although you told me to believe in them, those kids are something else. When I look closely at them, I feel compelled to doubt them, but it seems like they are the real deal. THey have good eyes, they chose the best weapons I have in the store.] (Storekeeper) The storekeeper took the dagger and the bow and skillfully placed them in their respectively holders before checking the amount of money placed on the counter. After confirming the amount, the storekeeper handed over the weapons to the two girls. When they received the weapons, Lunas tail started to shake back and forth while Til was rubbing her cheek on the bow. [If you feel unsatisfied with the weapons, or you want to have them repaired, remember to return here. Ill see what I can do, and if that isnt enough, Ill introduce you to a good blacksmith.] (Storekeeper) [Ill be relying on you when the time comes.] (Youya) It is important to maintain a good relationship with a trustworthy shop like this. The quality of the weapons may be excellent, however the weapons maintenance must not be neglected. We are extremely fortunate to meet this man and his shop. As we were leaving the store, I felt something call out to me. I looked towards the basket in the corner of the store. Within the basket were countless second-hand goods including swords and other arms. So long as you were not strapped on cash, it was not the place where an adventurer would be looking for a weapon. It was dangerous to choose a low quality weapon to rely on. Well, its not like the quality of the weapon matters to me. Unknowingly, my hands reached out towards the pile of swords. My eyes were fixated on the sword at the back of the pile. It was a sword with an unusual shape and a black sheath. I pulled the blade out of its sheath. Its blade had a similar shade of black to its sheath and contained a strange sensation similar to mana, however it didnt feel like mana. It felt a sword designed for hacking and slashing rather than clean slashes that were taught in swordsmanship It felt like it was meant to be. [How much is this sword?] (Youya) [Fuahahahahahaha. I never thought that you would notice that sword. I thought that the children were amazing, but the main course was even more amazing. Dont worry about the money. Just take it.] (Storekeeper) [You sure about this?] (Youya) [Of course I am.That sword was a masterpiece entrusted to me by my father. It goes without saying that I will only allow people who were chosen by the sword to leave with it. Its been almost fifty years since this sword has last chosen an owner. I never thought that I would get to see its new owner in my lifetime.] (Storekeeper) The storekeeper looked like he just seen something interesting. I said a word of thanks to him and gracefully received the sword. Unlike the dagger and bow, the shopkeeper wasnt that concerned about the sword. He must have felt like the sword was in capable hands and that there wasnt a need to be too concerned about it. It was a nice development. I didnt expect to come across a hidden gem when purchasing new weapons for Luna and Til. I took the sword and hung it at my waist where my trusted sword would be. Although the sword felt comfortable, I wished it was slightly heavier. [Thank you, be sure to come again.] (Storekeeper) [I am looking forward to coming back.] (Youya) After we finished our business, we left the store. This was a fruitful shopping trip. Looks like itll be a good idea to stay in this town a little longer. [Luna,Til. This was a fruitful shopping trip. However it is getting late, we could postpone entering the dungeon to tomorrow morning instead. What do you two think? ] (Youya) I asked the girls a question I knew the answer to. [Of course, we leave right away!] (Luna) [I cant wait to show off my skill in the dungeon!] (Til) [Alright. Lets go then.] (Youya) There arent any adventurers who look forward to testing out their new equipment. I took the two motivated girls and returned back to the guild. Its the first time we are entering a dungeon with three people. Lets witness how powerful Tils archery is and her power as a Spirit Archer. Volume 1 Chapter 15 Ill like to see it. The ability to hit any target within 200 metres. In reality, the biggest hurdle for every archer would be to accurately hit a target. The status may increase, and the equipment may become increasingly effective, raising the power of each shot. However, all of these are redundant if the arrow doesnt land. Unlike the sword and the spear, the bow user requires practice and accuracy for the bow to be effective. It would be impossible for a new archer to accurately hit a target at 200 metres away unless it was a massive monster. It takes a new bow user at least five years minimum before he can become a first-class archer. There are several first-class bow users that are well-known through the world, however almost all of them specialize in the crossbow. There arent many people who would spend years of their life to master a bow when they could simply use a crossbow which was easier to use. Even if the crossbow sacrifices power and range, it was still effective as a range weapon. Mastering the bow was avoided mainly due to the commitment required to merely utilise effectively. However, once mastered, it is one of the most powerful weapons. Bowmen could easily let loose waves of arrows down upon swordsmen and spearmen with a force close to a sword strike. It is a weapon that can be the strongest if mastered, and the weakest when unprepared. [Luna, can you search for enemies nearby?] (Youya) [Uhn. Ill try to.] (Luna) Luna began to search for enemies using Presence Detection. Presence Detection is a convenient ability to have as it allows us to search in a radius of 150 metres around us, increasing our hunting efficiency as well as preventing surprise attacks. [Found it. Youya. Til. In this direction, there is a rabbit monster hiding in the grass 140 metres away.] (Luna) In the direction that Luna pointed, the grass that grew to knee level, could be seen moving unnaturally as if there was something inside. It would have easily been dismissed as the wind if we didnt have Lunas Presence Detection. After listening to Lunas directions, Tils expression changed. The atmosphere around her changed from an energetic young girl to a seasoned hunter as she generated an arrow. [Til. Can you see it?] (Youya) [Yeah. The eyes of an elf is special. Especially the eyes that belong to an Ether Lance. I can see the rabbit in the grass as clear as day.] (Til) Looking closely, her jade-coloured eyes were shining with a jade glow. Thinking back, Ive heard about the eyes inherited by her family. Among the elves, there are families who have a stronger connection to their ancestors blood as compared to a normal elf. This gave them the ability to see long distances, fluoroscopic ability, dynamic vision that far surpasses a humans ability and even the ability to predict several seconds into the future. This was an ability that every bowmen desperately wanted as it was an ability that raises their combat effectiveness beyond their status. Til released her hand and arrows flew through the air. It wasnt just one arrow but three arrows. She released three arrows in a single breath with such refined movement that even an amateur could understand. The arrows werent flying directly at the target, but rather drawing a huge arc as it rode the strong winds blowing in the plains. When shooting a target a hundred metres away, even without exposure to strong winds, it would be impossible to predict where the arrows would land. However, the arrows that Til released flew through the plains as if it was one with the wind. [PII GYUUU] The scream of the monster could be heard in the distance, and the sensation of power welling up from within could be felt. It is the sensation a person feels when they are gaining experience points. [Uhn. That was amazing. All three shots landed.] (Luna) [Your aim is as good as Phils.] (Youya) [Because we have the same teacher. After she left, I was always the best in the competition! I can hit my target about 200 metres away with about 70% accuracy! If its three hundred.. Maa Ill manage somehow!] (Til) That is a reliable accuracy. With this range, we can perform a one-sided hunt with arrows form a distance. There is no safer way to hunt monsters than to hunt a monster even further than the range of Presence Detection. In addition, it can be used for luring. [I understand that your archery skills are top-notch now. Did you allocate all of your skill points properly?] (Youya) [Yeah. I did as you told me to and put three points into Arrow generation.] (Til) [Good. It will be an important skill for you in the future. As it is now, a quiver of arrows wont last very long in the dungeon. Using the skill will allow you to produce arrows using your mana. In addition, the quality of the arrows corresponds with your status, meaning that the arrows will become stronger as you level up. Eventually, it will be stronger than any commercially available arrows sold in stores everywhere.] (Youya) [hee. That sounds pretty amazing. I did feel that the arrows I made earlier was pretty bad, so they will become better in the future.] (Til) [I guarantee it. What about the other two points?] (Youya) [I properly placed them in the other skill.] (Til) [Good girl.] (Youya) That skill was necessary to unlock the strongest benefit of a Spirit Archer. Well then, time to continue the hunt. . . . Afterwards, the hunt progressed smoothly. Til was able to spot enemies from a distance thanks to her superior vision. That vision itself was a powerful weapon for battles. Monsters that were hidden from her vision was revealed by Lunas Presence Detection. If there were any monsters who were approaching us, we would defeat them with ranged attacks. From this, I could tell that Tils accuracy wasnt the only thing noteworthy. Her rate of fire and power were exceptional as well. Tils level is raising steadily as well. She is currently level 3, and the skill points were immediately used. At the moment, her skills were sufficient. Its about time for us to venture deeper into the plains. Generally, the deeper you enter in a dungeon, the stronger the monsters. [Youya, something big is approaching us quickly from the ground! (Luna) Finally, its here. The enemies that we hunted earlier were far too weak to display Tils full power, but with this monster, it should be possible. The area ten metres ahead of us exploded as something came out of the ground. We had no choice but to let it approach this close as we wouldnt be able to attack it from a distance when its in the ground. What came out of the ground was a bipedal bear that far surpassed my height, Mad Bear, the strongest monster in the dungeon. It was a powerful monster, albeit not as strong as the Rock Golem, beginners were heavy pressed to defeat this foe. It boasts a high attacking power, with explosive power due to its strong muscles and sharp nails along with high defensive power thanks to its thick fur, preventing any blade from passing. [Ill be the front line. Luna. When you see an opening, push in with your Assassinate. Its weak spot is its sides. Til, stay at the back and support us . [Leave it to me.] (Luna) [Understood.] (Til) The three of us moved to our respective positions, forming a party formation. With the three of us battling in a formation, makes it feel like an actual party battle. I can feel the adrenaline starting to kick in throughout my body. The main focus in this fight will be on Til. I ran behind a wall and began my chant for a spell while focusing on the monsters movements. In the next instant, the Mad Bear swung its claws towards my position. Movements at this level is easy to predict. Using my sword as a shield, I received while simultaneously deflecting its attack to the side. Realizing its attack was easily deflected, the beast became infuriated and continued throwing attacks after attacks. Monotonous attacks like these based on pure rage wont even land a scratch on me. [As usual, Til is good with her bow.] (Youya) Arrows rained over the monster from a distance as Til continued to provide support. As the front line, focusing on our preys movements allows me to avoid attacks while simultaneously throwing out my own. However, to attack a moving target with only an arrow, you will have to predict the preys movements a few seconds ahead. The Mad Bear began to scream as both of its eyes got pierced by the arrows. From the beginning, Til has been firing arrows from about 30 metres away. She managed to attack the bears eyes with pinpoint accuracy at that distance. What unbelievable skill. She seems to have been much more than I imagined. After getting robbed of its vision, the bear began to retreat. While it was beginning to retreat, a shadow rushed into its large body at a high-speed. Luna found an opening just as the beast began to retreat and rushed in with her full power. It was a rush which was refined by diligently training everyday. Her dagger entered the side of the beast and the sound of a critical hit resonated throughout the plains. [GUUUGAAAAAA] The characteristic of Asssasinate was its extremely high damage multiplier that activates only on a critical hit. The beasts expression began to distort into one of agony. Seems like the battle will be over soon. This whole time, Til has been providing support by releasing waves after waves of arrows. She had been chanting ever since the battle started. Spirit Archers did not have the same restriction as other classes while chanting, allowing them to simultaneously chant while moving, albeit only a single spell at any given time. This gave the Spirit Archers high offensively capabilities as they were also bow users. Even if a magic caster could move while chanting, they were unable to provide support during their chant. That is why spirit archers were effective as a back line attacker, as they were able to perform long ranged attacks with bows while casting spells. Til finished chanting and began to cast her spell advanced tier magic Thunder. As her level was still relatively low, the time taken for her to cast a high-ranking spell with high power and wide range was extremely long. In addition, her current mana pool was only capable of one shot, but that one shot was all that was needed. I backed away from the beast as her chant was completed to prevent any friendly fire. The next moment, the Mad Bear collapsed and turned into blue particles. [Man, a spirit archer is tough as expected.] (Youya) The spirit archers greatest strength was the ability to simultaneously utilise both physical and magical attacks at range. They could effectively increase the number of hands in the party by shooting arrows from range while they were chanting. This prevented any bow skills from activated but a bow still has a power that is high for a basic attack. Tils elder sister, Phil had focused her skills on her passive magical skills (abilities that are always invoked) and her bow skills. Spirit archers were inferior to magic casters in the Wind (Lightning) attribute and did not possess the utility that rangers possessed, but their advantages arent noticeable to the unaware. Even in our current party, we will be relying on her abilities much more often in the future. It is a style that greatly resembles my own. As Til fired her bow while chanting, she displayed her ability as an adventurer in the back line, firing arrows while chanting spells, just like a magic knight utilising magic in the front line. This feat is impossible back in the game era as any attack commands recognized by the system would cancel the chant, making this a style that is only feasible because that game has become a reality unbound by any systems. This is getting exciting. Both me and my party are definitely becoming stronger. Now that the fight is over, Til and Luna gathered together with me. [Just as big sis said, Youyas swordsmenship is amazing. You took the blows from the bear like it was nothing! Luna too! Your thrust looked so simple yet it was so powerful!] (Til) [Uhn! It was the technique that Youya taught me. But Til is even more amazing. All your arrows hit your target and yet you could still cast magic. That is so amazing!] (Luna) Luna and Til were complimenting each other. Looks like their friendship is just beginning to blossom after watching each others abilities. They will be getting along well before they even know it. Looking towards the sky, the sun has begun to fall. It is about time for us to head back, but after looking at how motivated the two of them are.. Lets stretch the time limit and hunt as much as we can, this way we can improve our coordination and their friendship . [The two of you, we will continue to hunt untill the last-minute today! The three of us still have much to learn!] (Youya) [Uhn! Leave it to me! That attack felt good, I want to do it more! Even more assassin!] (Luna) [Ill try my best too!] (Til) We continued to search for our next prey as we ventured deeper into the dungeon. This has been an exciting hunt so far. With this trio, I am sure that we can reach further than I did back in my prime. We can continue to grow together and become stronger. That night, we continued to hunt much longer than we had planned. Volume 1 Chapter 16 However, today will be the last day I am able to come here. I should be able to obtain level 11 after this hunt. To respect the level limit, I wont be able to enter this dungeon anymore where the level limit was set to prevent veteran adventurers from entering. My fist begins to glow red and becomes ablaze. [Napalm Strike.] (Youya) I pierced the belly of the golem with my burning palm and burnt it from the inside. The body of the Rock Golem began to turn into blue particles. Finally, the last Rock Golem gave me a Karakuri Heart. With gratitude, I stored the item into my magic bag. [Its going to become much tougher from now on.] (Youya) Ah, I accidentally said my thoughts out loud. Thanks to Luna who possessed exploration skills, our hunt went without a problem. Although thieves generally didnt possess much firepower, Luna overturned that general perception by mastering Assassinate. And I am the front-line of our party. Magic Knight is a class that has the fitness and defensive strength of a front-line class. Although, this was possible only due to the hidden room which fixed my status increased every level to the max, allowing me to have the same defensive power as an ordinary warrior. With this status and my ability with a sword, I can become a wall for my party that is equivalent or stronger than any first-tier warrior of the same level. In addition, I possessed Customized Magic which has its own strength and overwhelming firepower. My offensive power as a front-liner was much higher as well. Lastly, our backline which currently consists of Til. She is a Spirit archer who is capable of casting magic while simultaneously providing support with her bow. She was supplementing for a magic caster by providing magic spells, providing firepower equivalent to two people. With us three each playing an important role, individually we were important parts of our party as we have performed much more than our roles required us to. It is obvious that we were making good progress due to this. Since the battle is over, Luna and Til began to rendezvous on my position. [Good job, the both of you.] (Youya) [Luna worked hard today. I have assassined plenty today as well!] (Luna) Luna expresses her successful Assassinates with a weird term, however that expression is surprisingly cute. Personally, I like that term. When I stroke Lunas head, Luna narrows her eyes, showing that it feels pleasant and shakes her tail back and forth. Surprisingly, she worked extremely hard and managed almost a 70% critical rate in this short amount of time. Not to undermine Lunas hard work, but the thrust is the best attack in landing critical hits and most compatible attack with Lunas soft and silent high-speed rush. However, the stronger the monster, the faster their movements, and the harder it is to land a critical hit. It wont be long before she encounters a monster that she cant Assassinate with just the thrust. Landing a critical hit in any situation with any position. In order to perfect that technique, she will have to master all nine types of slashes. Now that her thrust has become more or less perfect, we should begin to work on her range of slashes. [Aaa, its not fair to praise only Luna. I did my best too! Praise me!! Praise me!] (Til) Tils cheeks puffed up as she complained about the situation. In reality, Tils progression was far more terrifying than Lunas. As her level increased, her mana pool increased as well as her mana efficiency. IN addition, her usage of magic along with her bow became much more refined as compared to the battle with the Mad Bear. However, there are still many weak points present in her battle style. She is first class when it came to archery, however the rest of her movements were still amateurish. There is no point in having the strongest offense when you arent able to protect yourself. Her position in the part is part of the back line where shes safe from the main battle. It is ideal for her current state but this provides a risk. There are many cases in dungeons where monsters will sneak up from the back, causing our positions to be reverted and exposing danger to the back line. This is especially dangerous for Til, as she tunnels her entire concentration into firing her arrows, she neglects looking out for her surroundings as she is attacking. For now, I asked Luna to look out for TIl with Presence Detection and to follow-up in the event that we were ambushed. Although such an incident has yet to happen, we should assume the worst situation where we would have to protect ourselves. For this, Ive been thinking about giving Til special lessons about close quarter combat. [Til did great too. You were our valuable ace when it comes to defeating groups of monsters.] (Youya) [Eeeh? Just lip service?] (Til) [I guess I dont have a choice.] (Youya) I pat Tils head. Together with Luna, the two of them narrowed their eyes in pleasure. The two of them became good friends over the course of this week. The number of capable children has also increased by one. Even though the two of them have strengths, they are also full of faults, they still have a long way to go. Somehow, I feel relieved watching the two of them acting like normal girls around each other. Even though they are special in certain ways, there are still merely children. Im lucky that these girls are working hard under my guidance . [Its about time for us to head back. If we stay here too long, Phil may get worried.] (Youya) [Uhn.Tonights a feast. It was a promise.] (Luna) [I too remember that if we reached level 11 today, Youya would let us ask for a special order at the bar!] (Til) [I know that. I plan to uphold that promise.] (Youya) [Yay! Luna loves Youya!] (Luna) [Me too!] (Til) Luna on my right hand and Til on my left. The two of them hugged my hand as we returned back to the guild. Well Im also looking forward to eating something good tonight as well. Besides, my food always taste better when eating with these two. Although, because of how clingy these two girls are, my reputation in the guild has dropped drastically. Ive even been given names such as lolicon or loli knight. Rumors have also spread that I am only successful as a magic knight because ive managed to attract talented girls into my party. I have to take action soon to prevent the situation from worsening. I am definitely not a paedophile. . . . When we arrived at the guild, we headed straight towards the reception to turn in our quest, earning us a bunch of guild points and cash.Obviously, the receptionist was Phil. Phil is popular among the adventurers and thus often has a queue in front of her. However the guild is similar to a private organization where anything can be done with money. It is possible to have an appointment with a receptionist by paying an additional fee. It is thanks to this appointment system that I can consult Phil directly without waiting in the queue. By the way, Phil herself paid the appointment fee to the guild. Since majority of the fee is given to the receptionist as a bonus, majority of the fee would return to her. She requested to do so as she wanted to keep track of her sisters movements as well as to help her out when needed. After listening to her reason, I had no choice but to concede to her. Out of curiosity, when I inquired another female receptionist about Phils popularity, it seems that her abundant knowledge and experience, apparent strength and appearance were the reasons that she was popular. Her reservation slots were also completely filled. It seems that she had some control over the list seeing as she could fit us into her packed schedule. The surrounding adventurers were making an envious face as Phil smiled while looking directly at me and shook my hand. Somehow it feels like Phil is oblivious to how popular she actually is in the guild. I sat in front of her as I report the status of the party. [Youya, even if its you leading the party, isnt your pace a little bit too quick? Just after a week and everyone is over level 10. Ive been a receptionist for a while but this is the first time Ive seen this.] (Phil) Phil squinted her eyes as she looked at me carefully. [Its not anything special isnt it? Itll be like this if we completed the quests you recommended to us as well as hunt Rock Golems daily in the dungeon.] (Youya) [Its the fact that you can even beat the golem that is strange.] (Phil) Phil is definitely an excellent receptionist. Although I report our partys levels every night when I deliver the quest document and materials, the next morning she would have prepared and introduce a delicious quest to us for that day. The quests would often be difficult enough for us to clear while providing excellent rewards. They played a huge part in our speed although the Rock Golem did provide a lot of experience. Since beginners cant defeat dungeon exclusive monsters, the only ones hunting the Rock Golems were us. It is possible to match our pace if you have Phils introductions while hunting other monsters in the dungeon, however there would be competition as everyone else would be hunting those monsters as well. Whereas we could freely hunt the golems without waiting for the monsters to respawn every week. Their individual experience values were high and rare items could also be dropped. Thanks to that, everyone was able to achieve level 11 in just one week. [Heres the material for the quest and these are the items that I would like to cash out please.] (Youya) [This much!!? Arent you earning as much as an intermediate adventurer?] (Phil) [Well yeah. If its after their respawn, in a beginner dungeon with fewer competition, its possible] (Youya) With their spawn rate fixed weekly, the monsters and treasures respawn and the geography of the dungeon changes. Although the risk is higher, it is the most efficient day to go into the dungeon. Thats why we entered the dungeon earlier today and hunted from the early mornings. Thanks to that we were more exhausted than expected, but we got a level higher than our goal. [You are definitely doing something! Even if Til has the firepower of two people, even if Lunas increased power from Assassinate, it shouldnt be THIS fast! It still doesnt add up!] (Phil) As expected of a professional receptionist. Just by looking at our party composition, she could estimate how much we can achieve with our capabilities. [Youre a former adventurer arent you. Us adventurers have things that we must not reveal carelessly.] (Youya) [Youre right. I wont ask any more. But about tomorrows dungeon and quest..] (Phil) [Its alright. The dungeon tomorrow has already been decided.] (Youya) Thinking back, we are finally level 11. Thanks to this, we cant enter the mountain dungeon anymore. With items from my peak and other special bonuses, there are a bunch of methods available to us that is impossible for others. [I have a bad feeling about this. Where do you plan to go tomorrow?] (Phil) [The seafloor dungeon.] (Youya) Phil gasped. Well that is to be expected. The seafloor dungeon isnt a dungeon meant for beginners in the first place. That dungeon has a recommended level 25, it isnt a place for chicks at level 11 to enter. Far from making a mistake, its a place where even making half a step incorrectly would be dangerous. [Thats suicidal!] (Phil) [Dont worry about it. If I was alone, thatll be true. But Im not alone this time. I have friends entering with me. If there are others, I have a plan.] (Youya) Our hunting so far has been within the realm of common sense, even if its pushing the limit. However, now that were level 11, we will finally begin hunts that are extraordinary. If I were to stick to conventional hunts, I would die of old age before I even reach level 50. Phil puffed up her cheeks while looking at me, before letting out a sigh. [Im guessing that is also a secret.] (Phil) [Yeah.] (Youya) [Sigh. Fine. I believe that Youya wouldnt put Luna and Til in any danger, but just in case, please keep this with you.] (Phil) Phil took out three blue jewels from her pocket. [Those are Return Stones arent they? I cant receive such expensive things.] (Youya) [Its my feelings as an older sister thinking about her younger sister. Dont worry about the money, they are items that I obtained back when I was still adventuring.] (Phil) Return Stones are items that can be used to escape from a dungeon instantly, regardless of the situation. It is impossible to create this stones, as they are items that can only be obtained from chests in the dungeon. For adventurers, this was akin to a lifeline that everyone wanted, causing the price of the stone to rise. [Then Ill humbly receive them. Ill try my best so that we will never need to use them.] (Youya) [Well they are only used when you are in the worst of the worst situation.] (Phil) [Of course.] (Youya) Phil looks at me and laughs. With this, the conversation ends. Phil hands over the quest reward and drop item fee and I leave the guild. Now then, I cant leave two kids starving and waiting for too long. Tonights superstar menu will be a gigantic roasted pig foot. Those two will definitely enjoy tonights meal. . . . The next morning, we entered the seafloor dungeon. [Youya. Looks weird.] (Luna) [You are not wearing your usual leather armour today?] (Til) [Well.] (Youya) I equipped a different set of equipment from my usual equipment this time around. I wore a robe instead of my usual leather armour, and a cane with a jewel at the top instead of a sword at my waist. [I just felt like wearing this today.] (Youya) We came here to do some a unique hunt not within the realm of common sense in this world utilizing my Magic Customization. My customized spells doesnt consist of only Napalm Strike and in this dungeon, there are other magics that can truly shine because of the dungeon. We will kill monsters with levels that far surpass our own to raise our levels as quickly as possible. It is also possible for us to go the standard route and raise it slowly, but this method is far more desirable than that. Now lets get hyped up. From here on we are shifting into full gears. To be the fastest to reach level 50 in this world. Volume 1 Chapter 17 The seafloor dungeon isnt a dungeon meant for beginners at level 11, it was a dungeon where even veterans would come to hunt. That is the reason why we came today, as the number of monsters are reduced thanks to the veterans, making it much safer than it appears to be. Usually, coming into this dungeon at level 11 would be suicidal.Despite our excellent equipment, and reset bonuses, it is still insufficient for us to have a proper hunt here. However, having magic catered to this sort of situations will allow us to get by somehow. The higher the difference in level, the higher the bonus experience will be. For every level, the monster will provide an additional 5% experience points. If there is a level difference of 14, the experience given will be 1.0514 which is roughly 1.98 times the usual experience given. In the first place, the experience value given by a monster increases depending on their levels. If a level 25 monsters experience value doubles when its defeated by a level 11, our levels will raise at an exponential rate. [Lets go, Luna, Til. Remember to have your return stones ready in case of an emergency.] (Youya) [Uhn. Properly ready.] (Luna) [My sister went out of her way to give it to us, of course Im ready.] (Til) The two of them held a blue jewel in their hands before placing it in their pockets. Clothing with deep pockets are an adventurers best friend. Therefore I suggested it to them as well. The more pockets there are, the more convenient it will be in the dungeon [Actually, it is more beneficial to place the stone around your waist.] (Youya) If there is an emphasis on how quickly a person can utilise an item, it would be better to attach the item to your waist belt. However, doing so with such an expensive item would require us to remove it when we are around other people as it would cause other people to become greedy, possibly exposing us to more danger. [Now then, lets go.] (Youya) [Uhn.But.. Im worried about Youyas weird get-up.] (Luna) [It feels like hes a full-fledged Magic Caster right?] (Til) [Well technically I am a knight who is capable of casting magic. But for now, I will be a Magic Caster who is able to use a sword.] (Youya) Right now, my equipment resembles more of a Magic Caster than it is a Magic Knight. I was carrying a sword with me, but it was hung on my back. In both my hands, I held a two-handed cane and wore a robe instead of armour. Right now, even if its a mere 11 level difference, I should be able to handle the skills from monsters in the area. However, the fact about this dungeon is that the monsters have an abnormally high attack power. Even if I raised my defense power with my best equipment, the battle would still be over if I took a direct hit. Therefore, I decided to raise my magical power instead by equipping this set of equipment instead. The robe I was wearing now has a special effect of raising my magic power while my staff improved my magic chants. [But the only magic Ive seen you use has an extremely short-range. Its dangerous to go close to any monsters he with such equipment. Especially without a sword, its too dangerous.] (Til) [The magic that Im using today will be much more magician-like. Its a new magic that I havent used yet, but its a magic that I can finally use today.] (Youya) The customized magic I have made by Magic Customization doesnt just consist of Napalm Strike. This time, Ill be using a customized version of Thunderstorm. [As we planned, Luna did you raise the level of Presence Detection to level 10?] (Youya) [Of course.] (Luna) [Well done.] (Youya) Presence Detection could go up to level 10 with skill points, however there arent any exceptional bonuses after level 5 and it was sufficient to stop at level 5. However, it was still a good skill to take to level 10. At level 5, you can detect the number and position of nearby enemies. However, at level 10 you will be able to clearly detect their figures as well as determine who had the monsters attention. [Til, your Luring will be the important factor in this hunt.] (Youya) [Hehe, leave it to me! My bow is absolute!] (Til) The plan in our dungeon is simple. Luna discovers the monsters with her Presence Detection, Till lures the monsters with her bow while I finish them off. If we pull this off successfully, we will be able to hunt safely in this dungeon. . . . As the name of the dungeon implies, the seafloor dungeon is a dungeon at the bottom of the sea. More precisely, it is a cave at the bottom of the ocean. The ceiling of the cave is transparent, allowing sunlight to enter from above the ocean. Thanks to this, there was good visibility in the dungeon. There were also wide roads in the cave, making it easier and safer to transverse. This was the main reason why this dungeon is popular among veteran adventurers. Yesterday, it was easy to move around by avoiding monsters with Presence Detection when we were hunting. [Wow, I cant see the end of this wide path.] (Til) [This is one of the reasons why we came to this dungeon.] (Youya) Even though the layout of the dungeon changes during the respawn every week, the fundamental concept of the dungeon doesnt change. That is why this long path can be expected inside this dungeon. Relying on Lunas Presence Detection to avoid monsters, we ventured deeper into the dungeon before encountering a giant hermit crab-type monster. Lunas fox ears started to shake. [The monster Youya mentioned is right there. Its soo big.] (Luna) [Alright, this time, Ill defeat him alone.] (Youya) The monster is a Hermit Crab, a giant hermit crab over 3 metres in size. It has extremely high defense, attacking power and a ridiculous rushing power. Although its rush isnt very fast, it has a long-range, high power and a decent speed for a rushing skill. Its rush frequently connects with the back line, causing the Magic Caster to be blown away while chanting. However it has a crucial weak point. It has practically no defense against magic. However, it is only susceptible to Wind(Lightning) spells as it has resistance against Fire and Water(Ice). It typically activates its rush when it detects a magical chant in its vicinity. Although its greatest weakness was a Magic Caster, it is a monster suited for defeating Magic Casters as well. Parties often have to avoid this monster as long as they didnt have a Magic Caster capable of defeating it, even when their levels were similar to the monster. Countless adventurers have fallen to this monster thanks to this, therefore they often clear the dungeon while avoiding this monster. [However, there are lots of enemies around the Hermit Crab. Fishmen, shellfish and even insects.] (Luna) [Because monsters naturally gather around him.] (Youya) Although it isnt understood why, there are many monsters surrounding the Hermit Crab. Such monsters were often declared as Mid-bosses as they were difficult to defeat with the monsters constantly respawning and surrounding them. However, we have Til in our party. [That is why Tils bow will become important. Luna, lets approach the monsters slowly. If any monster other than the hermit crab notices us, we will run away at full speed.] (Youya) [Uhn. Got it.] (Luna) We started to approach the group of monsters slowly. Luna has been reading the distance between us ever since we noticed the monsters. [Til, we are 200 metres away.] (Luna) The monsters were far away, at the end of the huge road. I could see it. [On my count, you shoot an arrow and make sure not to hit any of the surrounding monsters.] (Youya) [I know. Believe in my bow.] (Til) Now lets get started. There are several reasons why I chose to hunt the Hermit Crab in this dungeon. Firstly, among the available monsters at its level, the Hermit Crab gives more experience as compared to its other counterparts. This is probably due to the monsters difficulty. Second, if you possessed sufficient firepower in the Wind (Lightning) attribute, you could easily defeat the monster with a single spell. Normally, a magic caster would be unable to get over the fear of its rush as they rarely had spells that could be casted outside of its 30 metres detection range. However, I can use magic beyond 30 metres by utilizing magic that isnt ordinary. [Prepare for battle. Luna, Til, straighten yourselves. If we fail this, its certain death.] (Youya) The two of them nod with a serious face and I start my chant. I felt my magical power rising. Napalm Strike is a customized Firestorm which threw away every concept in exchange for power. However, the magic customized from Thunderstorm is different. I compress its area of effect into a straight line, resembling a bullet while increasing its cast time to improve its power. Right now, it takes about a minute for me to finish one chant. This spell wont be usable in a high-speed battle, but there isnt a problem. This spell is designed for long-range shots or accurate sniping. With Presence Detection, I can fire at enemies outside of their range while escaping if we were noticed, and the long cast time wont matter anymore. The area of effect and casting time is worsened to improve its range and power. With Magic Customization, the spell that produces a rain of thunder over multiple enemies has become a spell that shoots an enemy from afar with a rifle made of thunder boasting a range of 100 metres. It has been over 30 seconds since I began my chant. I gave the signal to Til and she shot the Hermit Crab from two hundred metres away. She easily landed her attacks on the crab. Originally, all monsters will attack anyone in its active range. Although it differs from monster to monster, the longest range is 100 metres while the shortest is about 5 metres. Unless the adventurers are within that range, the monsters would not notice them. However, whenever an attack lands on the monster, somehow the monster will automatically detect and move towards your location. These two rules can be abuse to lure monsters. [Youya. Til. The crab has hostility towards Til.] (Luna) Following Lunas report, the crab can be seen moving towards our position. That was what we were aiming for. We werent in the other monsters perceptive range and thus none of them has noticed our positions. However, the Hermit Crab runs towards our position, drawing aggression onto Til. This is Luring. Now, the Hermit Crab is isolated from its surroundings. In a few minutes, the monsters will be drawn to its current position, well have to defeat it by then. 20 seconds until my chant is complete. I point the tip of my staff directly towards the crab which is receiving waves and waves of arrows onto its body. Thanks to its high defensive power, the arrows werent having any effect. It was pushing through the rain of arrows, closing the distance with tremendous force. I felt cold sweat flowing down my back. Although my spell would be able to kill the crab in one hit, Magic Casters have their life endangered if the distance was reduced too quickly between them and the target. If my chant does not complete before it enters within 30 metres, it is over and my life will be forfeit. Thus, we have to defeat him from a distance in order to prevent endangering our lives. It felt like an eternity as I watched the crab close the distance between us. However, time flowed much faster than I thought. The remaining distance is 110 metres. My chant was completed and the timing was perfect. Magic power began to gather around the tip of the staff and electricity started to crackle. Intermediate Magic Customization Thunderstorm. [Superconductive Bullet.] (Youya) A bolt of lightning was released from the tip of the staff, moving at light speed. It is a long-range shot, made by sacrificing its area of effect and casting time to gain overwhelming distance and power, along with the characteristics of lightning that prevents you from dodging. This characteristic is the reason why Thunderstorm was the most-suited for a sniping-type spell. Fire and ice-type spells would not be as effective. Superconductive Bullet easily penetrates the Hermit Crab, scorching a large hole into its body. The crab was penetrated with so much speed and power that it didnt notice the fact that it is already dead, continuing to run towards us as it turns into blue particles. Unlike Napalm Strike, Superconductive Bullet had both its range and power strengthened, this meant that its power was lower than Napalm Strike which focuses on pure power. However, its power is still extraordinary. Whatever the level difference is between the Hermit Crab and us, the crab will not be able to take a hit from Superconductive Bullet as its a huge weak point. A large amount of experience points flow into our body and our level rises. Power flows throughout our body. [As expected of a level 25 monster, with this large of a level difference, our levels will rise multiple times each kill.] (Youya) [Amazing, we gained three levels. Were already level 14!] (Luna) [Didnt big sis tell me that it would be harder to level up once we hit level 11?] (Til) [It wasnt a lie. Its rather strange for us to gain three levels this quickly.] (Youya) It is a simple task to get to level 11 when starting out as an adventurer. However, after every 10 levels, the experience required to level increases exponentially. Usually, it takes about three days to achieve level 12. [Now, lets continue the hunt. Luna finds the crab. Til lures it and Ill defeat it.] (Youya) [Ill try my best! I want to become stronger!] (Luna) [Cant be helped. If Youya needs my help, Ill lend a hand.] (Til) I felt the appeal of their motivation rubbing onto me as I myself got more excited. [Lets go. Together we will become stronger.] (Youya) Thanks to the increase in levels, the maximum number of Superconducdtive Bullets I can shoot increases to 6. Ill leave one shot for emergencies, so lets hunt four Hermit Crabs before turning back. At this pace, we will reach level 20 in less than a month, definitely the fastest pace in all of history,. Volume 1 Chapter 18 [Uhm, hey Youya. This morning I was telling you about how its weird that you got level 11 in such a short time.. Right?] (Phil) [Uhhh.. Yeah.. You were definitely saying that..] (Youya) [So HOW are you already level 18? Whats more you have two people who are already graduating from being novice adventurers!!?] (Phil) Adventurers are only truly considered an adventurer once they reach level 20. Once you reach level 21, the beginner dungeons available in Rumberg will be out of limits as you arent considered a beginner anymore. The dungeons available in Rumberg were beginner dungeons for level 10 and below, beginner dungeons for level 20 and below and ordinary dungeons. Once you obtain level 21, you will have to survive on your own power and enter ordinary dungeons. Every 10 levels, the experience required to level up increases exponentially, causing most adventurers pace to slow down once they arrive at this point. [Well if you try really hard, its not that hard to reach up to level 20 in this short amount of time.] (Youya) [There is still a limit to everything!. Its supposed to take two weeks to reach level 10, one year and a half for level 20! I have never heard or seen of anybody reaching level 18 in a week! If people knew about this, they would just call it a fairy tale!] (Phil) [Well I think so too.] (Youya) I do think that I have overdone on the hunt for the Hermit Crab. If someone were to tell me that they killed a Hermit Crab at level 11, I would never believe it. [Even if you told me that there was a plan. I wasnt told that the plan included confronting the grim reaper of the seafloor dungeon! Who was the one that told me to avoid that monster at all cost and abandon all thought of defeating it!?] (Phil) Originally, the Hermit Crab is a monster that should be avoided at all cost. The only way to defeat it is to abuse its weakness to the Wind (Lightning) element with a magic spell. However, a Magic Caster capable enough of defeating the crab is as threatening to the crab as the crab is to the Magic Caster. When the crab detects a magical reaction, it will immediately activate its rushing technique to take down the Magic Caster capable of defeating it. And because of the monsters in the surroundings, the front-line will have difficulty acting as the shield for the rear guard. [I challenged the Hermit Crab because I was confident of defeating it safely.] (Youya) [Sigh. I wont bother asking anymore. Changing the topic, do you know about the festival taking place in Rumberg four days from now?] (Phil) [Of course I do.] (Youya) In Rumberg, there is a big and flashy festival that occurs once every year.There are also tournaments held where adventurers can participate, while tourists rush to obtain tickets to witness these tournaments. [There is a tournament meant for new adventurers to participate. It consists of a one on one combat with a weapon made of wood. The level limit is 20. Skills are prohibited and one good blow or exiting the ring will end the match. Its also a safe tournament as the medical team will be on standby outside the ring.] (Phil) [So what does that got to do with me?] (Youya) [I thought about sending you a recommendation for participation as the deadline for applications is today.] (Phil) [Lets stop right there.] (Youya) It is unfair for me to participate in this kind of tournaments meant for beginners. By definition, I am not a rookie adventurer plus I received a reset bonus along with my fixed status increase. In the first place, old men like me shouldnt steal the limelight from the young and upcoming adventurers. [I thought so.. However, the victor will not just receive money, but also a rare item you know. Its a rare item that you could never see again you know.] (Phil) I took a look at the documents taken out by Phil and gasped at its contents. This is..! I didnt think that it actually existed. I definitely want that item. However, I still feel that I should not participate in the tournament. [Youya youre late. Im hungry! Hurry lets go to the bar!] (Luna) It seems that quite a fair bit of time passed since we returned to the guild that Luna became impatient. Hmm? Wait a minute. I just thought of a good idea. [Luna, how do you feel about testing your swordsmanship?] (Youya) [Hmm? My swordsmanship?] (Luna) Luna tilted her head. [There is a tournament coming up where adventurers level 20 and below compete to see who is the strongest.] (Youya) [Sounds interesting.] (Luna) Lunas eyes started to glow. [Wait a moment, Youya. Shes just a little child.] (Phil) [You should know from experience not to judge a persons strength on their appearance.] (Youya) The difference between Lunas status and her actual physical appearance was extremely large. [Youya! Luna will attend the tournament!.] (Luna) [My thoughts precisely. Luna is much more suited to the tournament than I am.] (Youya) Luna has shown countless times that her speed has surpassed what her status implies. She doesnt feel fear from battling against monsters as well. However, when it came to battles with humans, her experience is far from sufficient. This tournament could be a good experience for Luna. And when she does win it, shell ask for something else in exchange for the tournament reward because she wouldnt have any interest in it. [Okay! Luna wants to join the tournament!. Youya! Train me more!.] (Luna) [Of course. Well make Luna stronger by the day of the tournament! At the end of the day, I guess I wont be able to teach you something other than the thrust.] (Youya) Our course of action will be to spend tomorrow and the day after to reach level 20, and spend the rest of the days teaching Luna the basic hand-to-hand combat and self-defense techniques and have her master them. I might as well have Til join in on the training as well, she should learn to be able to protect herself for worst case scenarios. I wont be able to raise our levels beyond level 20 untill the end of the tournament. This is actually a good way for us to slow down our progress. Its a good chance for us to train and practice other strengths as they could be insufficient if we raise our level too quickly. [Alright, then I will file an application for Luna to enter the tournament. Also, what about this?] (Phil) [There is an event where adventurers will be battling monsters in the stadium. It also has a level limit of 20 for all entries.] (Phil) [Ill like to appeal that this event is safe for newcomers to enter.. But, this time the monster in question is a little dangerous.] (Phil) Fights against monsters in the city is a common spectacle for an adventurer city as audiences enjoy watching monsters and adventurers fight for their lives. [Killer Ape. That isnt a monster for beginners to fight.] (Youya) [I objected against it, however the guild chief approved of the monster without consulting anyone. Lucky for us, the event wont be a true one on one battle but rather a three versus one.] (Youya) A gigantic ape monster, Killer Ape. It has power, speed and hair on its body that acts as armour against any slashing weapons. Its one of the monsters that possess high attack power, defensive power and speed. Furthermore, ape-type monsters have the ability to use martial art skills and techniques. Based on its level, it is only level 25. However, if you are pitting three level 20 adventurers against it, then those adventurers might as well be stronger than their level implies. It isnt a monster that ordinary adventurers can beat. In fact, even with a medical team nearby, there is a high risk of the adventurers dying to the monster in the battle. [I understand. Ill join that event. I wont take no for an answer. There is something fishy about that event.] (Youya) [Thank you, Youya! Actually the other two adventurers have already been decided! When it comes to their skills.. Well its just standard, along with the arrogance that comes with it. I was worried that there would be no one to wipe their asses should shit hit the fan.] (Phil) [Arent you even worried about me?] (Youya) [Youya will definitely win.You may have avoided showing me your status up till now, but you mentioned that your status is doing much better than before. Youya with a strong status is undefeatable.] (Phil) Phil talks so confidently about my victory as if it was fact. It makes me embarrassed. [Whatever the case is, I will participate in that battle.] (Youya) [Alright. My work today has officially ended. If its alright, can I join you for a meal? Ill like to advise Luna and Til about various things as well.] (Phil) [Of course you can. Ive also wanted to have a meal with you..] (Youya) Phils face started turning red. [But remember to control yourself when it comes to alcohol. You might as well be considered a drunkard at this stage.] (Youya) [After all, Youya is a meanie.] (Phil) With this, Lunas participation in the tournament is confirmed as well as my challenge against the Killer Ape. Im looking forward to watching how Luna performs in the tournament. Since she doesnt have much experience battling other adventurers, I am unsure if she is capable of defeating a dedicated swordsmen who has undergone proper training. Still, there is something about Luna that makes me wonder. Im waiting at the guild hall as Phil went to change into her personal clothes. Then, a familiar face appeared. [Youya-san! I saw someone having a conversation with Phil-san and I knew it just had to be you! I have a favor to ask of you.] (Boy) So far the only person in the trio with a name is Kevin. I am unsure of who is talking here so Ill leave it as Boy It was one of the boys that got involved in an incident with us whom we saved from the Rock Golem. Luna stood behind me warily as she stared at the boy. [What is it?] (Youya) Im not such a nice guy that I will accept the request without knowing what it is, but Im not so evil to decline without listen to the details. [Truth is.. Ive talked with my older brother about the challenge against the Killer Ape and advised against it. The two of us have been training together ever since we were young and we were both confident of our skills. We also received strong equipment from our parents when we started adventuring. However, because of Youya-san, Ive come to understand that we are in over our heads by attempting battles that were out of our league. Thats why, I hope that Youya-san will look after my brother in the challenge as I am afraid that he would make the same mistake as I did.] (Boy) I let out a wry smile at the boys request. Following what Phil mentioned earlier, I am guessing that this boys brother probably started adventuring over a year ago as he managed to achieve somewhat close to level 20. I bet this is the overconfident adventurer that she had mentioned was in the challenge as well. [Alright. Lets pretend this conversation never happened and you blurted out his participation thanks to alcohol. Irregardless, since I am participating in the challenge as a party member, I would never intentionally leave my party members out to dry.] (Youya) [Thank you very much! I am also thank you on my brothers behalf!] (Boy) The boy lowered his head at a 90 degree angle. It seems like both my challenge and Lunas tournament has their stakes risen by quite abit. However, the limitation on the battle is somewhat suffocating. I have the duty of looking out for his brother and I wont have the leeway to utilize Magic Customization as freely as I would like. If possible, I would like to avoid using it in a situation where it will become a spectacle. Well Im sure itll turn out alright somehow. After all, I am also strong with just a sword. [Youya.Til.Luna. Thank you for waiting. Shall we leave now?] (Phil) When Phil showed up, the boys face turned red as they turned away. Well Phil is the idol of the guild after all. Its likely that this boy is one of Phils diehard fans. [Im heading over to a bar at the moment, would you and your friends like to join us?] (Youya) [Uh.Of couC. I mean. Uh. Its okay.Its a pleasure especially since Phil. but .. uh. Im sorry!!] (boy) The boy ran away, despite coming over so cheerfully with a favor. [Youya, what is wrong with those children?] (Phil) [I dont really understand either.] (Youya) Phil is scratching her head at our current situation. It looks like she hasnt noticed it herself. Ignorance may be bliss but insensitivity is a sin. Anyway, its time for us to return to the bar at the inn. There are plenty of things to prepare for tomorrows hunt. Volume 1 Chapter 19 Currently we are inside the beginner dungeon for adventurers level 20 and below. Our goal today isnt to raise our levels but to train. Although we are at level 20, it is important not to neglect the strength that a person can obtain from training. I was capable of demonstrating power equivalent to an average adventurer despite my lower status when I was at my peak. [mmmmmm. I wanted to participate too. The tournament. Hmph] (Til) Til was complaining with an envious face. [Dont say that. You have a class suited for long-range battles. If you were to enter a ring 20 metres wide you wouldnt allow be able to utilize your strengths to the fullest.] (Youya) [But Ive been getting better at other weapons too such as knives and other stuff.] (Til) At the moment, Til was juggling three knives which she usually kept hidden on her body. She caught the knives between her fingers and threw them towards a tree, sticking them into the same tree. Although Spirit Archers didnt typically use knives for battles, Til was already a master at handling knives. [Ill admit that Til is very skilled as a fighter. And Ive always thought it was strange that you do not seem like an amateur at all. Its as if you have learnt martial arts before.] (Youya) Phil was skilled with a bow from the start, however aside from that she was average. For me, I have been scavenging and hunting in the mountains since I was young and my physical strength is higher than an average person, however it wasnt anything exceptional. However, in Tils case there is evidence to believe that she has been doing properly training. That wouldnt be the case if one led a normal life. [Because the art of a bow comes naturally to all elves, everyone had learnt how to use one. In addition, I have always been dreaming about being an adventurer, so I trained under the wing of the villages number one warrior. However, one day he said that he had to leave the village, and apologised to me as he had only trained me for a short time. As a result, I only have the fundamentals of the fundamentals drilled into me.] (Til) [So thats it.] (Youya) Ive met that number one warrior from her village. We fought together once as brothers in arms. If its him, then Im convinced. Just having the fundamentals seperates the novice from an amateur. [But even if you learn how to handle a knife or have good stamina. That is different from having a job that synergize with knives. You dont have the status correction that comes from having an actual job and a class benefit. A Spirit Archer that eats a blow from a wooden blade in close quarter combat is still dangerous. I cant approve of it. If someday there is a tournament that suits Til, Ill be sure to let you attend.] (Youya) I put a piece of Panam fruit into my mouth. Although Til has many complaints about the situation, she is still taking her training seriously. If she continues to work hard at her current pace, she will be able to defend herself even without needing Luna to protect her. Now then, I wonder how Luna is doing. [Luna. Looks like your yokonagi is able to land critical hits as well now.] (Youya) [Uhn. This is the second one!] (Luna) Among the nine types of slashes, Lunas second choice is Yokonagi. It is a good choice considering Lunas small stature. Yokonagi is a downward slash with a small movement and there arent many situations where this could be used. However, one effective use of the Yokonagi slash is to utilise it after the stab where its short range and range of motion can be beneficial. More than anything, it is an easier for Luna to land critical hits than a stab as it was a slashing movement. [Now then. Lets move on to sparring practice. Ill be using a wooden sword while you will use a dagger. For the next thirty minutes, Ill only be defending myself and I wont counter or attempt an attack. If you land a single hit on me within the time limit, you will win the match.] (Youya) [The rules are too lenient towards Luna! At least counter Lunas attacks.] (Luna) [Youll understand once we start the match. Lets see.. If you win the match, Ill grant you one request. ] (Youya) [!! Really!?] (Luna) [Only if its within my power of course.But yeah. Any request.] (Youya) [Alright! Luna will try her best and win!] (Luna) Luna became motivated instantly and her fluffy fox tail swung back and forth. Im suddenly afraid of what she will request of me. But I guess its much more fun this way now that the stakes are higher. . . Thirty minutes have passed. Lunas body gave way and she fell onto the ground, losing her grip on her dagger. She had attacked me for the entire thirty minutes without letting up so it isnt unexpected. [Was the match too easy? Should I revise the rules again?] (Youya) [Youya is strong! Even though Luna is faster.] (Luna) Based on our basic status, my stats are slightly higher than Lunas. However, with the class stat corrections, Lunas speed got a huge boost and her overall status is better. However, she wont be able to beat me using just pure speed. I have spent decades battling monsters and people who were far stronger and faster than I was. Shell need more than just speed to beat me. If anything, she needs to come up with a strategy in order to land a hit. [If you want to defeat me, you must be sure to watch my movements. Watch how I receive your blows and pace myself in battle. How I breath. My footwork. And think about how you can interrupt it. These are the skills that Luna doesnt have. Once you start noticing these things, you will begin to become more familiar with my battle style and eventually, you will be able to push through. Well do this spar session everyday at the inn for thirty minutes.] (Youya) [Youya. If it isnt today, will Luna still get a reward for winning?] (Luna) [Of course. There wont be any tension if there isnt a prize to be won. However, I will place a deadline. The deadline is one month. If you dont win within the month, the prize wil be forfeit.] (Youya) Without the strength to stand up, Lunas eyes started shining while she was laying on the ground. She opened my mouth and drank a stamina potion before proceeding to her own training. Somehow she feels more motivated than before. [By the way, what do you plan on asking for if you do win?] (Youya) Luna paused for a moment before puffing up her cheeks and turning away. Glancing at her neck, it looks like shes red down to her neck. [its a secret.] (Luna) That was a boring answer. But Im sure Luna wouldnt ask for anything unreasonable. If she is able to land a single blow on me in this next month, I plan to fulfill her request to the best of my ability. . . . The main reason we came to the dungeon isnt to train, but to go on a treasure hunt. Dungeons arent just filled with monsters for adventurers to hunt. The monsters are mostly cleared out on the day they spawn so adventurers often spend the other days treasure hunting. We may not be able to raise our levels due to the tournament rules, but if its just a treasure hunt then we will be fine. We could also avoid raising our level by utilising Lunas Presence Detection. [Youya, I smell treasure over there.] (Luna) Lunas nose began to twitch as she sniffs the air. This cute movement fits really well with Lunas appearance and her age. The reason why Luna said that she could smell treasure is due to the her new skill, Treasure Sense. As the name implies, it allows Luna to sense any treasure chests in our vicinity similar to Presence Detection. There are many chests in dungeons that are placed in conspicuous areas, however as a veteran adventurer I am certain that there are many chests that are hidden within the dungeon walls itself. Chests that can be easily found are certain to be looted by other adventurers. Thus we are hunting for the chests that are hidden instead. By using Treasure Sense, rather than persistently searching throughout the dungeon Luna will be able to sense their locations if we get close enough. [Weird. The treasure chest is directly ahead of us, but its a dead-end?] (Luna) As Luna said, we have arrived at a dead-end. It isnt possible to return and take a different path as the previous turn is quite a distance away. [In that case, there should be a hidden room behind the wall. Try to tap the wall and listen to the sound.] (Youya) I knocked the wall with my knuckles and a loud noise reverberated throughout the wall. Bingo. It seems that there was indeed a hidden room. There are several ways we could go about opening this room, but based on the sound the wall is quite thin as compared to the surroundings. For a thin wall, there is a simple way for us to pass through. [Luna. Til. Be prepared to dodge the debris.] (Youya0 [Uhn.] (Luna) [Roger that.] (Til) The two of them lowered their bodies towards the ground as I grabbed my sword. One of the most commonly used skill for swords, Bash. It can be activated easily with an efficient mana cost for its attack multiplier. The wall collapses as my sword collides with it. Although it is simple to destroy walls with this method, this is only possible as the wall is abnormally thin. If this is performed against a normal wall, there is a high chance that the sword will be damaged rather than destroying the wall. [Woah, the wall actually broke.] (Til) [Ah! The treasure really is behind the wall!] (Luna) Luna and Til walked past the collapsed wall and entered the hidden room. [Luna, did you put points into Lockpick?] (Youya) Original name was V which translates to Release, but changed to Lockpick [As you told me to, I put three points.] (Luna) [Good. That will be enough for now.] (Youya) We cant lower our guard just because we found the chest. There are traps that have a 50% chance of activating when opening a chest. There have been instances where a poisonous gas is released or paralysing needles are shot out from the chest so on and so forth. With Lockpick, not only is the chest easier to open, but the traps can also be deactivated depending on the persons status. With Lunas current status, level 3 is sufficient to deactivate the chest. [Youya its opened.] (Luna) [Nice. Its a Magic Bag (Small). It can only hold up to 10 kilograms of items but its worth at least two million gils on the marketplace.] (Youya) [If its two million, we could play around the town for three months.] (Til) [Amazing! Today is a good day!] (Luna) Luna and Til are grabbing each others hands in celebration of our loot. However. [We wont be selling this bag. Til will be using it instead.] (Youya) [You sure? Giving me this kind of item.] (Til) [Definitely. I was actually hoping of finding another bag for you. Wouldnt it be difficult to carry a bow around in the town? If you had a magic bag you could place your bow inside rather than carry it around.] (Youya) Bows are useful but they are quite troublesome to carry about.Their arrows are quite bulky as well. That is why Spirit Archers often carry around a magic bag. I was planning to pass her a bag from the start but I already passed my spare bag to Luna. When I asked Luna to pass her bag to Til, she looked so devastated that I couldnt bear to take her bag away from her so I held back on the thought. [Thank you so much! Ill treasure this.] (Til) [Please do so. We definitely have the goddesss blessings as we are very lucky to find such a rare item on our first chest. ] (Youya) Til hugs the magic bag tightly in her arms. Im sure she will take good care of it. [Now then. Its about time to head back. Weve obtained a good souvenir for today.] (Youya) [Lets go! Lets do special training when we return! I will definitely land a hit on Youya by the end of the month!] (Luna) Luna is extremely motivated for our challenge. I will do everything in my power to stop that. After all, I wont have the qualifications to be a teacher if I lose to my own student in just a few days. [Me too! Ill make big sis proud of me! I heard from her that having a magic bag is proof of being a top-tier adventurer!] (Til) [Yeah. Thats right.] (Youya) Very few adventurers actually carry around a magic bag. Even if a party do find a magic bag, they will often sell it and split the profits between the members. As usual, the party is progressing smoothly. Lets continue treasure hunting while training the two everyday until the day of the festival since it will be a good experience for the two of them. Volume 1 Chapter 20 Im impressed by Lunas resilience. Although I caught a glimpse of her talent back when she learnt the thrust in one night, her growth this past month has been even more abnormal to say the least. This girls battle sense and learning capacity is far too large. Not only does she have excellent parameters, she has a pair of eyes that sees much more than an average person, capable of seeing and absorbing my battle movements into her own. [Hou.] (Luna) She took a deep breath and applied more force into her legs. My movements isnt something a person can easily imitate and assimilate into their own. I cant help but wonder how much can this girl grow in the future. She is a jewel that far exceeds even Leonard in talent. In an instant, Luna closed the distance between us with a large acceleration. Looking at her speed, I assume that she is performing her signature thrust. Unless you are familiar with Lunas battle style, you will definitely be thrown off by her high-speed rush and her ability to transition into a thrust at that speed. Having experienced that thrust for the past month, I had made it a point to parry Lunas thrust the moment I notice her preliminary movement. I wouldnt be able to parry it in time if I wait for her rush. She has been repeating this for the past 27 minutes, unable to pass through my defense. However, this time she pulled her blade back rather than thrusting it forward, catching me off guard as I didnt have the time to pull my wooden sword back. I have not seen her done this even once for the past month, could this be her talent at work or is this her plan from the start? Luna stared firmly at my right shoulder, throwing out a thrust in the moment when I am moving my sword to parry her initial rush. Can I still intercept with my sword? There isnt enough time. My sword wont make it in time. I twist my body, letting Luna slip through the side of my body. In the next moment, Luna lands with another powerful step and pushes forcefully off the ground, twisting her body sideways. These series of movements are far too advanced for her to be adapting in the heat of the moment. She must have been training secretly in order to defeat me today. My sword is in a bad position while my balance has been broken. However its a shame. Using my left hand, I striked the side of Lunas dagger with my palm, adjusting its trajectory downwards from above. By striking the side of the sword, it is possible to defend yourself with just your bare hands, although it is near impossible to catch a blade with two fingers. While regaining my balance and my form, I rotate my body and move behind Luna. [Times up. Its a shame but I am the winner again this time.] (Youya) [Youya said that even if Luna landed an attack then Luna is the winner. But hitting the side of my blade is cheating!] (Luna) [That is a valid defensive move even in an actual battle. It was regrettable that you werent fast enough even with your high-speed combo attacks. If I had defended the way I usually did, you would had definitely succeeded, and I wouldnt had made it in time.] (Youya) [Cheater Youya! Youya is an adult! No excuses allowed. Luna properly hit Youya.] (Luna) Unhappy with the outcome, Luna puffed up her face and complained about the results. Although, rather than intimidating, her action looks much cuter as the fur on her tail is standing while her face looked like a pufferfish. I dont mind conceding the win so long as I wasnt defeated by Luna this quickly. She still has much room to grow. I will definitely reflect upon this battle later. Her footwork, her pacing and her breathing has improved drastically, even releasing a combinations of movements to perform a feint along with a lethal thrust at the end. There is much to improve on but for now this is sufficient. She should be ready for the tournament tomorrow. [Alright. You win the challenge, but its hard to say that you won the match. Ill give you the reward but these matches will continue even after the tournament.] (Youya) [Yay! Luna wanted to continue with Youya too! Luna still has many skills to steal from Youya!] (Luna) [Starting in the next match, I will begin to counterattack to raise the difficulty a little bit. If you focus on attacking without worrying about defending, I will not hold back on my attacks.] (Youya) [Ill do my best!] (Luna) Luna is burning up. She will become a good swordsman in the future and surpass me for sure. Ill be sure to drill everything I know into this girl. In order to let her soar through her future from now on. [If you return to the inn, remember to arrange a meal with the bar for you and Til.] (Youya) [Youya what about you?] (Luna) [I made a promise to meet someone today.] (Youya) It was sudden but Phil asked me to meet her today. If Phil is going out of her way to talk to me outside of the guild, it should be something serious. Ill be sure to listen to what she says carefully. . . . After the training session with Luna, I met up with Phil at her place. Her house is as well-maintained as ever. Even her equipment back when she was an adventurer looks brand new with a bunch of decorations. It is clear that she cherished her time as an adventurer. [Youyas favourite food is still spicy fried noodles isnt it?] (Phil) [Yeah. Preferably with extra meat please.] (Youya) [Your tastes doesnt change even with time huh. Im relieved. Its a good thing that the ingredients I bought beforehand wont be wasted. You can look forward to my special dishes.] (Phil) [An old mans preference wouldnt change even after a long time.] (Youya) The kitchen in Phils home is large and has all the essential equipment a person would need. Phil changed her clothes and grabbed a frying pan in the kitchen. Noodles covered in a red and spicy sauce began dancing in the air as she began to prepare the dishes. Her cooking skills is still as amazing as ever. While we were traveling together, if there was an interesting dish that caught her eye, she could easily learn the dish and improve it to her liking, adding another dish to her already large repertoire. [Sorry to keep you waiting. Heres Phils specialty, Spicy pasta with meatballs.] (Phil) [Looks delicious.] (Youya) [Of course its delicious! Do you remember the pasta in the bar back in Kaltara? Back then I asked the chef if he could tell me the recipe and altered it to suit Youyas taste.] (Phil) [That is nostalgic. That bar had one of the best food I have ever eaten.] (Youya) The pasta tastes delicious. She must have seasoned the meat with some miso and cooked it with the tomato sauce and the noodles. Although the noodles was delicious when mixed with the sauce, I like it more when there are plenty of meatballs along with the noodles. The flavor of the meatball spreads throughout my mouth [Heres some ale. Its Youya favourite drink isnt it?] (Phil) [Oh. Yeah, ale tests the best after all.] (Phil) [Ive always wondered why do you only drink ale although you can afford spending more on alcohol. Now it makes sense.] (Phil) Phil is currently drinking a honey-flavored sake. [Arent you the same as me. You have always favoured honey sake over wine unlike others. At the end of the day, its better to follow what you like rather than worry about what other people think.] (Youya) [Its all about our own perspective, thats what Ive learnt from you after all this time.] (Phil) Phil elegantly brought the pasta to her mouth. Phil mentioned that she made the pasta specially for my liking, and I cant say that it isnt true. It is incredibly delicious. Its been a long time since Ive ate something so delicious. It even goes well with ale. I hope next time Luna and Til could join us for the next meal. Our conversation continued throughout lunch as the spicy hot pasta slowly entered into our stomachs. I became increasingly embarrassed as I watched Phils bright smile throughout the meal. Being embarrassed, I opened my mouth. [So what was the reason for inviting me over to lunch?] (Youya) [Theres something I need to tell you that I dont want other people to hear. My room is quite expensive as I made it soundproof.] (Phil) Her place was indeed a nice place. If it was made to be soundproof, it must be quite a hefty sum to obtain this place. It couldnt be compared to the inn that Iare staying at. Seems like being a receptionist is much more profitable than I thought. Now that I think about it, there is also the bonus that a receptionist can earn from the reservations placed. Phil who is always fully booked must have earned a huge sum just from that alone. [Please tell me more about it.] (Youya) [There is something suspicious about the upcoming festival. The vendors who were supplying monsters for the events were changed without any explanations with the guildmasters approval. And although I have been voicing out against these actions, the guild has been aggressively holding me back from assisting in managing the festival. Its as if they are hiding something and they do not want me to be there.] (Phil) [Arent you just thinking too much about this?] (Youya) [I think so too. But I still have a bad feeling about this. Something really bad is going to happen. Thats why I wanted to tell you about this. There might be something going on behind the scenes, and I hope you will be careful during the event.] (Phil) Looking into her jade coloured eyes, she seems to be much more vigilant than before. [I understand. If there is trouble during the event, I will lend my strength. However much I can do as a level 20 adventurer.] (Youya) [Its because that strong Youya has become level 20 that I am asking for your help.] (Phil) [Youre thinking too highly of me.] (Youya) [Naturally. Because its the person that I look up to.] (Phil) Having a relaxing meal like this with Phil isnt bad once in a while. [Also, theres another reason why I called you here today.] (Phil) [What is it? It seems more important than the matter about the event.] (Youya) [I was hoping that you would be willing to make a move this time.] (Phil) [Are you drunk again?] (Youya) [Truth is I havent been drinking honey sake, but honey lemon water instead. Im not desperate enough to lay a hand on a drunken woman, nor am I hungry for a woman I wont let you use this excuse a second time.] (Phil) [Fuh.] (Youya) I was instantly cornered. [There were several things that I wanted to tell you before the festival including what I told you that day. Everything that I said that day was the truth and I wanted to tell you that before you leave the town.] (Phil) [You knew?] (Youya) [Of course I did. How many years do you think Ive been a receptionist?] (Phil) Rumberg only has dungeons up to the intermediate level, thats why its the town of beginnings. The limit for entering the dungeons here is level 25. If a person plans to go beyond level 25, they would have to leave the town for a city with stronger dungeons. [Youya. If I asked you to bring me along with you and leave this town, would you do it?] (Phil) [If you thought thatit would make you happier than being a receptionist here, I would.] (Youya) [Thats such a bad answer. If you wanted me to follow you then you should just tell me to. Maa, I guess that is a Youya-like answer. ](Phil) The two of us started smiling. However, that doesnt mean Ill give up on this. I just want Phil to be happy, regardless of the outcome. Whether she remains as a receptionist or my student. Whatever path she chooses, I will do my best to support her. [Itll be much harder for us to raise our levels now that we are approaching level 21, so itll take awhile before we leave the town. I hope you will support me from now on as a receptionist.] (Youya) [Ill be glad to. Im glad to help Youya in any way I can.] (Phil) Just like this, the day quickly changed to night. We continued to talk about what happened after we separated. Phil told me stories about her vacation while I told her about my life as an exclusive adventurer. [Its getting dark soon. Its about time I head back to the inn.] (Youya) [In the end, you arent going to do it. Sigh even after resisting my beloved honey sake.] (Phil) [Phil, if you say that I may end up doing it for real you know.] (Youya) [Dont worry about it, I have always been serious. The people under my care are adventurers, it doesnt matter if Im not there for one day. Or is it that Im just not that attractive to you?] (Phil) I swallowed my saliva. I walked towards Phil and pushed her down. [You sure about this?] (Youya) [Yes. Ive been sure about this forever. Even if Youya chooses to leave me, I will still look forward to meeting you once again in the future.] (Phil) [I have always thought of you as a daughter in the past.] (Youya) I have always thought that she was like a daughter to me. Whenever I think back, I could feel the past pulling the brakes, stopping me from moving forward. However, Phil has become beautiful when I wasnt around. She has become a wonderful woman. [Sorry for being an incompetent teacher. But I do not regret it in the slightest.] (Youya) Phil eyes started to tear as I wiped her tears away. Her breathing became heavier and her gaze became more passionate. . . . In the end, I stayed over at Phils place until the next morning. Luna was sniffing everywhere wondering why she could smell Phil in the inn while Til caught on quick and started to tease me about it. Now then, the long-awaited festival is about to begin. Its Lunas long awaited day to shine. Heres to hoping that Phils concerns were just her imagination. Volume 1 Chapter 21 [Uwahh, so many people!] (Luna) [Ughh. Im starting to feel a little claustrophobic.] (Til) Right now, we are walking around exploring the city during the festival. Lunas fox ears and Tils elf ears are currently twitching as we are walking around. Lunas tournament will begin in the afternoon and my challenge against the Killer Ape occurs right after. Although we woke up early today for our sparring session, Luna will have to fight in six battles if she is going to win the tournament. It is important for her to take a break until the tournament starts. This festival occurs only once a year, we should try our best to enjoy today as much as we can. [Youya, over there! That looks delicious.] (Luna) I grabbed the overly excited fox tail with my hand to prevent Luna from running off. The stall Luna mentioned is a stall selling roasted lamb meat.. The stall owner is kneading a variety of spices onto a large lump of lamb meat before stabbing it with a skewer and roasting it over a fire. Whenever he receives an order, he would scrape the cooked meat on the surface of the lump and place it on a piece of bread along with some onions and sauce. It is extremely similar to a dish called Doner Kebab back in my previous life. The intense smell released from the mixture of spices mixed with the juice from the meat stimulates the appetite. [Smells good. There is a lot of meat juice.] (Luna) Being a young and growing fox girl, Luna is in love with meat. [How much should we buy Actually. Til. Luna. Lets have lunch. Ill go buy some drinks and head over there while the two of you buy the food. The two of you go ahead and buy some food for us to eat. Lets see.. Each of you can buy up to three things that you like. Since its a festival, it should be more interesting for us to each different things little by little right?] (Youya) [Three things! Ill try my best to look for something delicious!] (Luna) [I have a good eye! Luna. Lets have a match! Lets see who can find the most delicious food in the festival.] (Til) [I wont lose.] (Luna) I hand over a large sum of money to each of them. Luna ran to the right while Til ran towards the left. Todays goal is to enjoy the festival above anything else. I had intended to take Lunas mind off of the tournament to relieve her tension but it seems like it was unnecessary. Im a little uneasy though. I hope the two of them dont get lost being engrossed in their challenge. . . . Typically, food stalls prepare an eating area with tables and eating utensils. I am currently at one of those tables. [Luna has brought food that is delicious! Luna wont lose to Til!] (Luna) [I dont have any intention of losing either!] (Til) Luna and Til both place their items onto the table. Luna brought a Doner Kebab, roast chicken with plenty of yoghurt sauce and chilli sauce and a gigantic pork rib seasoned with herbs. All of them are meat dishes as expected but the volume of food she obtained is surprising. Im glad that I let her choose her own dishes. It is amazing that she even managed to get this much food from a food stand. [As expected, Lunas choice of food is only meat.] (Til) [Meat is the most delicious food in the world! My instinct says so] (Luna) Lunas tail straightened to the limit. It seems that Luna made the choice to follow her instincts for this battle. [Fufufu. You are still a child.I wont lose! Jya jyan~] (Til) Tils items are completely different as compared to Luna. Her items are toast with cheese, soup with tomato base, plenty of vegetables with motsu and various sliced fruits such as frozen mango. [When eating a meal, it is standard to have soup and dessert right after.] (Til) [If it was only Luna choosing our dishes, we will only have meat for lunch. I do love meat but it would be difficult if it was just meat.] (Youya) [Luna is fine with just meat!] (Luna) [Only you are fine with that.] (Youya) Were saved. Although the kebab is fine, itll be hard for us to finish the roast chicken and spare ribs without any bread or soup. It is possible for me if I had some alcohol with us, but me and Luna still have our events later this afternoon. So I went ahead and got us some grape juice instead. Also, Im looking forward to the desert afterwards. Frozen fruits taste great and are delicious as dessert after a heavy meal. [Youya. Luna or Til. Who is the winner?] (Luna) [The one that decides the winner is Youya isnt it.] (Til) Both of them leaned forward towards me and stared at my face. It feels like a terrifying show curtain. [I cant make a decision without trying the food first. How about lets have lunch first?] (Youya) [Uhn. I understand.] (Luna) [Luna, You remember the promise right?] (Til) [I do. Well let Youya decide if we should buy it.] (Luna) The two of them seem to be betting on something that Im not aware about. Without noticing it, the two of them have become this close. I cut and distributed the small dishes that I bought while waiting for the two of them. Now then, shall we begin our lunch? As I thought that, a familiar face entered the eating area. Phil is talking to a handsome man who looks like hes in his late twenties. Phil smiled towards the man as she said something to him. My interest is piqued as I am very curious about what she is talking about with him. However, I am unable to pick out most of the conversation at this distance. Luna began to listen in to their conversation as her ears started twitching. [Luna are you able to hear what Phil is saying?] (Youya) [Possible. Lunas ears are good.] (Luna) As expected of a fox. Her large and cute ears are quite sharp as compared to human ears. [Can you tell me what they are talking about?] (Youya) [Uhm.. The guy is currently confessing and proposing. He will ensure she has no difficulty for the rest of her life and his parents are nobles or something.] (Luna) Phil is popular in the guild after all. It seems like the guild idol isnt on a date although I am worried about her smile. Could it be that she accepted his proposal? [Youya is making a scary face.] (Luna) [Dont worry about it. So what did Phil say?] (Youya) [I am unable to believe the fact that you love me. I cant even consider that possibility. If in another ten years you are still able to say that you love me, then at that time I will consider your proposal.] (Luna) I couldnt help but laugh at her reply. She is definitely referring to herself and me with that last statement. Ten years have passed since I last saw Phil. And even after ten years her feelings hasnt changed. The young man was shocked that he was rejected and walked away with a bitter face. [Youyas expression has been terrifying for a while now but now it is happy.] (Luna) [I agree. Youya is weird. Hey, is it fine if I asked big sis to come over and eat with us?] (Til) [Thats a good idea.] (Youya) Til stood up and began waving her hands. [Big sis, over here, over here.] (Til) Phil noticed Til and began walking over. [Youya, Luna-chan, Til. Looks like you guys are enjoying the festival.] (Phil) [Yeah. Its a rare opportunity for us to try out different foods from all around the world. Now we are eating various foods that Luna and Til chose. Do you wanna eat with us?] (Youya) [Sounds wonderful. I would like to.] (Phil) On the surface our behavior seems normal, however it feels more awkward than usual. Phil turns her head away whenever we exchange looks and her face turns red for a while. Luna hasnt notice yet while Til is grinning at the side. [Big sis, you were walking weirdly when you came over, did you hurt yourself somewhere?] (Til) Phil started to blush as she looks down. I really want to reprimand Til for acting like a perverted uncle. [Its nothing, dont worry about it. Rather than that, lets eat. Look. Luna has been holding herself back and drooling while we are talking.] (Phil) Everyones attention shifted to Luna. As Phil said, Lunas face became a mess from all her drool. Any more drool would ruin her cute face. [Then, shall we eat?] (Youya) [Uhn. Ive been waiting.] (Luna) [Me too.] (Til) [Itadakimasu.] (Phil) And so, our fun lunch party has begun. . . . I enjoyed the frozen mango for our dessert. It has a strong sweet and sour taste with a nice texture indicating that it was fresh. In addition, it is a cold dessert which tastes great in the middle of the afternoon. [This is Lunas defeat.. Such a dirty plan. Your food is only delicious because of my meat! Ill only accept it because Youya said so!] (Luna) [Fufufu, it was all calculated!.] (Til) It was Tils victory. Having a delicious cold, sweet and sour fruit after eating the greasy meat is definitely foul play. [Phil, is it fine for you to be spending your time with us rather than participating in the management for the festival?] (Youya) [Although the management is in chaos right now, the guild officials especially the experienced ones were excused from their duties. Thanks to that, I have some spare time now.] (Phil) What Phil told me yesterday flashed across my mind. My uncertainty and vigilance is increased to the maximum. [Now I am able to cheer on Luna and Youya during your events. So both of you try your best!] (Phil) [Uhn. Luna will try her best to win!] (Luna) [Ill try my best but I plan to have the younger men take the spotlight.] (Youya) Luna is fired up but Im afraid that it will be tough for her to win the tournament. Honestly, itll be difficult for her to hold up against someone who has been trained in martial arts as she lacks the discipline. Although she did manage to land a single blow on me in the sparring match. I think that she should be able to get a few wins in the tournament. [Its about time for us to leave. If we dont leave now we may not be able to find any seats.] (Phil) [I agree.] (Til) After the meal, we headed towards the Colosseum for the event. On the way there, a guy who I see often in the guild came over to talk to Phil. [Sorry, Luna, Youya. I wont be able to cheer you two on in the event. Seems like theres trouble happening somewhere and I have to go.] (Phil) [Its alright. Good luck with your work.] (Youya) I hope Phils work goes smoothly and wish her luck. However, I feel that the timing is a little suspicious. Since Rumberg is the city of beginnings, with a max level of 25 for adventurers, there arent many high level adventurers in the city. It could be a plan to keep the max level Phil away from the event. I hope Im reading too much into this, but just in case Ill keep my guard up. . . . Lunas tournament battle has begun. In the Colosseum, there is a ring in the center while the spectators seat form a circle around the ring. The atmosphere in the Colosseum is extremely heated as cheers roared whenever a match starts. There were also bets being placed on the contestants. Me and Til were watching all of Lunas battles in the tournament. [Youya bet a lot of money on Lunas victory right?] (Til) [Yeah since the return is quite high.] (Youya) No matter how you see it, Luna is just a girl around the age of 13 or 14 whose only weapon is a dagger which is unreliable in a one on one battle in an open arena. Most customers would wisely refrain from betting on her. Because of that, the bets were incredibly one-sided. There is no reason for me to give up such a profitable opportunity. [Do you believe that Luna will win the tournament?] (Til) [Shes my cute disciple. In addition, she managed to land one blow on me during our sparing match this morning. Theres no way she would lose to these inexperienced chicks.] (Youya) It is finally the tournament finals. Multiple matches were conducted simultaneously up until the quarterfinals, and only one match was conducted from the semifinals. Right now, everybodys attention is focused on the final match. Lunas final opponent is a spear man. Just going by their weapons Luna is already at a disadvantage. A spear already has a range advantage even against a swordsmen, but a battle against a dagger wouldnt be a contest. That is, if the dagger-user was a normal opponent. As the battle started, Luna jumped backwards, increasing the distance from her opponent. Jeers came from the crowd as they viewed it as an act of cowardice. [Luna, shut these people up.] (Youya) I know it very well. This is a move by Luna to prepare the distance for her top speed rush. After jumping backwards, Luna suddenly jumped forward towards her opponent. Spearmen were people who preyed others in a head-on battle. However, Lunas rush is low and abnormally fast. The spear man likely hasnt experienced any movements this fast and gets thrown off his pace. Unable to predict Lunas movements, the spear man attempts to attack in Lunas direction hoping it will deter her rush, however his reaction is too late. A spear without a target doesnt have a chance of hitting Luna. Luna is capable of accelerating to her top speed in an instant and before the spear was even raised in Lunas direction, her thrust had already landed into his chest. [Clean hit! Winner, the Thief Luna!] (Referee) The referee announced Lunas victory. Cheers for the Lunas unexpected victory roared throughout the arena and the wrath of the people who bet on the spear man echoed behind. Luna ignored the roar of the loud crowd and looked in my direction, showing a wide smile as proof of her complete victory. [Luna, you did great.] (Youya) I cant help but take pride in my disciples victory. Looking at it from afar, her movements were very similar to my own movements. She is really catching on quick. Although it was slightly different due to our choice of weapons, her breathing, footwork, center of gravity. I could see me in each and every one of those movements. I am really looking forward to her growth in the future. She learnt to imitate my movements with her incredible sense and presence of mind to became strong. I was thoroughly studied and absorbed in this short amount of time. Ill praise her more when we meet up later. Now then, next is my turn. My disciple went on to win her tournament. I cant disappoint her by losing my battle. While caring for the chicks in my team, lets make the battle with the Killer Ape an exciting one. Volume 1 Chapter 22 . . . After arriving at the waiting room, me and the other members gathered together to receive an explanation of the rules [This is a opportunity for us to show that adventurers from Rumberg more capable than those from the other starter towns, please show everyone the result of your trainings in the town. Moving on to the rules of the event] (Event Staff) While listening to the rules, I observed the young men in arms who I would cooperate with for the battle against Killer Ape. As I have heard from Phil, my party members were young men who were full of ambition and pride. The two of them only cared about showcasing their own capabilities rather than collaborating together for the battle. One of them is a warrior who is Kevins older brother, Nicholas. The other is a fighter named Isaruk. Based on how he carries himself, it looks like he has some experience as a martial artist but is extremely overconfident. Note: Isaruk speaks using -sessha and -gozaru [Dont drag our feet down old man. Try your best to keep up with us. It is impossible for magic knights like you to defeat Killer apes.] (Nicholas) [Nicole-dono, lets see who will be the one to land the finishing blow.] (Isaruk) [You two shouldnt underestimate me.] (Youya) The warrior Nicholas and fighter Isaruk clearly do not plan on cooperating with each other and think that they are capable of defeating it themselves. It is bad news if our group of level 20 adventurers do not collaborate in the battle as the battle will be difficult individually. The two of them heard me as I let out a sigh. Times like this make me appreciate Til and Luna even more. Those children may be equally ambitious but they properly listen to my instructions. [Magic is even prohibited in this battle for the crowd as they are more excited to watch us brawl out with the Killer Ape. This is really a terrible handicap] (Youya) Without my magic, my firepower wont be enough to take down the ape. Ill have to defeat it with just my sword. It will be a difficult if not impossible task to perform. I spent the time before the battle to prepare myself. . . . The event is about to start and the contestants enter the ring. The warrior Nicholas and the fighter Isaruk waved towards the audience, brimming with confidence and making themselves standing out. [Youya, do your best!] (Luna) [Show everyone your good side!] (Til) Hidden amongst the cheers of the audience, I could hear the voices of the two girls and waved towards them. I was starting to get depressed talking to these two people and I can feel a little bit of motivation coming back to me. The crowds cheers started becoming louder and louder as our enemy entered the arena. The Killer Ape was brought into the arena trapped in a mithril cage. It is a gorilla at least 50% larger and taller than me with purple hair all over its body. That purple hair served as an armor, harder than steel, flexible enough to absorb impacts and greasy enough that any blade that lands will be directed away. However, what made it terrifying was its abnormally large arms that boasts as much strength as it look, and its intellect which was more intelligent than a typical beast. There is even a chance of instant death if we make a mistake in the battle. [We will be activating the barrier.] (Announcer) A spherical barrier starts to surround the arena as a precaution to protect the audience from any collateral damage. However, this also means that we will be unable to escape from the battle. In addition, the staff started sprinkling perfume onto the contestants, agitating the ape while making the crowd more excited. This was done to ensure that the ape would be more focused on us rather than its surroundings. [For todays main event, it is the exciting battle between a powerful monster and Rumbergs very own adventurers!] (Announcer) The staff announced the start of the battle and unlocked the cage. An angry Killer Ape officially enters the arena. Now, its the start of the battle. . . . The first person who took the initiative is the fighter Isaruk. Thanks to the Fighters stat corrections, he moves quicker than any of us in the arena. As he has the air of an overconfident martial artist, I followed behind him in order to provide support and prevent the worst-case scenario. In my opinion, martial artists who are inexperienced are much more dangerous than amatuer martial artists due to their overconfidence whereas amatuer martial artists typically understand where their limits lie. As far as I can tell, Isaruks defensive stats should be enough to survive a hit against the Killer Ape so Ill support him on his attempt rather than stopping him outright. As Isaruk approaches the gorilla, he sidesteps the gorillas attacks and steps into its body. Those are good movements. [AH CHA CHA CHA.] (Isaruk) He lands a series of consecutive blows with the Fighter skill Iron Fist. Its a skill that hardens his fist as hard as iron, raising the power of his punches. [Uhoaaaa] (Killer Ape) The Killer Apes roar reverberates throughout the arena, however it wasnt a cry for pain but a roar in rage. The flurry of punches did not affect the gorilla in the slightest. It didnt matter how hard the fist was hardened, the bristles present on its body would cushion each blow, killing the power from the punch. Although he was advised to attack the areas without bristles, it seem that he ignored that advice and continued to attack the bristles anyway. In the first place in a battle of power, it isnt practical to release a flurry of punches rather than a single powerful punch. If he tried to push through with a single powerful punch, there was a chance that he could inflict some damage through the bristles. The Killer Ape swung its arms towards Isaruk and he is blown off to the side of the area. Watching his trajectory, I slid in front of him and caught him before he landed on the ground on his head. [Pathetic, Isaruk. End of the day, it seems that the hero will be me.] (Nicholas) While throwing a one-liner towards Isaruk, the warrior Nicholas entered the battle. He immediately ran towards the gorilla and releases a single strike against the tough bristles on the Killer Ape. However, it was a slash that a person would expect rather than a thrust, ignoring the advice given to him backstage. Typically, it would be more effective to thrust against the Killer Ape as it was possible to slide the blade in between the bristles and directly attacking its body. [Take this! Bash!] (Nicholas) Attacking from above with pure power by using Bash.However, the Killer Ape does not avoid it. As if it was natural, the sword slips on the greasy hard bristles, getting redirected back onto the ground [ARGHHH.] (Nicole) Nicole drops his sword onto the ground and screams in pain. This is expected if you are going to Bash onto a stone floor at full strength. The Killer Ape raised his arms and lands a direct punch onto his face, instantly blowing him away towards the arena wall. His life will be endangered if he slams into the wall with that momentum. I run towards Nicoles flying body to grab him, using my own body to kill the momentum as much as possible. [ouh ouh ouh ouh] (Killer Ape) The Killer Ape pounds his chest in celebration as I turn to face Nicole and Isaruk. [Our first round ended badly, but its time for round two. Now, you two ready for some revenge?] (Youya) The two defeated adventurers were trembling in fear, closing their eyes trying to drown out the roar of the Killer Ape. Their minds seem to be breaking just by battling the ape for afew seconds. They are forced to face the reality that none of their attacks worked on the beast and they would be badly injured if I did not step in. More than anything, their hearts were breaking when faced with an opponent with a overwhelming advantage in ability. They must have not participated in a battle against a monster where their superior techniques and equipment is unable to protect them. They grew as an adventurer experiencing victories after victories without experiencing a defeat. Having their first defeat with such an overwhelming difference has inflicted too much damage on their self-confidence. At this rate, they will become unable to continue as an adventurer. I could continue to defeat the Killer Ape but that is no good. If the two of them ends the battle in this state, it will become a traumatic experience for them. They may never stand up on their own two feet ever again. This is all they would ever amount to in their life. I cant bear to leave the two of them like this. The two of them are still growing and young, they have plenty of time to fail and learn from their mistakes. It feels too much of a waste for their journeys to end right here. [If you guys wont do it, then am I supposed to defeat it alone?] (Youya) [Its impossible. To defeat that.] (Nicholas) [At our level, its impossible for us to defeat it.] (Isaruk) [Then sit there and watch.] (Youya) I stepped forward and cast my new skill Warcry. Its an ability that draws a monsters attention and provokes it, forcing them to focus their attacks on one target. Its an essential skill for the front-line. [OHHHHH]] (Killer Ape) Without sparing a thought for the two fallen warriors, the Killer ape attacked me using both its arms without worrying about a flank, sometimes throwing in a kick showcasing its dexterity. I receive each of its attacks with my sword and deflect it to the side. Its attacks are much heavier than the Rock Golem in the dungeon with different variations, coming from the sides, above and even from below. However, it is still managable as it also has more preliminary movement. Predict its movements by afew seconds ahead to find an opening and land a strong blow. I dont have access to my magic so I wont be able to inflict any major damage without an opening. Wait and predict, be patient until you get a chance. Meanwhile, the two losers are on the ground watching the battle with widened eyes. [Amazing.. Such an intense battle.] (Isaruk) [Just who is that old man?] (Nicole) The Killer Ape throws out a telegraphed punch. This is my chance. If its like this, then Im sure the message will reach them. I deflect the punch towards the ground, throwing the Killer Apes center of gravity forward, lowering his height. When it is retracting its hand, I shorten the distance and release a thrust into its right eye. One of the Killer Apes weak points is its face which isnt covered by bristles, making it softer than anything. [UGOHHH] (Killer Ape) Blood flows out of its gouged right eye. The Killer Ape cries in pain as it jumps away, creating distance. When battling against an opponent with a impenetrable defense, it is a standard move to target the opponents eyes as it is highly likely to inflict damage while hindering the opponents vision. The Killer Ape growls at a distance in provocation. Somewhere in that provocation, fear could be sensed. Now is the time. [Nicholas, Isaruk. How long are you guys going to sleep for? You were watching werent you? Are you going to leave the battle as it is? At this rate you guys will exit this arena as a loser who relied on an old man to clean up after you. And you will remain as losers until your death without facing another strong enemy ever again. Are you fine with that?] (Youya) I have said my piece. Its up to them whether they choose to stand up and face their fears. [OHHH. I can still do it. Im not a loser.] (Nicholas) [You are not alone in this.] (Isaruk) The two of them stood up with trembling feets, following behind me as I stand at the front. I let loose a slight smile. I dont dislike people who try their best. The Killer ape started beating his chest and rushed towards us. [Both of you stay behind me. Ill open up a gap. When the time comes, both of you release your strongest attack right into him. Dont hold anything back.] (Youya) [OUH!] (Nicole) [Roger.] (Isaruk) The two of them ignored the advice given earlier before the battle, however this time they properly listened to my instruction. This time, rather than deflect and wait for an opening, I am slowly inching forward while deflecting. Eventually I will get a chance to counter and forcefully open up a gap. Driven by fear, the Killer Ape continues to fire a flurry of blows trying to deter me from approaching. With this, the match is decided. The faster you throw out attacks, the quicker your stamina drains. Eventually, the ape paid the price. It ran out of breath and its balance is thrown off. Seizing this opportunity, I moved around to the back of the Killer Ape and slash its exposed heel. [UGYAAAAA] Having its tendon cut, the Killer Ape is unable to stand and is put on his knees, cutting his mobility. [Now, its your chance! End the battle!] (Youya) I shouted towards the two of them to end the battle. The warrior Nicoles blade starts to shine brightly while the fighter Isaruks body is enveloped by steam. Nicole activated the warriors special skill Strike Impact. Its a skill with high mana consumption, but its easy to use with its high speed and rushing distance. The blade slides between the bristles and gouges out the flesh of the Killer Ape. The fighter Isaruk activated one of the Fighters more powerful skills Reverberation, focusing all his power into his elbow. It is a technique that focuses the persons power into a single point. This technique renders the bristles useless as the shockwave is sent internally through the body. Note: The name for Reverberation is which is also used for Bruce Lees famous One inch punch, however Isaruk uses it on his elbow instead of his hand so I decided to wing the name. After the two of them landed their skills, the Killer Ape collapsed and blue particles start to rise. But theres something off. The blue particles seem to be appearing too slowly. Is it just me or is his body not disintegrating? [We won.. We actually won right?] (Nicole) [Its our victory.] (Isaruk) The two of them have definitely stopped trembling. It seems that the two of them has gotten over their trauma. [Good work. Now you know that old men can flourish in battles as well.] (Youya) [We were rude to you and had to rely on you to save us. I am terribly sorry for my mistakes!] (Nicole) [I have also been reflecting on myself. When I saw your battle, I felt ashamed. I am sorry.] (Isaruk) Looks like these two men are still young in spirit after all. I am glad that I managed to save their spirits. [What you did isnt important. Its what you do afterwards thats important. So long as you are alive, you can atone for your mistakes. But now, its time to rejoice for our victory. When you come across a strong monster, you laugh and bump fists. That is a party.] (Youya) [Yes Sir!] I raised my fist and the three of us bump our fists and laughing in celebration. Somehow we managed to survive the battle without any major injuries. . . . Suddenly, I felt a chill rush down my spine. Following my instincts, I pushed the two of them aside, grabbed my blade and turned around. I felt a huge impact throughout my body. It was the Killer Ape that is assumed to be dead. However, its muscles were larger than before, its nails became even sharper and its bristles changed to silver in colour. It was ridiculously strong impact. I placed my hand on my knee and pushed myself upright. The Killer Ape raised his hand and swung towards me. I quickly performed a forward roll to the side to avoid the punch. The stone ring was unable to withstand the impact of the apes punch and broke apart. [It.. changed?] (Youya) And it isnt stopping there. It continues to change as time goes by. It shouldnt be that easy for a monster to alter its body. This is already on the level of evolution. Just what is this monster? Even if I were to go all out, I dont think Ill be able to defeat this monster, that is how terrifying this beast has become. [From here on, we will fight together!] (Nicole) [Both of you get away!] (Youya) The staff outside of the barrier took out their swords and began to attack the monster resembling the ape. The staff which consists of high level adventurers who were on standby stood up against the beast. However, it was futile. [GAHH] With just one swing of its arm, one after another the adventurers merely became clumps of meat on the barrier. This is bad. What can we do in this situation? What should we do? While I was contemplating our next move, a broadcast began to play. [Greetings everybody. Congratulations to the adventurers who won the first round. However, now its the real deal. Its the start of the second round. Everyone here is lucky enough to witness the first ever documented case of monster evolution. And the end of the adventurer age. With our secret art of evolution and our monsters, we will rule over the world.] (Broadcast) This voice sounds familiar. Its the voice of the guildmaster. From his broadcast, Ive understood the situation. No matter what, we have to manage this monster somehow. I feel the pain down to the bones in my body, but I have to do it now. The damage is contained for now thanks to the barrier around the arena. Phil isnt here right now thanks to her duties. If this beast is released from the barrier, there wont be any adventurers present in the town of beginnings that is capable of dealing with the beast. For the second round, I dont have to hide my magic anymore. It is a breach of rules to use magic, but it isnt the first offense committed here today. There is a customized magic spell that cant be used until level 20. Its time to demonstrate, the power of the Magic Knight. Volume 1 Chapter 23 The evolved Killer Ape became eerily quiet. Listening to the guild masters broadcast, it seems that he has complete control over the monster. [Until now we have always relied on those savages, adventurers to protect us. In reality, without adventurers we would suffer at the hands of wild monsters. It was all we could do as normal citizens to suck up to adventurers as they abuse their power in current society. We had no choice but to cater to their every whim.] (Guildmaster) Suddenly, the guildmaster began to give a speech. It had never occurred to me that a person hating adventurers would ever become the guildmaster that supports adventurers in every way. Actually, it could be the other way. He became to dislike adventurers after becoming the guild master. [However, it will be different from now on. The ability to rule over wild monsters has been discovered. And by researching this ability, We have managed to discover the ability to mutate monsters, to make them grow beyond their previous capabilities and evolve them. Everyone should be able to understand this. Rather than spending so much time and resources into raising weak humans into strong adventurers, we can instead raise strong monsters, far stronger than anything humanly possible. Unlike adventurers, they are also completely obedient. Please take a look at the power of the evolved Killer Ape.] (Guildmaster) Seems like we are the unfortunate ones that were chosen to be sacrificial lambs. The staff panicked and outside the barrier removed the barrier trying to get us out of the arena. The moment the barrier was lifted, chaos ensured as screams came out from the audience and every began rushing to the exits. The staff are good people, but unfortunately it was the wrong move. Even if it meant trapping us with it, the monster should be left contained inside the barrier. If I were to inform them about the voice belonging to the guildmaster, there is a chance that they would refuse to believe it. Nicholas and Isaruk ran towards the exit trying to escape. [Old man, you should escape too.] (Nicole) [That monster is too powerful.] (Isaruk) Escaping is the correct option to take here. The mutated Killer Apes strength feels like its on par with a level 50 monster. There is zero chance of winning this battle. [Piece of advice to the adventurers in the ring. If all of you escape the ring or die, Ill order the monster to attack all the civilians in the area. It will become a BIG incident. Well Im sure all of you are going to escape anyways! You adventurers, are self-centered people who only look out for themselves! Even if reinforcements arrive, Ill kill all of them!] (Guildmaster) Giving advice to us adventurers, such a nice person. I prepared my stance while grabbing my sword. Although the audience had started evacuating a while back, everyone is disorganized and in a mess. The evacuation hasnt progressed one bit. I dont want to imagine the damage it will cause if the guildmaster were to let the monster loose. [You heard what he said. You guys get away, Ill stay here and fight.] (Youya) [No way. In that case, Ill sta-] (Nicole) [Ill stay to-] (Isaruk) [Theres no need. He mentioned that everyone has to leave before hell unleash that beast. Only one person has to stay behind.] (Youya) Nicole and Isaruk both gasped in shock. [We arent going to leave you here to die!] (Nicole) [We can provide support! Even a little if were here!] (Isaruk) It is hard to believe that the two of them were trembling before the Killer Ape earlier after a rough beat. Im glad that pulling off a show to pull their spirits back wasnt a waste of effort. They will become amazing adventurers in the future. [Having the courage to battle against an opponent that you may or may not defeat is a privilege that belongs to the young. But take heed of the fact that too much courage leads to recklessness. So I request of you to give up on this battle. If you were to join in the battle you will die. That is without a doubt. You guys will just be dragging me down in the battle. Now GO.] (Youya) The two of them remained silent as they recalled how overwhelming the mutated ape is based on their encounter against it pre-evolution. [No.. I refuse. If we leave you to die here.. Then we are the losers here. That kind of loss-] (Nicole) I put on an air and started laughing. [Since earlier just what have you been trying to imply? Self sacrifice. Dying. Doing what you want without regrets. I think you have misunderstood. If you guys arent here being dead weights. Then I can win this easily.] (Youya) Increase my concentration and control my breathing. [I mentioned earlier that the courage and recklessness to dive into a battle against an overwhelming opponent is the privilege of the youth. If that is the case, then the privilege of the old would be the accumulation of experience from constantly diving into battles to the death, finding ways to overcome opponents that you would have no chance to defeat otherwise. Old men only participates in battles where he can win.] (Youya) The brave men who planned on sacrificing themselves are began crying while leaving the battlefield. With this, I have even more reason to ensure that I do not fall here to prevent wounding their pride even further. As their senior, that is something I will absolutely not do. I would have two win conditions where I get to survive with my life. First would be to defeat the monster and survive. Second would be to survive and buy enough time for other adventurers that are capable of defeating this monster. If only Phil was among the audience, then this situation wouldnt be as dire as it is. However, thinking about it clearly, my conditions arent impossible. [Oh? Only one adventurer was willing to stay? Trash will remain trash no matter what. No one else would ever consider abandoning their friends for their own survival. Now, enough waiting. Go, my cute toy.] (Guildmaster) The mutated Killer Ape is finally ready to battle. On the other hand, I have been ready from the start. [Oie you public display. How long are you goona stare at me with that I hate you for gouging my eye out look?] (Youya) [OUHHHHH] (Mutated Killer Ape) Now then, its the start of the second round. . . . Back in the days where I had a shitty status, I obtained a means of overcoming my low status to allow me to compete against other adventurers. For me who had neither speed nor power, it was the only thing that I had. Deflect was difficult to maintain but it made me stronger by a huge margin. However omnipotent it could be, there was a limit. Note: I gave a name to Youyas technique as it fit the description of his technique while making it easier to write. [UHOOOOO] (Mutated Killer Ape) [UWOOOOO] (Youya) I properly received the blow and diverted the force elsewhere. It doesnt matter how fast the Killer Ape could move nor how powerful his blows are. So long as I can anticipate his movements several seconds into the future, Deflect can be used perfectly. However, it wasnt enough to nullify his power and each blow threw me around the arena. Deflect isnt a technique that nullifies a persons attack, but rather a technique that allows me to receive an attack roughly ten times my strength. Regardless of how perfect I perform it, it is inevitable for me to receive some of the impact and damage when performing Deflect. If its the worse case scenario where the opponent has strength far superior than I can deflect, then Ill be blown away. Just like what is happening right now. Right now, even though I am killing my momentum after each blow, Im immediately sent flying once more. The mutated ape became so fast that he could easily move to where I was sent flying in an instant, cracking the ground in the process. [Ugh. This is difficult.] (Youya) His power is probably at least eleven or twelve times my own. Its not a level where I can manage with just Deflect. Even my Deflect is starting to falter to his power and my footing is becoming worse. If I were to directly impact the wall of the arena or the ground without breaking my momentum, I will suffer substantial damage. I could feel the pain from each blow penetrating into my arms as if my bones were shattering. Its taking my all just to avoid taking a fatal blow. I received the same attack five times consecutively without being able to counterattack. My body is slowly getting heavier and my arms cant be lifted anymore., At this rate, I wont be able to move around soon. The longer I survive, the further the citizens can get away from here and the closer I get to my second win condition. It is still not impossible for me to win. Without caring about defense, the mutated Killer Ape dashed towards me from the front. [Its finally done. Superconductive Bullet!] (Youya) A bullet resembling a lightning bolt flies towards the Killer Ape. Its the magic that I began casting at the start of the battle, customized from the Intermediate class magic Thunderstorm focusing on its power and range by sacrificing its area of effect and casting time. All in all the chant took one minute, and I had to buy time for that minute. Based on raw power, Napalm Strike would be more powerful than Superconductive Bullet, however that spells activation period was too short for me to use in this battle to land cleanly onto my opponent. The lightning bullet sent towards the ape penetrates the left side of its chest, scorching a hole. [UGAHOOOOO] (Mutated Killer Ape) Although the bullet wasnt powerful enough to completely scorch through to its back, it bought several seconds as the ape suffered burns as well as paralysis due to the electric element. If its now, I can do it. I started a new chant, quickly closing the distance between the two of us as fast as I could. My left hand began to shine red as it started trembling. [Napalm Strike!!] (Youya) It was my strongest spell that focused every element into its power. The strongest fire that blasts a super high temperature blast at point-blank. I struck my glowing left hand into the Killer Apes left chest. This was my goal from the beginning. By using Superconductive Bullet, I can paralyze and stop the monsters movements while burning the bristles around its chest, giving me the opening to cast my strongest spell Napalm Strike. It is the reason why I spent the last-minute being thrown like a ragdoll! Let this blow penetrate through! [UGAAAA] (Killer Ape) However, that was naive of me. The blow that I hoped to end the battle with, was stopped at his skin. The Killer Ape swung his right leg. I brought up my left hand to intercept his kick. A dull crushing sound could be heard. Along with my armour, my left arm was crushed and I was blown away. Somehow, I managed to stand and glared at the monster [Even my Napalm Strike was defended against just by his skin.] (Youya) My left arm was in extreme pain from being broken. Im lucky that it wasnt my main hand as a right hander but it means that I cant cast Napalm Strike anymore. If I were to use it on my right hand, it meant throwing my sword away which I needed for my Deflect. Based on my status, it should had been possible for Napalm Strike to effective against the monster, however it appears that somehow it developed a resistance against fire due to its evolution. Thanks to that my calculations were thrown off-course. However, my plan wasnt in vain. Thanks to the damage it received, the Killer Ape became wary and began keeping a distance between us, allowing me some breathing room. [Youya! Luna will fight too!] (Luna) [If its support then thats my specialty!] (Til) Appearing from the exit were Luna and Til. Im glad that the two of them showed up. If I were to lose here, then the more adventurers around the better. However. [Dont interfere!] (Youya) [But, you are..] (Luna) [Dont worry. I can win this. So watch and learn. We will fight together in the next battle.] (Youya) Luna is a sharp child but she is still a child. If I were to just tell her not to join, she would argue against it. However, if I told her to watch so that she could be more effective in helping next time, she will listen. Luna silently nods and continued to watch my battle from afar. [Til. Ill leave Luna to you.] (Youya) [I understand, but are you really able to win?] (Til) [Dont worry, I still have a trump card. From now on, its no holding back.] (Youya) I feels like its time to activate my trump card. However, its a shame that I wont be able to activate it along with an attack magic. If Im unable to use an attacking magic, then Ill use that spell instead. Theres no doubt that the situation is worsening by the minute. My body has accumulated a lot of damage and fatigue. In addition my left hand is unusable. Finally, it looks like the Killer Ape is ready to attack once more. I took a deep breath to prepare myself. This time, Ill activate two of my trump cards. First is the power that I obtained thanks to my knowledge of my previous life. The power that Magic Knights were known for back in the game era. Second is the power I obtained from my experience living in this life. The power that I obtained when I suffered from my incompetent status. The Killer Ape prepares for the third round. It is a little bit intimidating that I no longer have the option to use Deflect and receive his attacks. But Im not afraid. I absolutely cannot lose this battle. This is a test of the experience accumulated in this life and the knowledge from my previous life. There is too much at stake for me to lose here. Now, let the third round begin. Volume 1 Chapter 24 [UWHOOOO] (Mutated Killer Ape) The Killer Ape started running in my direction. Seems like it was quite agitated by my attack earlier. It is emitting an overwhelming bloodlust. Calm down and concentrate. I closed my eyes and began to concentrate my consciousness. This is the moment where I have to activate one of my trump cards. This is the strength I obtained in this life, the ability to compensate for the low status that I obtained in the past. The power that was never discovered back in the game era. [] (Youya) Why does a person become stronger whenever their status went up? This was a question that had been on my mind for a long time. I was constantly thinking about the possible answers to the question. Until one day, on the brink of death, it became visible. Surrounding everyones body was a white aura. It wasnt until afterwards when I realised that the aura was the manifestation of a persons status, becoming brighter as the persons status becomes stronger. Then it occurred to me. If I could control the aura surrounding my body, then I could use that power to make myself stronger. And that idea became reality. The attack that I was unable to defend against, that threw me around was coming once again. [Whats wrong? Are you that frustrated that the arms you were so proud of could be easily stopped?] (Youya) [Ugahhh] (Mutated Killer Ape) I received the blow without being blown away. I express my usage of the white aura as opening the door. The essence of the aura was released from the individuals soul, which then wraps itself around the souls body. By imagining the white aura overflowing from the soul, the aura can be increased by 20%, which then increases my overall status by the same amount. Not only am I able to increase the amount of aura coming out from my body, I am also able to focus the aura into one part of my body. The blow that came from the Killer Ape wouldnt be stopped just by increasing my overall status by 20%. It was only possible by concentrating the aura around my body onto my arm receiving the blow and the leg that was holding me in place. By doing this, I can increase my power from 20% to 50%. With a 50% increase, my power isnt that much different from the Killer Ape. Perhaps there are other adventurers who also gained the ability to see the aura on their deathbed. This is the ability that is awarded to people who have put in the effort. Even after gaining the ability to see it, it took me ten years before learning how to utilize the white aura. Since then Ive been practicing to increase the amount of time I could maintain the increased aura. Anyone who has put in this much effort in their lives would never be stupid enough to give up after ten years. [Now, its my turn!] (Youya) I completed defended against the apes attack, disrupting its balance. Although its dexterity is higher than usual for a monster, throwing such a powerful attack is sure to disrupt its balance once deflected, resulting in a large opening that is impossible to miss. Opening the door requires a large amount of concentration. Normally, I am able to leave it open for about a minute, however in my wounded state I can probably only last for thirty seconds. Once this battle is over, its highly likely that I wont be able to move a finger. Opening the door for an extended period of time places a large burden on my body. If I dont end this before then, it will most likely result in my death. The moment I used this technique, I was already resolved to finish this battle as soon as possible. [UGAOOO] (Mutated Killer Ape) The mutated Killer Ape is trembling in fear. I am surprised at this. Monsters who only battle with an overwhelming large difference in their status. True adventurers draw their power not from their status, but from their strong will and training. This wasnt something that monsters possessed. [Im sorry but I am going to end this quickly.] (Youya) I activate my magic spell. However, instead of an attack magic, I will be activating one of my support magic. Back when Magic Customization was discovered, one of the advantages that a Magic Knight possessed was their support magic. A spell that represented a Magic Knight was Power Gain. It is a spell that increases a persons power by 20 percent for 10 seconds. It is a convenient spell that is used often but often lacked any huge impact that other spells had. However, Magic Customization completed changed that. Raising a persons power for an extended period of time was unnecessary so long as the persons power was amplified when their attack is released. Thats why people often decreased its effect duration while increasing its power amplification to the maximum. As a result, the increase in power became over a dozen times the original strength. This is that customized version of Power Gain. Its name is [Gods Strength!] (Youya) It is the strongest spell that a Magic Knight can cast but is difficult to use. Its chant requires 2.5 seconds. In other words, you would have to cast it preemptively before the activation period which lasts only for a few moments. It is difficult but thanks to my usage of the aura, it is possible. However, it is still not enough to take down the Killer Ape in a single blow. Increase the power of my trump card even further. Focusing all my power into a full-power thrust. Without splitting the aura in my body, I focus the aura onto my foot when launching myself towards the Killer Ape, redirecting it to my waist when twisting my body, followed by my shoulder, pushing my blade forward then redirecting the aura towards my arms, following the flow of kinetic energy in my body. This is my true trump card. My usage of the abilities I possess. It doesnt matter how much knowledge I obtain from my previous life nor the overpowered skills that I possess. It is the power I obtained when trying to overcome the low status which drove me to despair. After 2.5 seconds, my power amplification spell timing coincided with my thrust, penetrating the left breast of the Killer Ape. The monster that wasnt staggered by the combination of Superconductive Bullet and Napalm Strike, was struck down by the combination of Gods Strength and the thrust amplified by the power of the aura. After completing the thrust, I let go of the sword and jumped backwards. The moment I landed on the ground, its fist landed onto the ground at my original position. Although its heart has already been stabbed, his fighting spirit hasnt waned in the slightest. It continues to lose a large amount of blood and will most likely die soon. It plans to take me along with it. [UGAWHH] (Mutated Killer Ape) It started running towards me. With the accumulation of fatigue, my movements are starting to become sluggish. I have five seconds left before I reach my limit. I have enough mana remaining to cast one more spell, however Napalm Strike wont be effective against an opponent with fire resistance while Superconductive Bullet takes too long to chant. My beloved sword was also currently in its chest. It is the worst case scenario. At that time, the other sword in my possession appeared in my mind. The magic sword I got from the weapon store back then. [Are you telling me to use you?] (Youya) I felt the sword call out to me as if it was responding to my question. If thats the case, then Ill trust you. The sword that I chose from the barrel. I lowered my center of gravity as I grasp the sheathe of the blade. If piercing its heart isnt enough to finish it, then there is only one other place which could be lethal. I cast Gods Strength a few moments before it closes the distance between us. Ill push forward with all my strength against the Killer Ape. [Sorry but my cute disciple is watching us. There is no way that I can lose now.] (Youya) The black blade shines in the air and a red liquid flows out from the neck of the ape. As he approached me, I jumped out and slashed at its neck with my entire body. Aside from his face, the weakest point on the Killer Apes body is its neck where the bristles are thinner. Besides that, it was a bet on whether it would be enough to finish it off. The next moment, the mutated ape collapsed onto the ground, this time disintegrating into blue particles for sure. The time limit on the door ended and I collapsed onto the ground. [That was dangerous.] (Youya) I cant even move a single finger. I felt my sweat flowing, my heart beating profusely and my ragged breathing. I barely survived the final round. The reason why I barely managed to win the battle was due to the fact that my currently status was almost equivalent to my status before the level reset, causing my body to move perfectly according to the image that I have pictured for decades. This allowed me to control my body perfectly when utilizing complicated combinations like this. A single misstep would had cost me my life. If my status was any higher than this, my control would go haywire, making it impossible to fight like I did earlier. However, that fight was still enjoyable.I was pushed to the limit and somehow managed to increase my speed and power even further. I was somewhat held back by the time limit, however what drove me forward wasnt the pain of losing my life, but hope for surviving towards the future. [Youya!!] Luna and Til started running towards me from the exit. The two of them held me upright and Luna took out a health recovery potion and a stamina recovery potion. However, strength was absent from my body and the liquid spills onto the ground. [Youya, try to swallow it.] (Luna) Im properly trying to, but I cant. Luna cried as she looked at me, however her face changed somewhat to a determined face. Then, without hesitation, she poured the liquid into her mouth and pushed her lips to mine, attempting to force me to swallow through mouth-to-mouth. While feeling the soft warmth of Lunas lips, I couldnt help but notice how beautiful Luna looked up close. After awhile, I felt a slight amount of energy return to my body. [Youya, please get up.] (Luna) Luna desperately tries to feed me the potion while crying. However, my body still isnt moving. I should show my guts and try to comfort her. [Its alright, Im better now.] (Youya) I felt some sensation on my fingertips as I lifted my hand and pat Lunas head. [Im glad, Youya.] (Luna) Luna jumped towards my upper body which was held up and as if the dam had been broken, started to cry uncontrollably. Thanks to her I managed to recover a little bit of strength, but it still isnt enough. Honestly, I am trying to resist the urge to close my eyes and fall asleep, however the match isnt over yet. I have to do something about the guildmaster. If he had the liberty of showcasing a demon like the mutated Killer Ape, he must have at least another monster on the same level escorting him. If thats the case, its impossible for normal adventurers to go after him. I am the only one capable of doing so. And yet.. [It looks like my battle has come to an end.. I leave the rest to you.] (Youya) In the distance, I saw the appearance of a girl with beautiful blond hair carrying a bow, heading in the direction of the guild. This is good enough. Ill leave it to you. If its Phil, then I can relax knowing its in good hands. Besides, Im sure she isnt alone. After all, Ive heard rumors that he is currently in Rumberg. If both of them are there, then this old man isnt needed. Using my own power, I forced myself to grab the potion, and drank from the bottle directly. [Luna,Til. Lets return to the inn. Im a little tired.] (Youya) [Uhn. Lets go.] (Luna) [Youya, lean onto my shoulder.] (Til) My job in this incident is over. Ill hear the details from Phil later. I ought to have the right to know why the guildmaster acted this way and what kind of people is he working with or working under. Volume 1 epilogue Volume 1 epilogue After the battle with the mutated Killer Ape, investigations were conducted and by the time we were released, the sun was about to set. Towards the end of the investigation, word was received that the guild master was finally apprehended. That is to be expected, since he and Phil were the ones pursuing him. Borrowing Tils shoulder, we somehow managed to return to the inn where quickly washed up before going to bed as we were all exhausted. Suddenly, I felt an intense blood lust and got out of bed. [Honestly, is this how you greet someone?] (Youya) After grabbing a change of clothes, I grabbed my sword and left the room. It would appear that we have an unexpected visitor. . . . I headed towards the back of the inn alone to meet the guy who emitted a large amount of blood lust towards my room. [What is with you, being all stealthy like this. How about showing your face for once? Since we are on the same side, we dont have to hide things from one another.] (Youya) When Phil went after the guildmaster, she wasnt alone. There was a handsome youth in his mid-twenties with silver hair extending to his shoulder wearing a mask. At a glance, it would look like he is an old man. However, if you look carefully, the person carries the air of a dignified swordsman that has zero openings. [Its been a long time. Teacher.] (Masked Man) [You dont have to be so polite with an old man like me, hero..Leonard.] (Youya) It is the hero Leonard. One of the only men who managed to conquer the Tower of Trials that has a 2% survival rate, increasing his level limit to 70 and becoming stronger than anyone can hope to be. A man who could be said to be the strongest adventurer. A disciple who had everything drilled into him by me. This is our first meeting in ten years. [No matter how much the circumstances has changed, you are the master whom I respect, and the teacher who guided me back when I was a reckless young youth..and my important friend.] (Leonard) [Dont you have a grudge towards me for what Ive done?] (Youya) [Of course not. Back then I knew that teachers decision was the correct one. Or rather, it was me that was stupid. Because of my actions, my teacher abandoned me and Phil decided to leave. Once I matured, I finally conquered the Tower of Trials.] (Leonard) The Leonard standing before me feels completely different from the Leonard that I remember. Just what did he experience this past decade? [I was watching the entire time. From the audience seat. It was an amazing fight. But arent you being too cruel teacher? This whole time you have never showed me such a technique.] (Leonard) [Its been ten years since we last met you know. Even I can learn a trick or two in ten years. And about that, if you were in the audience then you could had lent a hand in the battle a little earlier. Letting me, a level 20 adventurer to battle that monster all on my own.] (Youya) [I thought about lending a hand, but despite being level 20, my teacher was as strong as I remember back when he was level 50, with skills that were even stronger. I would never give up the opportunity to observe such wonderful swordsmanship either. As expected of teacher, you are amazing. Even with the title Sword Hero, Im still nowhere close to my teachers level. Its frustrating.] (Leonard) Note: the original name for sword hero is , which sounds a lot like swordsmanship / technique I was caught red-handed. I felt intense blood lust coming out from Leonard. [I came to this town today for the sake of meeting Phil once more. Lyle received a message from the guildmaster in this town that Phil is currently living in this town, and told me about it. Once I heard about it, I didnt stop until I got here.] (Leonard) That guildmaster. Did he seriously dig his own grave? He went out of his way to showcase the power of his monsters, just to let Leonard come out and arrest him by giving out Phils location? That is unexpected. [I thought that if it was the current me, then there was a chance that Phil would accept me. However, I miscalculated. I had forgotten about my own teacher after 10 years. Unfortunately my teacher reunited with Phil before I did. The teacher who was superior to me in every aspect except for swordsmanship. And although it wasnt easy to catch Phils affection. You did it just by reuniting with her earlier than I did, isnt that too cruel?] (Leonard) Leonards hand started to grip the sword on his waist. [Your blood lust has been growing stronger for a while now. Are you thinking that you can win Phils heart just by killing me? It seems that you have changed quite a bit this past ten years.] (Youya) The possibility of me beating Leonard in the current situation is impossible. He is a genius who managed to master all my techniques and even improved them further. In addition his level was raised to 70 thanks to the Tower of Trial. [I do. However, the way I am right now, I will completely overwhelm teacher. That is why I have a request. One year from now, we will have a battle to the death. So please do your best to become stronger from now on. A year from now, I will steal every technique and skill that you possess and become the true Sword Hero. Then I will steal Phils heart. After all, Ive managed to obtain everything I ever wanted after teacher left.] (Leonard) That wasnt a joke. He is serious in killing me. [Even if you kill me, there is no way that Phil ever falls for you,] (Youya) [Ahahahaha. Dont worry about that. I have my ways of forcing her into submission. It doesnt matter what she feels. Right now at least. I understand it now. Itll never work because teacher is here. Its uncool of me to be inferior to my teacher isnt it? Teacher, Ill take my leave. I look forward to seeing you again.] (Leonard) Leonard turned and walked into the night. He was always this hard-headed even back then, but he wasnt like this. Just what happened to him to make him change this much? Regardless, there is something I have to do. When a disciple strays from the right path, its the masters job to bring him back. A year from now, I will beat him down with my full strength. . . . Several days have passed since my reunion with Leonard. Due to the incident caused by the guild master, the entire guild was suspended, making it impossible to enter dungeons or to accept quests. Rather than sitting idly, Ive been spending this time training with Luna and Til without entering the dungeons. The guild masters intention was discovered as a result of the investigations. After advertising the ability to evolve and control a monster in the Colosseum, he planned to escape from the town and make a living selling monsters. He thought that he would be able to escape due to having three monsters on par with the mutated Killer Ape as his bodyguards, however it was thanks to his unusual bodyguards that he was discovered and eventually defeated by Phil and the hero Leonard. [He was a nuisance until the very end huh.] (Youya) Causing a national scandal during the festival, ruining the event and incurring the hate of the people. Even adventurers were unable to hold in their anger and stress towards the guildmaster. His plan was to hold the audience hostage and force the adventurers in the event to make the decision to escape with their life, leaving the hostages to die and displaying the disgusting personalities of adventurers . Simultaneously, he would prepare his escape while the mutated Killer Ape would display its strength by battling Phil or Leonard who would be attracted by the noise. Furthermore, in order to ensure the plans success, he leaked the information about Phils whereabouts to her former party member, the Thief Lyle in order to lure Leonard here and created a situation where a novice adventurer would have to either escape from the arena or defeated by the monster. [His well-thought and meticulous plan was ruined.. By me huh.] (Youya) Not only did I choose to stay without abandoning the audience, I even defeated the mutated Killer Ape which possessed overwhelming power. The public image of adventurers was protected by a novice adventurer who chose to confront the monster with overwhelming strength, even ruining his display of power by defeating the monster. His bodyguards were also easily defeated, resulting in his arrest. In the end, even if he managed to escape, his plan wouldnt had succeeded. Everything turned out near perfect for us. However, afterwards it was discovered that the guildmaster was assassinated in the prison, most likely by his collaborators to prevent any information from leaking out. This confirmed to us that the true threat hasnt been eliminated, and there were more people with the similar ability to evolve monsters. [Luna, Til, its about time to take a break.] (Youya) [Uhn. I understand.] (Luna) [My throat is soo dry, I want a cold drink~.] (Til) The two girls who were training in the courtyard started walking back towards the inn. The girls were sweaty and wearing light clothing, making it difficult to look at them directly. Luna began drinking the special nutritious drink that I made. Her face began to cramp up. [During training, I suddenly thought back to Youyas fight.Youya was amazing. It was completely different from sparring with Luna. Even though I tried to, I couldnt replicate Youyas movements. The difference is too large. Frustrating..] (Luna) [Me too. When I saw the battle, I couldnt help but tremble even when I wasnt involved. There is still so much to learn. Ill have to continue to do more self-defense training.] (Til) I see. No wonder they have been so fired up recently, so the two of them were just inspired by my fight that they ended up trying even harder than before. [Dont worry about it. The two of you are talented, far more than I. Eventually you will be able to do a battle like that too.] (Youya) [I cant say that I agree with you. It was overwhelming. The monster was too strong and I was scared. Even if you say that we will be able to do that eventually, it feels like that time would never come.] (Til) Before I knew it, Luna approached me and grabbed my side. [Uhm, Youya. Do you remember our promise. After the tournament, you would reward Luna for winning.] (Luna) [Of course I do. Its for my cute disciple, Ill do anything.] (Youya) Luna got shocked after hearing my reply, her fox ears going limp. [Youya. Lunas request is to make a promise.] (Luna) Luna stares directly at me with eyes mixed with uneasiness and expectation, as if she was making a request with her eyes. [Luna wants to be with Youya forever, so never leave Lunas side.] (Luna) [I thought it was something important since you said it like that, so its just that.] (Youya) [Its not just that! Youya abandoned Phil.. Luna doesnt want that..] (Luna) Although I thought she was just being her brazen and happy self following me ever since we met, it looks like she has been worrying about this the entire time. She was afraid that I would leave her. I let out a smile and caress Lunas head. [I promise. Until Luna wishes so, we will always be together.] (Youya) Lunas face bloomed like a beautiful flower after hearing my flower. [I love Youya!] (Luna) Luna jumps into my chest as she grins uncontrollably. Her fox tail was also moving back and forth. Such cute actions fit Luna very well and I gave her lots of pampering. Til who was watching at the side started grinning. [I want to celebrate with Luna but As a sister Im worried. Its the rise of a powerful rival! Well I guess it doesntt matter at this point. Fuu fuu. Congratulations you two. Fuu fuu. Dont the two of you have the hots?] (Til) This girl.. Although I wonder if it does look that way towards other people. It doesnt feel that bad though. Ill stay with Luna as long as she wants to. . . . Even after finishing our dinner, Luna continued to cling onto me and was sitting on my lap. Occasionally, I would lean back and let out a laugh. In such a setting, a visitor came. It was Phil. [Youya. Sorry for being late. I really wanted to come here sooner but some stuff happened. Also.. If I had reached earlier then.. You wouldnt have to do such a dangerous thing.] (Youya) [Maa. It turned out fine so dont worry about it. How about you? Guild work after the incident must be tough right?] (Youya) [Its really tough. But dont worry, I will do something about it! Its my job after all.] (Phil) After that, the conversation with Phil continued on. Since we were the only people around, we also talked about the incidents and other matters. [Youya. I came here today to explain what happened on the day of the festival, and that I had to give my reply someday.] (Phil) On that day we officially became a couple and I asked her several important questions. [You asked me that if I wanted to go on a journey with you, whether I would be happier being a receptionist or an adventurer with you. Ive thought about my answer carefully since then.] (Phil) [Ah. I did say something like that.] (Youya) [I was in a bind, and constantly worrying about my answer. I want to be with Youya, but I enjoy being a receptionist and helping others. I felt satisfied and fulfilled at my job. But in the end, I feel the happiest is being together with you.] (Phil) [I see. Were still together arent we?] (Youya) I stretched my hand out to Phil. But she didnt take it. [Not now. At the very least, for the time being, not for a while. Thanks to the incident, the guild is in shambles and if Im not here, the guild will eventually crumble and the city will inevitably be doomed.] (Phil) Shes right. It is an important time for Rumberg right now. Itll take time before the guild can restore its credibility. [I cant do something as irresponsible as that. I love the guild and the adventurers here too. Give me two months. No. A month to restore the guild. And once thats done. Ill come for you. So please, wait for me until then.] (Youya) Its going to a little bit lonely since the trip with Phil has been postponed. But Im proud of her answer. She has grown up to be a fine woman who became capable of thinking about others, the guild and the adventurers. There is only one thing I can do. To support her decision. [I understand. Then Ill wait for the day when I can see you once more. Do your best for your own battles.] (Youya) [Of course. Ill definitely return to your side.] (Phil) Phil leaned in and we kissed. Luna raised her fox tail and Til was covering her eyes, watching from the gaps between her fingers. At our level, we are already approaching the limit for the dungeons in the area. We will be leaving the town soon, we will have to separate from Phil. However, Ill wait for the day when we can meet once more. Ive decided to tell her everything on that day. Luna came between me and Phil and began hissing towards Phil. It isnt an act caused by any romantic feelings from Luna. Its just that childs desire to monopolize me. Her actions are definitely weird, Im looking even more forward towards our future reunion. Unable to hold it in, I started laughing. Living the days with futile effort, Ive moved forward without being rewarded for my actions. But it all started to change the day I met Luna. And since then, the fruits of my hard work started to appear one by one. I was finally rewarded. Being rewarded for my efforts felt really sweet. I wish these days would continue on forever. Hi guys! I will be taking a break next week . Volume 2 will start the following week. Meanwhile, I hope you guys enjoyed this series and support the series by purchasing the This website is just a fan translation of the web novels on . If you enjoy my work then please consider heading over to our or support the so that the author will continue to release new chapters for the series! Special Thanks to sfcipher and many others for helping to spot my mistakes. Volume 2 Chapter 0 prologue Volume 2 prologue In this world, something called a Status exists. A persons status is determined by luck. Their stats will increase by a value from 1 to 3 whenever they leveled up. I was unlucky. From the beginning, my stats only increased by one and occasionally two until I was level 50. However, I didnt give up. I continued to train, eventually obtaining other skills and strengths beyond my status. [Munya,muna, youya seconds please!] (Luna) [fufu, its fine to praise me more you know!] (Til) When I woke up in the morning, I was being embraced by two beautiful girls. One of them was a cute fox-girl with fox ears and a fox tail, Luna. She was suffering from amnesia and a girl who I picked up in a dungeon. The other girl is a beautiful Elf, Til. She is a girl who ran away from her village in the forest to become an adventurer. Things happened and she joined my party. Currently, we are in the town of beginning, Rumberg in an inn serving as our base. It sounds great and all. But.. [Luna,Til. Why are the two of you in my bed?] (Youya) I pinched the noses of the sleeping beauties in my bed. After a while, their faces distorted and jumped out of bed. [Youya, Horrible.] (Luna) [You should wake girls up more gently!] (Til0 The two girls woke up with faces of contempt. [I thought that I said no one is to enter my bed when im sleeping?] (Youya) [I was envious of Til and couldnt help it.] (Luna) [Once you get a taste, you cant stop asking for more!] (Til) Both of them gave a ridiculous excuse. During the festival, the two of them were competing to see who could find the most delicious food. Secretly, the two of them made a bet and for some reason I was the prize.The winner, Til asked me to sleep in the same bed with her for one night. I obviously refused, but after she cried claiming that she was lonely after running away from her village, I gave in to her request. [Listen here. Men are dangerous and vulgar creatures. You should be mindful of your own actions.] (Youya) The two girls tilt her head. Til started laughing. [Youya isnt dangerous. I feel safer when clinging to you.] (Til) [Right! And hasnt Youya said it over and over? That Youya isnt a lolicon! So Luna is safe!] (Luna) The two girls were stuck on me in the bed.The two of them were still children around the age of 13 or 14. And I do not feel attraction to children. However, because of their nightwear, it is highly likely to make a mistake at night if I dont watch my own actions. [If I find the two of you in my bed again, expect to eat the daily set meals at the inn. And only the cheapest bread with cheese will be prepared for lunch.] (Youya) [Youya, unfair!] (Luna) [This is blasphemy! I plan to eat all of the delicious things in Rumberg before leaving!] (Til0 Also, the two of them are gluttons. They will only listen to me when their food is at stake. After groaning for a while, the two of them finally let me go. Now that I think about it, how did the two of them sneak into my bed? As a veteran, Ive trained myself to stay aware of the surroundings even when I am sleeping to prevent anything dangerous from happening when Im most vulnerable. [Once you are done eating, head to the courtyard for your training.] (Youya) [Okay.] (Luna) [I understand. Ill do my best!] (Til) The two of them replied obediently. I finally understood how. The two of them dont harbor any ill intent towards me, so I wouldnt notice them when Im asleep. . . . . After completing our morning training, we headed towards the guild.Although statuses existed in this world, it is important not to neglect our training and discipline. Speaking from experience, a persons status isnt everything. Having proper training and a good status has a synergistic effect that improves a persons fighting prowess even further, separating the first and second class adventurers. Having the techniques without the status, or the status without techniques would only get you so far. However, having both would propel you to the top of the bunch. As usual, we headed directly towards Phils desk. Phil is my former party member and Rumbergs number one most popular receptionist. Although her appearance is similar to a beautiful girl in her late teens, her actual age is around the mid-twenties. [Youya, Ive gotten a good quest for you. Its an emergency ingredient collection quest in the seafloor dungeon. The requester is offering three times the market price for the item.] (Phil) [Ah that sounds extremely good. If its the seafloor dungeon, we can earn a lot of exp as well.] (Youya) The target this time is the Long Arm Shrimp which is a shrimp the size of a child. The item requested is the flesh that it drops, Shrimp Meat (Average). It is extremely tasty and easy to collect as one drop is about 2 kilograms. Furthermore, even after 2 months the foods quality doesnt deteriorate, so its often used more as compared to standard shrimps. [That isnt all. After completing the quest, you will be given an invitation for a free meal up to four people at the clients restaurant. It is a shop that specialises in shrimp cuisine, and because their usual supplier ran into a bit of a problem, they are currently in a bit of a pickle.] (Phil) I received the documents from Phil and began checking its content. It is an extremely tempting quest as they are offering three times the market price for 20 Shrimp meat (Average), roughly 40 kilograms. It is quite a large amount but we can manage somehow. [Alright, Ill accept that quest.] (Youya) [The deadline is the day after, please make sure not to fail it, so do your best!] (Phil) [Leave it to me, the guild is in big trouble after all.] (Youya) [Yes. It isnt quite like before the incident, especially since we dont have a guildmaster now. But that is why I have to work twice as hard!] (Phil) Phil is smiling. She has become stronger compared to when I met her for the first time. Right now, the guild is currently in a dangerous situation as the guildmaster himself had initiated an act of terrorism. Although his attempt ended badly, the guilds reputation has been tarnished, and without a leader, the chaos has spread all the way to the adventurers and staff. In the midst of all the chaos, Phil rose up as a leader figure to guide and restore the guild back to its former glory. It is thanks to the her that the guild has managed to recover this much. As an adventurer, I want to do my best to help. To do that, I have to finish this quest as quickly as possible. [Youya, I want to ask a favor from you.] (Phil) [What is it?] (Youya) [About the free invitation, could I come along? Its a high-class restaurant and I want to try it sometime.] (Phil) [Leave it to me. Ill definitely bring you to the store.] (Youya) Phil is embarrassed. Considering her savings that was accumulated from her savings and the reservations, she could easily go to any store that she wanted. She really just wanted to have a meal with me. And I felt the same way. . . . We walked through the magical door and appeared in a dungeon at the ocean floor. It is the dungeon at the bottom of the ocean with a transparent ceiling where many aquatic monsters appear. [Tonight we shall feast!] (Luna) [For that to happen, well have to hunt plenty of shrimp!] (Til) As usual, Lunas excitement can be seen by her vigorous fox tail. Similarly, Tils long ears were twitched form excitement. Rather, they were more excited than ever when they heard about the dinner invitation. Til takes out her quiver and her long bow from the magic bag. [Thank you Lunas Treasure Sense.] (Til) [Luna is on fire, Luna will find plenty of treasure too!] (Luna) Luna is a special Thief who only possesses one offensive skill, Assassinate and poured the rest of her skill points into exploration skills. Thanks to her, we are able to explore the dungeon comfortably. [Youya, Til. An enemy is coming out from that corner. A big shrimp.] (Luna) [About time.] (Til) The first person to react is Til. in one quick movement, she nocked the arrow and drew her bow. The unique trait of an elf, her jade eyes began to glow. A crimson shrimp the side of a human child appeared from the corner. It was a Long Arm Shrimp. The Long Arm Shrimp has a relatively low attack power, however being a crustacean-type monster, it has high defensive power making it a troublesome prey. From a distance about 100 meters away, the monster doesnt even notice the rain of arrows falling down above him. Even with its defensive power, it shouldnt be able to endure more than ten consecutive arrows. With Tils precision, its a ranged attack that can only be done by her. This is the result of being well-versed in archery and training ever since she was a child. [Its just as Youya said. The arrows made by Arrow Generation is getting stronger and stronger! At this rate, what would happen if we were to become level 50!?] (Til) Til was trembling with excitement. Arrow Generation It is an essential skill for all bow users. It consumes a portion of the users mana to create arrows of quality and power proportional to the persons status. With this, even if the store-bought arrows were all used up, the arrows can be replenished easily. In addition, an arrow generated by a level 20 adventurer is stronger than any arrow that can be commercially produced. [Well find out once we hit level 50. Now lets continue. Although Phil told us to clear it by tomorrow, well complete the quest today.] (Youya) [Leave it to Luna! Luna will find many enemies.] (Luna) [Whats wrong Luna?] (Til) [That wall smells of treasure.] (Luna) Looks like we managed to find a chest today as well. My wallet is feeling hungry. [Since its right here, lets find it.] (Youya) Luna and Til are still children, but they are adventurers who have clear strengths and weaknesses. Were progressing fairly well as a party that is only one month old and our earnings are already on par with an intermediate level party. . . . After returning to the guild, we headed towards Phils desk to report the completion of our quest. [I thought that if it was Youya it would be completed by tomorrow.. I cant believe you guys actually completed it within a day.] (Phil) Phil began the completion procedure with an astonished face. [Maa. I used a little trick.] (Youya) Initially, we were hunting as usual when we entered the dungeon. However, it has been a few days since the monster has respawned, so it was difficult to find the target let alone any monster in the dungeon. So after running one round about the dungeon collecting treasure, we did a little cheat. One of the most well-known monsters in the seafloor dungeon was the Hermit Crab. As most adventurers consciously avoid this monster known as the god of death, it was one of the monsters that were still alive in the dungeon. The Hermit Crab has a passive ability as a mid-boss that regularly summon monsters in its vicinity. That was the trick. Normally, it would be a very troublesome ability to defeat, but with Tils long-distance shooting and my Superconductive Bullet, it isnt that difficult to clear the monsters in its surroundings without being swarmed by them. Since the Hermit Crab spawns monsters that appear only in the seafloor dungeon, one of the monsters being summoned was the Long Arm Shrimp. We repeatedly cleared the monsters surrounding it after its ability kicked in, providing a constant supply of monsters and drop items. Doing this, the drop items that appeared stacked up fairly quickly. This was a famous strategy utilized back only in the game era, so it would make sense that adventurers have never thought about abusing the monsters ability. [Now then, heres the reward Youya. When will you be going to the restaurant?] (Phil) [Tonight. Luna and Til have been saying feast,feast feast non-stop since this morning.] (Youya) [Youya, Lets hurry up and feast!] (Luna) [My stomach is already going guruguru!] (Til) Luna and Till came over from behind me. Phil let out a wry smile watching the two children. [I understand. Then Ill quickly finish up my work here. Itll be about an hour so please kill some time at the bar. Luna, Til, Ill pay so order whatever you want at the bar.] (Phil) [Youya, we will go ahead to the bar. Luna wants a parfait!] (Luna) [I want a mixed fruit juice.] (Til) The two of them ran towards the bar in the guild. Watching the two girls enjoy themselves, I couldnt help but let out a smile. Our adventure today also went well. Next week, we will be riding on a caravan to the next town, and well be leaving Rumberg. There is only less than a week before we part ways with Phil. Its a little short but lets try to enjoy our time with Phil as much as possible. That is what I have decided. Volume 2 Chapter 1 [Since its a high-class restaurant, do we have to worry about any dress code?] (Youya) [Dont worry, there isnt any dress code required for the store. Since many adventurers are fairly wealthy, there arent any stores here that impose a dress code.] (Phil) Thats a relief. Although adventurers frequent public stores available to everybody, as a top tier adventurer there are times when you will have to go to a place that requires a dress code. As such, Ive prepared the clothes in my Magic Bag in the event that it is needed. However, I have not prepared clothes for Luna and Til. Even if I did, both of them would definitely be against it. Generally, demi-humans such as a fox-girl and elves both love their freedom and nature and dislike restrictions. [Tonight is a feast! There must be a large chunk of meat!] (Luna) [I hope there are delicious fruits that I have never eaten before.] (Til) Luna and Til kept repeating I want to eat, I want to eat delicious food non-stop. It makes them appear more childish and energetic. Looking at the two of them, Phil and I started feeling awkward. [We have arrived.] (Phil) The name of the shop is Charlotte. From its appearance, it seems to be a high-class and refined store. If there are other upper-class people present, Ill have to ask the two of them to remain quiet. While thinking of this, we entered the store. . . The inside of the store has a calm atmosphere and the furniture is decorated with gold. To complement the atmosphere, a piano is being played live in the store. The store itself oozes elegance and has a nice look. [Well if its a city of adventurers then it should be like this.] (Youya) Although I had somewhat expected it, there were quite a few adventurers being extremely rowdy and ruining the atmosphere of the store. [Does Youya dislike this kind of stores?] (Phil) [I dont particularly hate them. But I do feel that the store is being wasted having this kind of customers despite having such a nice premise.] (Youya) If the mood is going to be destroyed anyway, then there isnt a need to make a mood in the first place. They have the option of having cheaper furnishing instead of putting in futile effort. [Its not like that. For adventurers who have decent earnings, they come to this sort of stores for a change of pace. This store is quite popular among adventurers actually.] (Phil) [Sounds complicated.] (Youya) Truth be told, luxurious shops like this could be a popular store for adventurers. Its a special thing for adventurers to be able to afford this kind of store. [Anyway if a person wants to properly enjoy the mood and the atmosphere, they can go to the second floor if they pay a fee. Many people who know about this often choose to pay the fee. To be honest, it would have been nice if we could go to the second floor but it looks like it has been fully booked.] (Phil) [We did come unexpectedly with the ticket. That cant be helped.] (Youya) It is better for us to remain on the first floor either way. With a noisy atmosphere, Luna and Til get to enjoy themselves fully without bothering anyone. Lets reset and enjoy the food. . . . [Youya, the shrimp meat is delicious!] (Luna) [Its so juicy. And it has a lot of volume!] (Til) Luna and Til ate plenty of food and were thoroughly enjoying the main dish. Tonights main dish is a large piece of shrimp meat cooked over a frying pan similar to steak. The meat was served to us rare and has a sweet taste. Juices flowed out whenever we took a bite. The sauce that came along with it was also delicious. It was a sauce made with eggs, vinegar and oil which fit well with the meat. It is a dish that cant be replicated using ordinary shrimp due to its large mass and volume. [Phil, this store is great. Both the food and alcohol are both first-class. I never thought I would enjoy eating it this much.] (Youya) [Right? It was much better than I imagined. The main dish was very tasty, and so are the appetizers that came before it. I feel ashamed that I have not noticed this store after living here for so long.] (Phil) I tilted the glass towards my mouth and drank the wine. As expected of such a store, its wine is first class. Its rare that I find myself enjoying the alcohol without ordering any ale. Even if I am a fan of ale, I can understand that this wine is of high quality. [Did you enjoy yourselves?] A grey-haired cook with broad shoulders came over to our table. [Yeah. The food here is amazing. Ive travelled all around the world and seen many different shops but not many can compare to it.] (Youya) [Thank you for your kind words. Thanks to your work, the store can continue to serve its signature dish. I am extremely grateful.] (Chef) [Thats just work. Its amazing that you guys are able to sustain having this dish as your main course. There arent many adventurers in Rumberg that actually go to the seafloor dungeon. Even if they did, they are probably preparing themselves to move to another town to continue leveling. It isnt easy to sustain a dish made of Shrimp Meat (Average).] (Youya) The strongest dungeon in Rumberg is the seafloor dungeon. If anyone is able to hunt regularly in that dungeon, it is likely that they will begin to reach a plateau where they cant climb anymore in Rumberg. If they are aiming to further increase their levels, they will most likely travel to another city. [We obtain our supply of shrimp meat from another city where the seaside dungeon is popular. Due to its popularity, the market price for Shrimp Meat (Average) is much lower at that town. Even after factoring in the transportation costs, the total price averages out about the same as purchasing directly from the local marketplace in Rumberg. However, the highway that is typically used was blocked and that route has become impassable, delaying our supply.] (Chef) The highway? If its a town with a popular seaside dungeon, that town is quite close to the next town that I plan on visiting. Something seems suspicious. [The 40 kilos of meat that you requested doesnt seem like itll last very long.] (Youya) Although the meat isnt in any risk of decomposing, the store has a fairly large number of customers. Assuming a single persons portion is about 200 grams, with at least 50 orders a day, the meat would only last about 4 days. [Dont worry about that. We have been informed that the highway will be repaired in three more days. Until then, the meat you delivered will be enough to cover for the time being.] (Chef) [Ah then thats good. I was thinking of coming here again another day but I was afraid that you wouldnt have enough meat for another day.] (Youya) The chef and I laughed together as we continued to chat. [Although I came here because of Richards recommendation, just what is this store? There is more to enjoying a meal than just delicious food! How can someone eat in a zoo just like this?] (???) A man bangs his fists onto the table and leaves his table heading directly to the exit.. Looking at his attire, he looks pretty wealthy. [Please wait a moment! Waiter, Ill leave the payment on the table!] (???) A girl with silver hair bowed towards the waiter before going after the man. She is a elegant girl. Not just by how she conducts herself, but her atmosphere feels very different from an ordinary person. She is probably a noble. While thinking to myself, my eyes crossed paths with hers. After noticing my presence, her eyes grew wide with shock before instantly reverting back to normal. Behind her were two young men who are most likely their bodyguards. Just one look and you can tell that they are professionals at their job. However, that girl is familiar. I cant seem to recall where I last saw her. [Chef, are there too many customers today?] (Youya) [Normally we will recommend those kinds of customers to the second floor, however the second floor is completely booked today. They did receive a warning that it will be noisy having their meals on the first floor, but this is a risk we have to take if we want to do business in Rumberg.] (chef) Just like he said, the chef is calm. It seems like this happens often depending on the business. After that, we continued to chat for awhile. [Youya, I was surprised. Earlier, that girl who left the shop was the Laluzulu Kingdom princess. The man she went after was probably the prime minister of the kingdom. We met them for a quest back then. It looks like they were travelling incognito. I wonder what is going on?] (Phil) [Ah I remember. So shes that princess that we met while travelling together. To think that little princess has grown so big now.] (Youya) We were quite popular as a party back then. Although our party was based in a different town, we were recommended a quest from the Laluzulu Kingdom labeled as an emergency quest. It was a terrible quest where I thought I was seriously going to die. [Youya, our next destination is the town of Greenwood right? Isnt that town part of the Laluzulu Kingdom?] (Til) [Thats the plan. Although it is hard for us to progress at that town, there is something that can only be obtained at that town.] (Youya) [Ahh. Are you still planning to get that? We didnt manage to get that the last time we went right?] (Phil) [Well well manage somehow.] (Youya) Back in the game, there was something called a Magic Pet. Magic Pets were extremely useful as they provided support magic to the party without taking up a slot in the party. The only town where they can be obtained is Greenwood. If its possible, I would like to have one in the party. [If thats the case, itll be nice if you managed to get it.] (Phil) The highway that is blocked is also close to the town. The princess and the minister even came to Rumberg incognito. There is definitely something going on. [Well take care. However, lets leave that talk for later. Lets enjoy ourselves now. I want to properly enjoy my date with Phil.] (Youya) [Its embarrassing if you say it like that.] (Phil) Phil pushed her glasses up in embarrassment. I glanced over to the two girls who were completely engrossed in the food that we ordered. The date for our departure has been set. After completing todays quest, our levels have increased and four days from now, we will be joining the caravan heading towards Greenwood. If we miss this caravan we will have to wait for two weeks for the next caravan. Considering the matter with Leonard, I dont plan to waste a single second. Thus, we will be boarding the caravan four days from now. We will be parting ways with Phil for awhile. That is even more reason for me to enjoy our time together now. . . . We finished our dinner and we left the store. When we were leaving the store, I wanted to stay more was written all over Phils face. Shall I grant her wish? [Luna,Til. Can the two of you return to the inn first? I have something to talk about with Phil about our exploration tomorrow.] (Youya) [Okay.] (Luna) [Fufu. Such an obvious lie. Youya and big sis, do your best!] (Til) [That girl. Just where did she learn about that kind of stuff..] (Phil) [Haha, but this time Im glad for that. Phil. I feel like heading over to your room now.] (Youya) [It cant be help. Since Youya is perverted.] (Phil) Phil linked arms with me happily in contrast with her words. [Soon itll be goodbye with Youya huh.] (Phil) [You plan on finishing the matters with the guild within a month right? You can just hold back until then.] (Youya) [I did say that, but itll be a long and lonely month.. Youya. Us elves dont believe in monogamy but please hold back as much as possible okay?] (Phil) [Its already taking my all to look after those children, I wont have the energy for it.] (Youya) Luna and Til are still children and immature as adventurers. Its taking all my time and energy for me to look after those two. I dont have the leeway to look for other women in the meantime. [Its Luna-chan and Til that Im most afraid of.] (Phil) [They are still children though? Its too early for them to think about love and a partner.] (Youya) [Let me let you in on something good. Listen here. Those girls will mature faster than you expect. Just like I did. Before I knew it, I wasnt viewing Youya as an older brother anymore.] (Phil) Listening to her example I felt my body become heavier. Even if that happened to Phil, it isnt confirmed that the same thing will happen to Luna or Til right? Im sure shes just worried because well be seperated for awhile. [Phil.] (Youya) I grabbed Phil and leaned in for a kiss. A kiss with Phil is always sweet. Lets do more tonight to make her troubles go away. While thinking that, we headed towards her room. Volume 2 Chapter 2 [Youya, Luna enjoyed this town. Leaving it feels a bit lonely.] (Luna) Luna looks reluctant to leave the town. Currently, we are in the caravan preparing to depart from Rumberg. There are many carriages lined up and large numbers of adventurers and merchants are moving about preparing for departure. Caravans are formed when a group of merchants spend a large sum of money to hire escorts while charging other carriages to travel together, forming a journey for a large group of people to travel safely and relatively cheaply between cities. Disregarding towns that are close together, it is dangerous to travel large distances to a distant city without a caravan. Besides monsters, there are many bandits roaming around, especially bandits that have high-level staff within them. [You properly told my big sis about our time of departure right?] (Til) [Yeah I did.] (Youya) [Thats cold of her. Not coming to see off her younger sister and lover.] (Til) [Well the working hours of a receptionist are harsh. It cant be helped.] (Youya) I spent the night at Phils place yesterday. Although she looked fine, she is definitely the one who is feeling the loneliest right now. She was crying when she left for work this morning. She was the one who wanted to stay in the town until the guild recovered, but her loneliness from being reluctant to part ways is a separate issue. [Luna, Til. Its a shame that we wont be able to say goodbye to Phil, but lets get on the carriage. Its about time to leave.] (Youya) [Alright.] (Luna) [Nothing we can do about it. Big sis was always bad at being honest.] (Til) Til had an astonished expression as she got into the carriage. After a few moments, the carriage starts running. It was at that moment. A girl with beautiful golden hair and with pale white skin that started turning red. It was Phil, dressed in her receptionist uniform who rushed over without even changing her clothes. She screamed out. [Truth is I really want to be with Youya forever. I dont want to separate from you. The guild right now is insufficient, but I will spend every second to push forward its recovery so that I can meet you again even earlier! Thats why please wait for me! Also, please remember to send me letters! I will also make sure to reply them. Absolutely will!] (Phil) When we reunited, it felt like Phil had finally become an adult. Her demeanour, her choice of words and control of emotions have became more mature. However, the Phil right now feels much like the one I knew back then. The small Phil who always hid and followed behind me. I let out a small laugh and looked out the window. [Ill be waiting! You better catch up to us! Thank you for supporting us as a receptionist! Thanks to Phil we had a great start as adventurers. But from now, well be counting on you as a companion!] (Youya) Note: it is written as *Nakama* g in the raws. They are still lovers but what Youya meant was as a party member in case anyone is mistaken about their relationship. The carriage began to accelerate and reached a speed where Phil became unable to keep up. Luna and Til also stuck their head out the window to thank Phil. [Also, Youya! Ive always thought that it is unfair of you to always be drinking Tils drop! Please drink my drops as well!] (Phil) Note: Oh gawd this sounds so wrong. Phil threw over a small glass bottle containing Drop of the World Tree. It is a mystical liquid that can stop a human from aging one day by taking in a single drop every morning. It is a liquid that can only be produced by female elves. [Thank you for making this! Phil. Ill be waiting!] (Youya) Phil kept waving her hands until she disappeared in the distance. And this was our departure from Rumberg. . . . The trip to Greenwood is estimated to last about one week. During the trip, we performed physical conditioning during our breaks while spending our time in the carriage by studying in a classroom-format. There are many things that Luna and Til have yet to learn as adventurers. It is important to experience things directly in battle but it is also important to expand your knowledge by studying in a classroom like this. [Lets end todays lesson here.] (Youya) [Youya, todays lesson was fun.] (Luna) [Adventurers have to learn about a lot of different things dont they.] (Til) Luna seems to enjoy the lessons but Til looks exhausted from studying all day. Luna displayed amazing concentration due to her curiosity but Til looks uncomfortable being unable to move her body during the lessons. Therefore, it is more beneficial for her to register the information given in the lessons as if we were having a conversation rather than a lesson. [I think I have taught essentially all the foundations of being an adventurer to the two of you. However, what do you think is the biggest shortcoming of our party? Let me know what the two of you think.] (Youya) After listening to my surprise quiz, the two of them looked at each other with desperate faces and began a discussion. Til was the first to answer my question. [Extremely strong gear! With stronger equipment our hunting efficiency will go up!] (Til) [Having strong gear is definitely important. However, the weapons and equipment that we obtained from the store in Rumberg is already strong enough to be first-class.] (Youya) [Che. Its wrong then. I still dont know what it could be.] (Til) Til began to go into deep thought once more. When I looked towards Luna, her fox ears began twitching and she gave a good answer. [Our party members. Although we can have up to four members, we only have three.] (Luna) Although Luna behaves and thinks like a child, she has an excellent memory and talent. [Correct. Its fine if we are a beginner party, but our party is already approaching the intermediate level. That is why when we arrive at Greenwood, I intend to look for a fourth member for our party. And hopefully it will be someone who can act as a healer. Having a healer in our party is the difference between living and dying. If we dont have a healer in our party, the moment any of us gets injured in the dungeon, we would have to fall back immediately.] (Youya) Most of the enemies that we have faced against have been enemies that were easily defeated, so our problems havent really become an issue but from this point onward the absence of a healer will be noticeable. Since we will be facing powerful enemies in the future, the inability to fight drawn-out battles will become an even larger problem. [Hurray! Correct answer! Youya, praise me.] (Luna) I caught Lunas head and began patting her. Looking at this scene, Til shook her head calmly. [Im against it. Shouldnt our fourth member be my elder sister? We dont need a fourth.] (Til) I smiled wryly. Til is a kind sister who is constantly thinking of her elder sister. [Dont worry about it. There is a certain item that exists which allows us to increase the number of party members by one. We will aim to get one in the future before Phil joins us. However, because both Phil and Til are Spirit Archers, a healer is still essential for our party. Im Phils lover, I am properly thinking about her.] (Youya) [Really? In that case, the next party member should be a man! That way Youya wont be able to cheat on my elder sister.] (Til) [No. The fourth member must be a woman.] (Youya) Mistakes are likely to occur when a party has an equal number of male and females in the dungeon. Furthermore, Luna and Til are beautiful girls who are also young and naive. It is highly likely that depending on the persons personality, they will force or convince them to do something bad. I will absolutely not allow another man to join the party. [Uwahh, Youya is making a scary face.] (Til) [Uhn. This is the first time seeing such a face.] (Luna) [Anyways. The last member will be a woman.] (Youya) That is the line that I draw. As long as Luna and Til are around, we will not have another male party member.. Is what I want to do but with this many restrictions it will be hard to find a fourth party member at Greenwood. Having a healer who is a woman conveniently waiting for us in Greenwood is impossible. However, we will never find one if we dont search for it. I will try my best to find one while we are in Greenwood. I looked out the window at the scenery and took a deep breath. I see, we have already arrived here. I opened the window [Luna,Til, look outside the window.] (Youya) [Look at the greenery!] (Til) [Looks similar to the Elf village!] (Til) The scenery was green all around. The road to Greenwood was made by cutting out a path in the forest. It is a town that is surrounded by a forest and all the dungeons are similar in that they are all integrated with vegetation as well. [Greenwoods dungeons are filled with forests. Normally it will be hard to even walk, but there are even many places for monsters to hide. These two factors make it a very hard dungeon.] (Youya) [That is Lunas specialty!] (Luna) [fufufu. I am an Elf you know. A forest is basically my garden!] (Til) Looks like I didnt need to worry about the two of them. As expected of a fox and an elf. An opening in the forest appeared and beyond that opening, it appeared. A town with a beautiful waterway system, and stone buildings that harmonize with nature appeared. It was the town of green and water, Greenwood, the most beautiful town in the world. [Youya, that town is beautiful.] (Luna) [Uhn. I like the view too. Although it isnt completely natural, the town has adopted a natural look. Its a wonderful city. Im glad that we came here.] (Til) Til was pleased with the aesthetic of the town. [Luna, Til. There is a reason why we are coming to Greenwood. Although it is a simple task for us to raise our levels, our main goal in the town is to obtain something.] (Youya) If our only goal was to raise our level, there are many other towns which has better dungeons for us to level. However, I chose Greenwood as there are other objectives which we have to complete. [Im curious. Tell me.] (Luna) [Uhn. Im curious as well.] (Til) The two girls were staring at me with I want to know written all over their face. There isnt any reason for me to keep it from them any longer. [Its to obtain a Magic Pet for our party. There are special trees in the dungeon here that are called a God Tree. Those trees are the only location where a magic egg can be obtained. In other words, its the only place to obtain a Magic Pet. And this time we will definitely get the egg! ](Youya) [Uhn. Luna wants a pet!] (Luna) [Well have to think of a name from now on!] (Til) The two of them readily agreed with me without even considering that we have not gotten the egg yet. Magic Pets are indeed cute but they are also an important factor in our partys overall strength so I definitely want to get it. However, it is much harder than they think. Only one of the countless God trees in the dungeon will be spawning an egg and the spawn only happens once a year every january. There will only be one egg for countless number of adventurers who desire the same thing. Just by obtaining that one egg, as long as it hatches safely into a Magic Pet, it can be said that the party will effectively have an extra member which provides supportive magic without taking up a slot. This is the reason why even high-level adventurers participate in this once a year event. In order to obtain the egg, we will have to obtain the egg before the rest of the competition. That is why my previous party gave up trying to obtain the egg. However, this time our chances of locating the egg will be almost guaranteed due to Lunas exploration skills and my knowledge of my past life. If we have these two factors, it wont be difficult to obtain the magic egg. We will definitely beat the competition and get the egg. Volume 2 Chapter 3 [The air feels great here.] (Luna) [Uhn. It has the same feeling as the elf village.] (Til) Luna and Til were in high spirits as they entered the town. I understand what they are feeling whenever you enter a foreign town, being unable to control your excitement when experiencing something new. The town has blended perfectly with nature, with waterways filled with clear water running throughout the town and spreading out into the fertile soul in the area. [Has Youya travelled to this town in the past?] (Til) [I didnt but I am familiar with the town.] (Youya) I visited this town as a player back when it was just a game, but I have never visited this town even once as an adventurer. Whenever an adventurer obtains a Magic Pet from one of the God Trees in the dungeon, word gets around very quickly. Back then we had planned to drop by Greenwood after completing the quest at the Laluzulu Kingdom, however there were far too many adventurers competing for the one egg that will l spawn sometime during the month. We couldnt estimate how long it would take us to obtain the egg and in the end, we decided to go to a town with better dungeons rather than Greenwood. [If you are familiar with the town then its fine. Youya, is there an inn with delicious food around here?] (Til) [Yeah yeah itll be great if we could find an inn with delicious food. Itll be quite miserable if their food wasnt good.] (Luna) That is what you are worried about? I smiled bitterly. [Dont worry about that. Phil recommended me a few places, so there is no worry about the accommodation.] (Youya) There are many adventurers from around the world that travel from town to town. More often than not, those adventurers would visit the guild in the town that they visited, and the people who have the most contact with these adventurers are the receptionists. It is easy for Phil to gain information about other towns being a popular receptionist. In addition, Phil is a good cook. She will definitely consider the food when choosing an inn. Even more so when Luna and Til are gluttons. If we stick to Phils advice, we will definitely not be disappointed about the food. Well if we consider the number of inns that are willing to take care of Raptor, the number of inns available becomes limited. Although there hasnt been many opportunities to ride Raptor recently, I just cant bear to let go of a precious buddy. [Youya, lets go. My stomach is growling.] (Luna) [Me too. I want to eat a proper meal. Im sick of hard bread with cheese and preserved meat.] (Til) [Im hungry too. Although the journey with the caravan was safe, the meals were depressing. Since its been a while, lets have a feast to enjoy ourselves.] (Youya) We headed towards the inn for three people. Itll be nice if the inn has nice food. . . . Based on the results, the meal at the inn was delicious. Greenwood is surrounded by fertile soil and nature, the vegetables were delicious as well. Even Luna who typically only eats meat were saying that the vegetables are delicious. The meat here tasted normal, however when eaten with the vegetables, made the meat taste exceptionally good. After placing our belongings in the inn and taking a break, we left the inn. [Having this kind of luxurious adventure, I never would have expected it when I left the village.] (Til) [Was it difficult when you began adventuring Youya?] (Luna) [Ah.When I became an adventurer, I didnt have money for anything, I couldnt afford any weapons not to mention accommodation.] (Youya) I was an orphan that grew up without knowing or meeting my birth parents. Until I was 12, I stayed in an orphanage. Once an orphan became an adult at the age of 12, they would have to leave the orphanage and find a way to survive on their own. Especially for orphans, since it is difficult for us to get a job in the first place, we had no choice but to become an adventurer. [Youya, if you didnt have a weapon how did you defeat monsters? If you didnt go to an inn, where did you sleep?] (Luna) [One way or another. In my case, when I started I used a stone as a weapon. You could throw it or attack them with it. It is surprisingly effective to attack their heads with a rock and it was a convenient weapon as well. Afterwards, when I was exploring a dungeon, I encountered an adventurer who had just died in an encounter and took his equipment and weapons which made hunting easier. For accomodation Well there were several options. Usually I would sneak into the stables to hide from the weather or ask the church for help.] (Youya) Inns in these world were a luxury and was something that only most successful adventurers could afford. If a similar situation were to occur in Japan, it would be similar to travelling around in Japan staying in a hotel everyday. Having a place where its safe with a warm and soft bed to sleep on, Luna and Til who had such things right from the start were blessed. [I didnt know it was like that at all.] (Luna) [You wouldnt know about it unless I told you about it. In order to earn a profit, there are many ways to do it. Back then, it was simply not spending money on accommodations to earn a profit from hunting.] (Youya) In order to earn money, you would have to defeat monsters. To defeat monsters you will need weapons and equipment. To get equipment would require funding, in other words money. The cycle will never start if you had to start from the bottom. To climb out of poverty, I had to abandon the idea of living comfortably and collected money in order to obtain strong equipment. Having such a vicious environment, it is natural that many adventurers will die in the process. [Youya, Luna is embarrassed. I had been enjoying myself and having fun without realising it. I will properly experience what everyone experiences. I will sleep in the stable instead of the inn!] (Luna) [Im glad that you feel that way. But letting a cute girl like you sleep in the stables at night will make me too anxious to sleep at night.] (Youya) Lunas face turned red. [Til, Youya said that Luna was cute.] (Luna) [U~waa, cheating on my big sis you playboy.] (Til) [I didnt mean it that way, if Til were to say the same thing I would give the same reply.] (Youya) [Hurray. Thats mistress number 2! Luna, lets do our best!] (Til) Luna tilted her head. It seems like she doesnt quite understand what Til is talking about. Til is the kind of girl who would often joke about that kind of stuff but is the first one to escape when someone makes a move on her. If the situation permits, I should let her experience whats it like on the receiving end. Its fine if she continues to behave like this when the other party is me, but if she behaves like this towards other adventurers, the outcome may become irreversible. Note: I am unsure about this part, so if anyone can confirm the translation please correct me. Ӥ϶ꉈӤ륿פ Ϥ餫äƤʤ顢һȤϤۤɤۤɤʹĿҊۤ ֤ʤ餤ðߤͬȤ򤷤ȡ귵ĤʤȤˤʤ꤫ͤʤ . . . We finally arrived at the guild. As compared to Rumberg, there werent as many adventurers in the guild but there were still quite a number of people who came for the magic egg. Not only people who wanted it for fighting power, but there were many people who wanted the egg for resale purposes. Frankly speaking, it is much easier to obtain the egg by waiting for someone to sell it on the auction as it fetches a high price. However that wouldnt be interesting, it will be much more interesting if we tried our best to obtain the egg rather than waiting for the easy option. [Luna,Til. Im going to register our party at the counter, both of you head over to the bar to wait for me.] (Youya) There is also a bar in the guild that is perfect for killing time. [Okay. Well wait.] (Luna) [Finish it quickly and come back alright.] (Til) Although we arent obliged to register as an official party, there are many merits to registering as an official party. Completed quests will be shown in the records, making it easier to recommend our party for quests. It is essentially required for us to register whenever we change our base of operations. . . . I arrived at the receptionist desk. The receptionist lady was a woman who looked slightly overweight with an unfriendly attitude and a monotonous tone. I had always been dealing with Phil as my receptionist so having this kind of treatment feels unsatisfactory. [A Magic Knight.. ?] (Receptionist) She had a look of disbelief similar to the other adventurers back when I chose to be a Magic Knight. It wasnt common for anybody to choose Magic Knight as their class in this world. [Ah, but I have been doing a good job. This is a list of the quest I completed in Rumberg.] (Youya) The list was prepared by Phil when she was handling our quests. By going through the procedures, we would be able to bring along our achievements when travelling to a different town. It was a troublesome and time-consuming process, but it will make our lives easier in the future. [I dont believe it. Achieving so much in this short amount of time, its a terrifying pace.] (Receptionist) [Its the truth. It was signed by the guild.] (Youya) [Please excuse my behaviour. I will let you know when an emergency quest comes up.] (Receptionist) [If there is the opportunity, then Ill be the guilds strength.] (Youya) The guilds job is to increase the rate of completed quest to raise their own reputation. Although a receptionists job is to guide adventurers as much as possible, it is also their job to allocate difficult quests to adventurers who are capable of completing them and increase the guilds overall achievements. Well there are also exclusive adventurers like I was, so there is a limit to the quests that they can give to normal adventurers. [Going straight to the point, are there any quests that can be completed by level 25 or below adventurers?] (Youya) Lets have an explosive start for our first day at Greenwood. Ill like to keep our fighting spirits as high as possible until the hunt for the magic egg. . . . There were quite a few decent quests available at the guild. Furthermore, the quests could be completed in the forest dungeon containing the God Trees making it convenient. Truth is, there is a place in the forest of God Trees where a hint can be obtained about which tree will be spawning the magic egg. If possible, I would like to head over there as soon as possible. The quest reward is also quite good. Although we have quite a bit saved up, our money is also being burnt quickly just due to the accommodation. Ill like to earn as much as we can even if its just a little. After completing the procedures, I headed towards the bar in the guild. In the bar, there was a scene about an invitation. [You girls are cute and have a decent level, I will make a special case for you and let you into our party.] (Guy no.1) [You see, we were just in a predicament where we are having trouble having just the two of us in our party.] (Guy no.2) Luna and Til were being given an invitation to join a bunch of intermediate level adventurers in a group called Gala. Such scenes are common in the bar. They said that they only had two people in their party, but it is most likely because the other two had died in the dungeon. They are most likely playing around with their words. However, there arent any adventurers who would join another party just because their numbers fit coincidentally. There is nothing more dangerous than having incompetent party members. [We have Youya in our party, so we decline.] (Luna) [Yeah yeah! Plus you uncles are looking at us with perverted eyes. Its scary you know.] (Til) The two of them strongly refused their invitation, however the two men were persistent. Their ulterior motives were written all over their faces. If they accepted their invitations, they are highly likely to be pinned down instantly the moment they are in an isolated area in the dungeon. Thanks to the nature of the occupation, there are many deplorable men like them. I could understand if it was a beautiful and mature woman, but lusting after Luna and Til who were around 13 and 14 years old is revolting. Just when did adventurers become lolicons? I should step in and prevent the situation from escalating. [Ill have you two stop right there. These two are in my party.] (Youya) [Youya!] (Luna) [You are slow!] (Til) The two girls immediately hid behind my back. They were much more frightened than I thought. Although if it came to ability, the two of them could easily defeat the two of them. Even so, I guess there is the fear present when a girl is confronted by a man. [Ah? Dont interrupt our flirting session old man.] (Guy no.1?) [So this old man is Youya? Get out of here old man. If you arent here we have a perfect party of four. Its a good idea isnt it? Get out of the party old man.] (Guy no.2) The two of them laughed heartily and reek of alcohol. I could just let them off with a warning, but if words wont get through to them. Ill have to resort to force. [I will not be letting go of these kids. They are my precious companions. If you are adventurers, then Im sure you understand that we wont let our friends go that easily.] (Youya) [We understand you old man!] (Guy no.1) Its settled, Ill beat them into submission. I could easily dodge their punches but its more convenient for me to beat them up if they were the ones who attacked first. I can take any abuse, whether physical or verbal towards myself, and laugh about it afterwards. This hasnt changed ever since I was born. However, they frightened Luna and Til, and that cant be forgiven. They will receive their just rewards. When his fists approaches my cheek, I twist my neck reducing the impact from his fist and guiding his fist past my cheek. A solid impact could be heard. It looked like a direct hit but there was almost no damage taken. With this, I have a legitimate excuse for defending myself. Now its time for punishment. The moment I thought about counterattacking, the atmosphere in the bar became several degrees colder from blood lust. Someones fist struck the mans solar plexus, blowing him away and knocking away several tables behind him into the wall. The man began coughing blood as his eyes turned white. It was a perfect hit and the ringing belonging to a critical hit could be heard. Following the source of the sound, I saw Luna clenching her fist. I hadnt taught Luna how to battle without a dagger yet so I was surprised that she could throw such a punch. [You hurt Lunas Youya. Luna wont forgive you.] (Luna) [eeek.] (Guy no.2) The other man lets out a pitiful scream while Lunas eyes were filled with blood lust. At this rate, she will seriously kill him. I let out a bitter smile and pat her head. [Calm down. Im fine. Theres no reason for me to take that blow head on, I had properly deflected the blow.] (Youya) [Youya!] (Luna) Luna jumped into my chest thinking that I was seriously injured from the guys punch. [Our Luna seems to have gone too far, but you guys were the ones who decided to pick a fight so were even. However, if youre up to it, we could continue the fight.] (Youya) I started talking to the mans companion and it seems that he was extremely unsettled by the situation, but he seems to understand my words. [Aaa,ah.] (Guy no.2) [There was a horrible cracking sound from your friend, be sure to take him to the hospital.] (Youya) After getting frightened by Luna, the man carried his friend who passed out and left the guild. [Looks like we got involved with a bunch of weird men. Lets forget about it and head to the dungeon. We can still become much stronger.] (Youya) [Uhn. Leave it to me! Somehow it felt like I managed to do a critical with that blow.] (Luna) Luna was able to land a critical blow using her fists without any training. It looks like Luna has managed to learn the fundamentals of basic martial arts or something equivalent. [That is amazing. Lets enter the dungeon with Luna as the main attacker! Be sure to remember how that critical felt.] (Youya) [Im super ready, lets go!] (Luna) It was unfortunate that we got caught up in the situation earlier, however since Luna benefitted from that skirmish, it should be fine. [Also, thanks for being angry for me.] (Youya) [Uhn. Of course. Luna likes Youya after all!.] (Luna) Luna proudly puffed up her chest and her fox tail was shaking vigorously from being praised. Her attitude was so amusing I couldnt help but laugh. Putting the incident behind us, lets make our first hunt in Greenwood a successful one to remember. Then we can prepare for the real competition to obtain the egg and gain information about the eggs spawn. Volume 2 Chapter 4 There are two reasons why we came to this dungeon. First would be to collect Pork (Average) for a quest that we accepted. Pork (Average) can be obtained by defeating the Horned Boars that can be commonly found in this forest. Second, we have to look for any hints or information about the spawn location of the Magic Egg. Sometime this month, out of the numerous God Trees present in this forest, only one of them will spawn the Magic Egg. Back in the game era, we had to battle against a party of 5 non player characters (NPCs) in order to obtain the hint, but it was still possible to obtain the egg without a hint. However, the scale this time is much different. There are at least 50 other parties competing for the egg, with over 200 opponents. We wont be able to guarantee our victory without having any advantage over that number of opponents, at least not without knowing which tree out of the hundreds that will spawn an egg. Especially when there are adventurers who have been here numerous times to obtain the egg. Those adventurers are likely able to grasp when the egg will spawn based on their past experiences. We could obtain information from them by eavesdropping on their conversations, however that information could be unreliable to throw off any other potential competitors that they are expecting to be listening. Thus, it is more reliable to obtain information on our own. From the beginning, if you are capable enough, you will be able to obtain information about the spawn without leaking any information. In the location where you can obtain this information, the monsters provide a decent amount of experience points and have valuable drop items and equipment as well, making it an extremely efficient place to train and hunt. . . . [Youya, there are so many people here.] (Luna) [Ugh, at this rate there wont be any prey for us.] (Til) There were many people in the forest of God Trees who were frantically looking around for the Magic Egg. Only a handful of adventurers can estimate the day when the Magic Egg will spawn, however other clueless adventurers are desperately searching and investigating each God Tree hoping to find some signs that could lead them to the egg. In addition, many of these adventurers are hunting monsters while searching for the egg. As a result, the number monsters in the dungeon were rapidly dwindling. The quest was probably issued around this period knowing that drop items would be easily available due to the large number of adventurers hunting. [Its alright. There is a place where a lot of monsters are still around.] (Youya) If you were a perfectly sane person, it is a place where you will never enter. Unless you are attempting suicide, that place is a perfect location to hunt monsters in the current season. It is also the place where it is possible to get information about the magic egg spawn. We would be able to raise our level, complete the quest while obtaining information about the egg. We would be able to kill three birds with one stone. [Amazing, Youya. Lets hurry up and head there!] (Luna) [Thats right. We wont be able to make a decent hunt in this kind of place.] (Til) [Ah, youre right.] (Youya) I smiled bitterly at their responses. If the two of them knew what the entrance to the location was, the two of them would definitely be filled with terror. At that moment, we could hear whispering among the other adventurers, and the chance for our hunt to start had appeared. The surrounding adventurers began to scream. [Uwaaaaaaaaa, Its here, the devourer of the forest.] [Run away!] [Its a God Tree! Run to the God Trees! Its the only thing that it will not eat!] The ground began to tremor as it appeared. A giant caterpillar with a body length of about 30 metres. Its main body is divided into around ten segments covered with a green-coloured shell resembling the larva of a citrus swallowtail butterfly. Its body was covered with a pattern resembling a large eye that looks poisonous and inflicts fear into anyone that looks into it. Its legs arent visible so its uncertain how it is moving, but based on the vibrations of the ground, it is likely that there are multiple small legs carrying its large body. However, what makes it even more terrifying is its large mouth. Its mouth was capable of reaching from one God Tree to another, swallowing everything in its path. Whether it was the earth, monsters or mere stone, nothing was spared. It was the monster unique to the Forest of God Trees, the Starfish Larvae. It is a symbiote of the God Trees that devours everything around the God Trees. Note: I dont understand its name nor can I find out through the dictionary so Im going with google translate on this one. In this world, it was thought that nothing couldnt be defeated. There were twenty pairs of level 50 adventurers who attempted to defeat the Starfish Larvae and after a close battle, with only 5 survivors, they managed to defeat it. Normally, defeating powerful monsters would yield strong materials and amazing drop items. I can understand their sentiments of wanting to defeat the monster as it isnt easy to encounter this level of monster often. After they defeated the monster, apparently there were many drop items that could had fetched a high price. There were materials made of its outer shell and eye that could be used to make powerful equipment. In addition, there were rare magic swords and magic armors that were dropped. It isnt an understatement to say that the quality of drop items was very high. However, the rewards for defeating the monster wasnt worth the effort to defeat it. The price for defeating the monster was the lives of 35 first-class adventurers. There isnt any treasure that could be worth that sacrifice. Furthermore, the battle didnt end there. After the Starfish Larvae was defeated, its green shell began turning red, its eyes shifted upwards, appearing to grow larger and more violent. As if it was enraged, the monster began rampaging throughout the dungeon for an entire week. The dungeon became uninhabitable until its rampage was over and no one could enter the dungeon. Surprisingly, at the end of the week it returned to the typical Starfish Larvae and it became possible to return to the forest of God Trees. If the normal Starfish Larvae could drop such high-quality items, there is the possibility that the enraged Starfish Larvae would drop even better items. There are even rumors spreading that there are special benefits that can be obtained for the Tower of Trials by defeating the enraged Starfish Larvae. However, the rumor was never confirmed as no one was willing to test it. There were no adventurers insane enough to attempt to defeat the enraged Starfish Larvae. Since I possessed the knowledge of the game in my previous life, I can remember clearly what were the rewards gained by defeating the enraged Starfish Larvae. The rewards were as amazing as the rumors put it out to be, however just like the first battle, the compensation for defeating the monster was massive as well. Back then, the entire party could easily be revived so there were no actual casualties. However, attempting it now would merely be suicide. It was common to revive and retry the battle multiple times until it was defeated. That was how powerful the enraged Starfish Larvae was. It is a simple task to escape from the normal Starfish Larvae. So long as they arent coerced into their enraged state, they have the characteristic of never harming the God Trees, making it easy for people to stick to the trees in order to escape from the monster. [Uwaaa, it looks disgusting.] (Til) [Youya. Cant stop trembling.. Its too strong,] (Luna) Although their responses are slightly different, both of them feared the Starfish Larvae albeit for different reasons. That is troubling as it is the key for us to enter the hunting ground. [Both of you follow closely behind me.] (Youya) [Youya, wait a moment. You are walking in the direction of the bug.] (Luna) [Youll get eaten!] (Til) Although the two of them often followed my instructions silently, the two of them voiced out their opinions this time, telling me to stop. [Of course Ill get eaten. The reason I came here was to be eaten by that thing. Truth is, its stomach is the best hunting ground in this entire dungeon. Plus there are many treasures as well. I understand that both of you are scared, but if you dont want to enter then the two of you can head back to the inn.] (Youya) I laughed as I stood in front of the insect. After a few moments, Luna came up to my side. [Luna will always be with Youya. That is why Luna believes in Youya.] (Luna) Although she said some brave words, her tail was trembling to the maximum. I guess its that terrifying for her. [It cant be help. Ill come too. Because Youya said so, then even if I think its impossible Ill follow you.] (Til) Til walked to my side. Although she laughed and appeared to be brave, both her voice and her legs were trembling. [Both of you, thank you for believing in me. Tonights dinner will be on me, so you two can order whatever you like.] (Youya) Normally the two of them would be jumping in joy to my words, however the two of them dont have the strength to do so right now. The tremors became stronger as the Starfish Larvae approached closer and closer until it was directly in front of us. Looking at it up close, a monster 30 metres in length is impressive. Luna and my right and Til on my left, I could feel their entire bodies trembling as they clung tightly onto my arms. Its mouth was open as it moved forward, eating everything in its path. It was large enough to be capable of swallowing the three of us whole. And finally, it ate us. [uhn!? AAAAAAAAAA] (Luna) [KYAAAAAAAAAAAAAAAA] (Til) Luna and Til who were holding tightly onto me closed their eyes and began screaming as we got swallowed by the Starfish Larvae. And our surroundings faded to darkness. . . . I opened my eyes and my surroundings were covered in darkness. [Where is this place? Is this heaven? Youya, I cant see anything.] (Luna) [Uggg, are we dead? I wish I could had the courage to experience my first time before dying.] (Til) Luna and Til were clinging onto me while saying ridiculous things. I took out a light crystal from the hidden room out of my magic bag and tied it onto my forehead with a string. Unlike a normal torch, it doesnt run out. It was very bright and lit up quite a large area around us plus it was safe to touch. Back then, I thought that it would be very useful when traversing in dungeons underground and only took five of them. It wasnt possible to take the light crystals back in the game, but Im glad that it was possible to be used this way so Ill show my appreciation. [It isnt anything like heaven. This is the Starfish Larvaes stomach. Its stomach is actually in a different dimension. Take a look at our surroundings.] (Youya) With the light crystal illuminating our surroundings, we were inside a labyrinth with stone walls all around us. The road was about 5 metres wide and the end could not be seen. Although the Starfish Larvae is a large monster about 30 metres long, it is impossible for the labyrinth to fit within its body. The entrance to the hidden dungeon was the mouth of the Starfish Larvae. As a matter of fact, the Starfish Larvae isnt considered a monster but a biological weapon created by God. Passing through its mouth transfers you to a different dimension. This fact wouldnt be discovered by any ordinary adventurer in the first place. Anyway, there isnt any reason for anyone to risk their life and it was easy to avoid getting eaten by the Starfish Larvae by sticking onto the God Tree. If there was anything that is considered a trap in this dungeon, it would be getting eaten by the Starfish Larvae when it is enraged as you wouldnt be transported into this dungeon and will be sent directly to its stomach instead. Luna and Til looked around the surroundings illuminated by the light crystal. [Uwa, a gigantic maze.] (Luna) [This is the place Youya is talking about right?] (Til) [Youya, there are many signs of monsters around us. Goblins, wild boars and insects.] (Luna) [Any monsters that are eaten by him will also be sent to this dungeon. We will hunt the monsters here as he eats every monster in the dungeon.] (Youya) For adventurers in the forest of God Trees, it is a competition to see who will be able to hunt the most prey in a short amount of time. However, if you are able to enter this hidden dungeon, you will be able to hunt to your hearts content. [But Youya, how are we supposed to get out of here?] (Luna) [There are two ways. First is to use a return stone, although that is a waste of a return stone. Second is to conquer this labyrinth. At the end of the maze, there is a magical vortex that brings us to the exit of the dungeon.] (Youya) [In that case, there is only one answer! We will defeat the monsters here and get a ton of materials while searching for the exit!] (Til) [That is so. Although we have the light crystal, the visibility in this area is still terrible so lets progress with caution.] (Youya) [Uhn. I understand!] (Luna) [Fufufu. Dont underestimate the power of an elfs jade eyes! My jade eyes can see even in complete darkness!] (Til) [Oh thats right. Phil was the same way as well. That is enviable] (Youya) The jade eyes that have the ability to see long distances, night vision and clairvoyance that every adventurer envies. [Lets hurry up and clear the labyrinth. There is a curse placed onto this maze where our bodies will steadily become heavier the longer we stay here. The curse will only activate after half a day and walking will become difficult after a day. Eventually, we wont be able to move and we will likely die after three days. This is the reason why the information present here is hidden from the public as many people often lose their lives before they managed to escape the maze.] (Youya) Their bodies froze up after listening to my warning. Not only is it difficult for adventurers to discover that the entrance of the dungeon was the Starfish Larvaes mouth, but it is difficult for them to even escape the dungeon to let this information be known. Many adventurers who have entered this dungeon have not lived to tell the tale. A labyrinth within complete darkness with a complex maze to conquer. In the first place, it is difficult to even walk around in this darkness. Above that, there are many monsters present in this dungeon that are capable of detecting our location through sound and their sense of smell, making it difficult for normal adventurers to fight an unfavourable battle where they are robbed of their sight. To sum everything up, people who have been eaten by the Starfish Larvae will find themselves teleported into complete darkness, while those who somehow have a light source with them will have a higher chance of surviving the dungeon. However, only those who are lucky enough to have the rare and expensive Return Stone will be able to live. Other than them, the others are likely to perish in this dungeon due to the curse. In our case, we came prepared knowing the mechanics of the dungeon and how to enter the dungeon. For us who know about the curse and environment of the dungeon, and are able to prepare for it, this dungeon will turn into a delicious dungeon with plenty of monsters for us to hunt. Aside from monsters, there are also many treasure chests as well as the gear from dead adventurers present, making it a very profitable dungeon. As a reward for clearing this difficult dungeon, there will always be a stone monument before the exit which provides information about where and when the egg will spawn. [Luna, Til. There isnt a dungeon that gets any better than this! Lets enjoy the hunt to the fullest and enjoy a feast tonight!] (Youya) Now, lets raise our spirits and break through this difficult dungeon. Lets aim to cover enough distance before we become too immobile to exit. Otherwise, well have to use our Return Stones. Volume 2 Chapter 5 Even a first-rate party will take at least six hours to clear the dungeon. For our current party, we should be able to clear the dungeon within 10 hours, if there arent any unexpected incidents. Lunas fox ears began twitching and her movements changed. [Youya, I can sense a monster at the turn ahead. Feels like a boar monster.] (Luna) Looks like we found our prey right from the get go. Its time to hunt. [Is the prey asleep? If its asleep then Luna will go alone. Erase your presence and approach it cautiously without waking him up. Usually all boar-type monsters have a weak point between their brows.] (Youya) [Leave it to Luna. Luna will go now!] (Luna) Luna began to run towards the target. Although she was running on the stone pavement in an enclosed area, I couldnt hear any sound at all. Her unique trait as a fox allows her to land softly on the ground while running, producing no sound at all. This was a demonstration of her talent at work Luna did not bring along a light crystal with her as she is able to detect the monsters location and the surroundings with Presence Detection, akin to having a radar of the surroundings within her head. That is why she is able to locate the monster without a light source. It was also easier for her to land a surprise attack. I heard a ringing sound unique to landing a critical hit and Luna came back. It seems that it was successful. [Youya, the drop item is a meat. Pork (Average)] (Luna) [Well done, its an item that we need for our quest. Now, lets continue.] (Youya) [Uhn. Luna will continue to assassin!] (Luna) That is a good sign for our start. Lets continue on at this pace. . . . From that point onwards, Luna and Til both played an active role to our success as they were not affected by the darkness in the labyrinth. For Luna who is able to sense her surroundings with Presence Detection and Til who possessed the jade eyes unique to elves, the dark surroundings was actually advantageous to them. Thanks to that, I didnt have a chance to participate at all. [Youya,Til. A herd of boars are coming over here! We cant see them because its dark but they are extremely close.] (Luna) [Ah. If its a group of them my bow wont be that useful.] (Til) Til began chanting after Lunas warning was issued. A couple of seconds later, a herd of wild boars appeared in front of us. Til fired arrows at the herd while continuing her chant. Thanks to the special ability of the class exclusive to elves, she is able to fire arrows while simultaneously chanting a spell, allowing her to have twice the firepower of a standard class. After several tens of seconds, Til completed her chant and casted the advanced magic Heavenly Thunder, the only area of attack spell that our party had. Numerous lightning bolts descended onto the herd, striking the entire herd altogether. [[GAGUUUUU]] The electrified wild boars screamed as the lightning bolts struck. However, the monsters here were around level 25, it wasnt a level where they would be taken out by attack. Those that were damaged beforehand by Tils arrows collapsed, however those that were still alive were placed under paralysis from the lightning bolts. While they had their movements sealed, arrows flew towards them. However there were still many of them alive and it is impossible for us to handle all of them with just Tils arrows. Some of them who had their paralysis wear off began charging towards Til. Luna and I intercepted the charging boars. [Bash.] (Youya) [Assassinate.] (Luna) Bash is a skill that doesnt have any special effects but it has a high attacking power with efficient fuel consumption while Luna released Assassinate which has a high attack power when landing a critical hit. Similarly, both of us landed attacks onto the weak point of the Horned Boars between its eyebrows, releasing a ringing sound. After finishing off one boar, we quickly moved on to the next. Thanks to the damage taken from Tils ranged attacks, we were able to defeat each of them with a single blow. Shortly after, the entire herd was annihilated. [We did it! We have plenty of meat!] (Luna) [Fufufu. Youya, its fine to praise me you know! After all I was almost able to defeat all of them by myself!] (Til) With high spirits, Luna and Til ran towards the herd of Horned Boars to pick up the Pork (Average) dropped around everywhere, placing them inside their magic bags. Looking at the ground in front of them, I felt cold sweat flowing down my back. [Dont move!!] (Youya) I shouted at the top of my lungs, however they were slow in reacting due to their excitement from the recent victory. If this goes on. [Haah!] (Youya) I pushed opened the door and my body was covered in the white aura. I focused the white aura around my body onto my legs and stepped in using the high-speed movement skill Ground Shrink, grabbing their collars and throwing them behind me. Luna and Til landed on ground with a loud slam as I couldnt afford to spend any time to soften their landing. After confirming their safety, I closed the door and the white aura dissipates. I cant afford to leave the door open for too long and risk losing my stamina here. [Youya, it hurts.] (Luna) [Ugh, I think my butt is swollen.] (Til) The two of them stared at me grudgingly. [I apologise, but I had not choice. Take a look.] (Youya) I picked up the body of a Horned Boar that was on the verge of death and threw it onto the floor ahead of us which had a slightly different colour. The ground opened up and the dying boar fell through the hole. After awhile, the sound of fleshing being pierced could be heard. Luna and Til peeked into the pitfall. At the bottom of the pitfall, spears were lined up with the Horned Boar pierced between several spears. [This pitfall was designed to work against adventurers. If the weight above the trap is too heavy or too light it wont activate. Earlier, the herd of boars were too heavy and the trap didnt activate, but under both of your weights the trap will definitely activate. The two of you should have the mentality that every labyrinth-type dungeons will have a trap.] (Youya) It is commonly known that labyrinth-type dungeons have traps that are targeted specifically at adventurers, however it seems that the two of them made the rookie mistake of advancing forward without caution due to their excitement. There werent many traps present in the beginner dungeons at Rumberg, but there will be many more traps present in dungeons once you hit the intermediate level. Although, placing such a trap in a dungeon with low visibility is just bad taste. This is the reason why the survival rate of adventurers in the Starfish Larvae is so low. [That was close. If we fell then Luna would had died.] (Luna) [Uwah. What is this? Its so scary.] (Til) Both of their faces turned blue and the ground in front of us rumbled before closing again. [Youya, the battle earlier raised our levels and there are skill points. Trap Detection was also unlocked. Im scared.] (Luna) [No, its okay not to level it. It is definitely convenient to learn Trap Detection, however it is possible to notice traps in the dungeon just by looking at the surroundings. You should focus your points onto other skills. Ill teach you the method to find traps so that you do not rely on skills to detect traps.] (Youya) [I understand. Please teach Luna how to do it.] (Luna) For hidden treasure chests, there might not be any hints about their location, however for traps there is always a way to notice where they are. If it is only possible to detect traps by having the necessary exploration skills, then it would be impossible to clear dungeons safely without inviting a specialised class into the party. That would just be a horrible game design, and all game producers and players would know it. Therefore, it was made so that it was possible to clear dungeons even without exploration skills. The variety of exploration skills a Thief possesses is huge. If possible I would like to avoid wasting skill points onto skills that can be supplemented by experience. Example of skills that cant be supplemented are Increased Drop rate and Summon Rate. Note: I am unsure about Summon Rate so Ill just leave it as that. If the skill comes up again Ill rethink its name. As we progressed deeper into the labyrinth, I explained the different commonly used traps as well as the way to disable them to Luna and Til. Although [Why are the two of you clinging onto my back? You two are making it hard to move.] (Youya) [But its scary to walk ahead of Youya!.] (Til) [Uhn. Youya continue walking forward. Luna doesnt know about the traps.] (Luna) The two of them seem to be significantly affected by the earlier incident. [Only for today. However, if we come across a trap I will show you how to distinguish and disable them. Next time the two of you will be the ones identifying the traps.] (Youya) The two of them nodded. Now then, lets continue to collect plenty of meat for today. Thanks to the herd of Horned Boars, we have gotten one step further as an adventurer. . . . We continued to encounter multiple monsters as we ventured deeper into the labyrinth. We have had countless battles ever since we encountered the herd of Horned Boars as there were countless swarms of monsters in this labyrinth. To have this large number of monsters for us to hunt without encountering any other adventurer is a luxury that other adventurers may never experience. Til shot an arrow towards the monster approaching us from the front, however the arrow was off-target. It was a first time for me to see Til miss an arrow. It is a bipedal monster that gives off an extremely unpleasant vibe, a Puncher Bamboon. Luna ran towards the front, releasing Assassinate as usual, piercing the Puncher Bamboons stomach, however there wasnt any ringing sound released. Her attack was no different from an ordinary attack. The Puncher Bamboon didnt falter despite directly receiving Lunas attack and attacked Luna with a right hook on the side of her head, blowing her small body away. [] (Youya) [These girls havent had much experience being driven back by a monster. As expected when being mentally cornered they wouldnt last very long.] (Youya) I stepped forward towards the Puncher Bamboon and it threw a left jab in retaliation. I twisted my head, dodging the jab while slashing the tendon in its arm. It screamed in pain after getting its arm slashed. While it recoiled from our exchange, I closed the distance and released a thrust towards its heart. The critical ring can be heard as the Puncher Bamboon collapses and turns into blue particles. [Luna, Til. Are the two of you at your limit?] (Youya) [Not yet. I can do it.] (Luna) [It was just a fluke. I will hit the next one.] (Til) Even though they are hiding it, they have clearly reached their limits. Asking for anymore than this is unreasonable. The near-death experience from the trap earlier must have activated the adrenaline in their body, causing their senses to be heightened from fear. Having their senses heightened will cause their fatigue to accumulate constantly without them noticing it, and that causes your legs to weaken even quicker. Although its been a while since weve entered the labyrinth, we havent arrived at the exit and since its already been more than half a day, the curse has already kicked in. Our bodies are feeling much heavier to the point that it doesnt feel like our own bodies. Receiving a one-two punch from the combination of fatigue and the curse, it is difficult for the two of them to exert their usual abilities. [In that case, lets continue to push onwards towards the exit. Lets aim to reach the exit by half an hour.] (Youya) Lacking the energy to reply, the two of them nodded. This will be a good experience. For them to train both their spirits and bodies, it is necessary for them to push themselves beyond their limit. This whole time, they have been thriving under my lead and I wasnt able to let them experience any true hardships. This is a once in a lifetime opportunity, lets utilize this opportunity as much as possible and explore as much as possible. Luna raised her face and shouts desperately. [Youya, its a super strong spider! Its coming close really quickly. Above. The ceiling!] (Luna) Luna desperately sent a message despite her fatigue about a powerful spider. I have an idea of what monster that spider might be. In the forest of God Trees, there was a powerful spider whose favourite food was human flesh, the Hunting Spider. The threads it produces can not be cut by ordinary swords and anyone who touches it will be inflicted with paralysis. When it is hungry, it would consume its defeated prey on the spot and when it isnt, it would wrap its prey in its paralyzing threads and carry it to its nest to store it for another meal. It is a terrifying experience to be caught by it as you will be restrained by its paralyzing threads, making it impossible to recover from the paralysis naturally, waiting to be devoured. The forest of God Trees has a recommended level of 25, however the Hunting Spiders strength is equivalent to a monster at level 30. Many adventurers have been killed by this monster after underestimating its strength. The next moment, It finally appeared. If Luna hadnt warned us about its presence, I would not had noticed it. It was moving silently on the ceiling. Then, it stuck the thread from its rear onto the ceiling. I actually wanted Luna and Til to experience a difficult battle like this but right now, I cant expect them to do such a thing. Relying on my intuition, I threw my sword towards its threads without looking at it, severing its thread with my trusty enchanted longsword. Having its thread severed unexpectedly, the Hunting Spider landed on his head, leaving a large opening. [Napalm Strike.] (Youya) I aimed my glowing hand at its head. We didnt have the leeway to prolong this battle. There is always the chance we may get defeated if we do not defeat it immediately. The weak point of the Hunting Spider is its head and it is weak to the Fire element. It would definitely be killed if it received a super high power fire magic onto its weak point. The palm of my hand landed on its head, causing his head to blow up with flames. However, even if its head is gone, its body will still be able to move for a short time. In order to prevent any accidents, I took out my second blade, the black magical blade and pierced its body before it finally stopped moving. [Thanks to Lunas warning I managed to notice it on the ceiling. Thanks Luna.] (Youya) [Dont need to thank me. Luna could only notice it.] (Luna) The Hunting Spiders body disintegrates into blue particles. The items that were dropped are its evil-looking eyes and its thread, which are useful items that can be used in alchemy. And also.. [This isnt an item is it?] (Til) There were cocoons left on the ground. The Hunting Spider was probably on its way back to its nest as it often wraps its prey on its back on the way to the nest. It is difficult to tell if the people were already caught by the spider before it got eaten by the Starfish Larvae or the people were caught while wandering around the labyrinth after getting eaten. Regardless, I put on a pair of leather gloves so that I wouldnt be affected by the paralysis threads and cut open the cocoons. Two of the men inside the cocoons were already dead. Their skins were as black as charcoal probably due to the curse of the labyrinth taking effect. The hunting spider does not kill its prey who were caught in its cocoons,thus its highly likely that the cause of death was the curse of the labyrinth. The two victims appear to be intermediate adventurers with decent equipment and items. I took their equipments gratefully and opened the last cocoon at gasped at the third victim. [Is it, the princess..?] (Youya) [Youya, she is extremely pretty.] (Luna) [Amazing, its a beautiful lady. However, she looks a little bit black.] (Til) We were unexpectedly reunited with the silver-haired princess that we saw at the restaurant in Rumberg. The princess of the Laluzulu Kingdom was also eaten by the Starfish Larvae. Why did a princess come all the way to the forest of God Trees? Wasnt she supposed to have an escort? How did she end up getting eaten by the Starfish Larvae? There are still many questions left unanswered. This incident reeks of conspiracy. Most likely, we will be caught up in a complicated situation if we rescue her. However, Im not heartless enough to leave her in the dungeon just because of that. Besides, I made a promise to her back when I last saw her during the quest and I intend to keep it. I carried her with my body that became heavy from the curse. [I cant let her die here. Lets carry her and get her out of here.] (Youya) During the recommended quest at the Laluzulu kingdom, I was asked to be her bodyguard. It was back then when I made the promise. I had forgotten about it, but now I remember. That is why I will save her. Her body is already turning black due to the curse. At this rate, she will lose her life in about three hours. We have until then to conquer this labyrinth. [Luna,Til. Lets hurry. Were almost to the exit. Give it your all!] (Youya) [Uhn. Well try our best!] (Luna) [Awawa, its a bit difficult but I can still do a little more!] (Til) Our aim is the exit. Worst case scenario we will have the three of them use the Return Stones to go back to the town except for me. While I was thinking about our options, I placed more strength into my legs to go forward Volume 2 Chapter 6 [Youya, theres the blue vortex. Now we can go home!] (Luna) [It was really exhausting. In the first place, it was too difficult to move around in the maze. My body feels too heavy.] (Til) [Im hungry. My whole body is sticky from sweat.] (Luna) [Un un. I cant wait to return to the inn to wash up, change my clothes and enjoy a nice fruit juice at the bar!] (Til) [So long as we get out of here Im happy. Youya, lets hurry up and leave!] (Luna) The two girls spirits seem to be lifted after arriving at the exit. They became light on their feet and the smiles return to their faces. It seems that I had more leeway than I thought. If I had known about it, I would had taken a different turn to increase the amount of time spent in the labyrinth intentionally. However ending the adventure like this is fine too, the two of them have already gotten plenty of experience in the labyrinth today. [Has the princess woken up yet?] (Luna) Understandably, the princess who was sleeping on my back hadnt woken up yet. Although we had fed her an antidote for the paralysis, she has suffered from starvation as well as the curse of the labyrinth for a long period of time. She also has a horrible smell from being encased in that cocoon all this time. However that cant be helped either. Well have to return to the inn and clean her up afterwards. More than the smell she had, there was something else I was worry about. Initially, I considered the possibility that the two adventurers who we found together with the princess were her bodyguards. However, the progression of the curse on their bodies didnt match. That meant that the timing they had entered the labyrinth were different. Those adventurers were definitely just normal adventurers who got caught in the labyrinth. It is more likely that the bodyguards might have abandoned the princess after the Starfish Larvae appeared, whether intentional or not. When this possibility came to my mind, the smell of trouble seems to become even thicker. Luna and Til who were excited to return looked at me and repeatedly asked me to exit the labyrinth. Regrettably for them, we cant do that yet. [Wait a moment. There is still something we have to do. Before we leave the labyrinth there should be a stone monument nearby. On that stone monument there will be a hint about where the magic egg will spawn. [You mean this? It doesnt look like theres anything important on it.] (Luna) [Right? It looks like a normal star chart] (Til) [Well, I kind of expected that it looks like that.] (Youya) I smiled bitterly as I put the princess on the ground, and took out a bunch of writing materials from my magic bag. Near the blue vortex, there is a stone monument about twice my height. On the monument, there are numerous stars drawn but only one star looked like a red jewel and shone brightly. Even if a person somehow saw something valuable, if that person doesnt understand the value of the object, then it might as well not be valuable at all. Each of the stars on the monument actually represents a God Tree within the forest. This chart displays the arrangement of the hundreds of God Trees inside the forest and only one star is accompanied by a red jewel. The red jewel represents the magic egg. However, with just this monument alone it is difficult to understand what the charts actually displaying. In reality, there arent many people who would take a look at the stone monument and immediately understand that the arrangement of the stars were the same as the arrangement of the God Trees and go Wow! The egg-shaped red jewel represents the next magic egg where it would spawn!. Not many people would actually notice it. Although it is currently physically impossible for someone to view the arrangement of the trees from above, it is possible to create an image of their arrangements by walking around and locating every God tree in the forest. Furthermore, even if an adventurer was capable enough to survive the labyrinth, between the fear of an unknown curse causing your body to become heavier and turning your skin black as time goes on and your spirit being worn out by travelling in darkness encountering monsters and traps, the moment the exit can be seen, it is highly unlikely for that person to consciously delay their departure to analyze a stone monument. That is why its even more likely that only someone who noticed that the hint to the magic egg can be found by entering the labyrinth by getting eaten by the Starfish Larvae. Coincidentally, this hint was discovered by the same person who found the hidden room which fixes your status rise to three points per level. Before I let my mind wander off too far, I mustered up the last of my strength and tried my best to copy the star chart onto the notebook. With this, we have the advantage of knowing where the egg will appear. Next step is to determine when will the egg actually spawn. In the labyrinth, the stone monument isnt the only hint available. Next to the stone monument, a pendulum clock can be seen. However, it only has an hour hand which has stopped moving. It is also written on the clock, When a new day comes, a new life will be born. It is simple enough to understand that the egg will spawn when this clocks hour hand reaches 12. For an oblivious adventurer, there is an obvious hint at the center of the clock where an egg is draw as well as the sentence. The clock has a secret function where the hour hand only moves once every midnight. The moment the hour hand reaches 12, the magic egg will appear in the forest. I took a memo of the hour hand position in order to estimate when the egg spawns by comparing the different positions of the hour hand. Together with the stone monument, we will be able to identify where and when the egg will appear. [Yosh. Luna, Til. Im done investigating the hints. With this, weve gotten one step closer to obtaining a Magic Pet.] (Youya) [Hurray!. Youya, Luna is already at her limit! Lets hurry up and leave!] (Luna) [I also feel my body getting heavier every second! I feel like Ill die soon~] (Til) [What are we going to do about that? Were coming back here tomorrow.] (Youya) At that moment, the two of them had a face like it was the end of the world. Its regretful for them, but this labyrinth is the perfect spot for them to train right now. Plenty of monsters and the chance to learn about traps. If we took a different route from today, there will still be plenty of monsters and treasures for us to obtain. In the first place, it is important for us to come back here once more in order to estimate when will the egg spawn. [For now lets return to the town and rest up for tomorrow by enjoying a feast. Dont worry too much about returning to the labyrinth. Both of you have gained a lot of experience and it should be much easier for you guys to conquer the labyrinth tomorrow. ] (Youya) After mentioning the feast well be having tonight, the two of them looked revitalized. Then, the three of us entered the blue vortex, finally exiting the dungeon. . . . [The air feels great~ My body feels light again.] (Luna) [I never thought Ill be this happy just walking outside!] (Til) Luna and Til became energetic again after exiting the labyrinth. The sun was already setting, apparently we had spent quite a long time inside the labyrinth. [Luna, Til. Could you bring the girl back to our room at the inn? Ill head over to the guild to submit a report. Please help her to wash up and change her clothes since she giving off a bad smell.] (Youya) [Leave it to us!] (Luna) [Once were done well go for a feast! Dont forget!] (Til) [I know. I wouldnt lie about that.] (Youya) Now then, lets quickly return to the guild to report our progression. Today we managed to reap a huge harvest. Thanks to that herd of Horned Boars, we finished the quest in one day although I thought it would had taken three days to complete. In addition, we also have the equipment that we picked up from dead adventurers in the labyrinth. Apparently there were more adventurers being eaten by the Starfish Larvae than I had thought, and most of them lost their lives inside the labyrinth. Adventurers who are unable to bring along a Magic Bag are highly unlikely to take the trouble to bring a light source along to a forest brightly lit like the forest of God Trees. It is impossible to clear the labyrinth where visibility is basically zero with numerous monsters and traps. They would be saved if they had a Return Stone, however using such an expensive and rare item isnt a luxury that intermediate level adventurers would be able to afford. I had thought about this back when it was just a game, but this world is incredibly hostile to live in. After confirming that there wasnt anyone following or eavesdropping on us, I head towards the guild after checking on the princesss condition and the talk with the girls. [You two! It is unacceptable for us to lose the magic egg when we have gotten such an important hint.] (Youya) [Roger that!] (Luna) [Yes sir! As planned we will obtain the egg!] (Til) They gave good replies. However, the meaning behind my sentence was slightly different from what they might think. It isnt that simple for us to just obtain the egg. Magic eggs are usually sold for a ridiculously high price on the market. If someone finds out that we have somehow obtained information about where the eggs potential location, there might be people who are willing to take hostages and resort to torture to obtain that information. Furthermore it is still tricky to obtain the egg even with the information. A human driven by greed is even more dangerous than a powerful monster. . . . I am currently talking to the receptionist at the guild. As usual, I was talking alone with the receptionist in order to keep the secret from getting out. It wasnt a case of distrusting the girls, but they are careless about what topics are appropriate in the current situation.. The priority with the receptionist is the completion of quests and exchange of materials. [Uhm. Isnt it the period before the weekly respawn where there arent many monsters right?] (Receptionist) [Youre right.] (Youya) [You went hunting in the forest of God Trees where there are many adventurers hunting monsters while searching for any clues about the Magic Egg right?] (Receptionist) [Youre right again.] (Youya) [So how did you complete the meat collection quest a little under a day!? And also what is with the amount of materials that you are trying to exchange!?] (Receptionist) [Everyone in the party tried their best and we got lucky.] (Youya) The receptionist was so surprised that she forgot to breathe. It isnt very unreasonable to think that we did our best and got lucky. The respawn occurs the day after so its currently the worst time for us to go hunting as there arent many monsters nor treasure left in the dungeon. Normally, adventurers wouldnt be working around this time, however only the forest of God Trees which has the egg spawn is crowded. The limited number of prey had to be divided among the number of adventurers. Moving on to the material exchange, as expected of a professional, she handled the exchange extremely quickly, rewarding us with our cash and guild points. It will become easier for the receptionist to give us better quests if her opinion of us increases. It is actually nice to give her this much of an impact on the first day. Besides, the situation with our wallet recently has been become even more dire. Itll be nice to promote our party ranking as soon as possible since we are already getting close to a promotion. Once we promote, our exchange rates will increase and the amount of benefits we have will also increase. [How is the recruitment notice I requested going?] (Youya) [There hasnt been a single application.. Because monks are popular, there arent any that are usually available.] (Receptionist) Earlier today when we accepted the quest, I had also requested for a party recruitment. When a fee is paid to recruit party members, the notice will be placed on the guilds quest board. Also whenever a person who fits the criteria appear, the receptionist will also explicitly introduce the party to the person. It is already difficult to find an adventurer without a party, much less someone who fit the specific conditions. However, having a healer is a necessity for a party and I already knew it wouldnt be easy from the start. [I know that itll be difficult. Ill be patient until then.] (Youya) [That isnt the only reason. There have also been adventurers who are interfering and spreading rumors about you, ruining your reputation.] (Receptionist) Could it be the two men who tried to forcefully recruit Luna and Til? Is this their way of retaliating against us? Such a troublesome bunch. [So its like that. I understand the situation now. Ill wait a little longer on the recruitment. Ill be coming back tomorrow so I hope you will introduce us a good quest for tomorrow.] (Youya) [We will be waiting. The guild welcomes any capable adventurer.] (Receptionist) Afterwards, I left the guild. Someone spreading rumors about us makes things difficult. It will probably be impossible for us to get a party member in this town now. . . . On the way back to the inn, I bought several recovery potions while purchasing several light foodstuff for the princess. As her constitution isnt in the best of states, it would be better for her to eat food that is easy on the digestive system. While I was on the way back ,I purchased food for one person. [I wanted to find a fourth member before Phil joins us to strengthen our coordination but what should we do now? Since were together should we just recruit that princess to our party?] (Youya) I smiled bitterly as I thought of something impossible. [That is a stupid idea. Shes a princess. She cant be an adventurer. Although I never did expect to meet her again.] (Youya) I remembered the promise I made with the princess over ten years ago. During our nominated quest at the Laluzulu Kingdom, the knights had lost their lives one after another to the point that outsiders like us had to be hired to protect the royals. At that time, princess Lutra was only six years old. She was a shy girl, so shy that she was even afraid of us who were hired to be her bodyguards. Because of that, it was difficult for us to accomplish our job, so I made a promise to her. [Are you afraid of me? Are you unable to trust me? It isnt unreasonable for you to do that since were just savage adventurers.. However, we are also professionals. I promise you, that if you cant believe me just by my words, then I will become Princess Lutras personal Knight. On my knights pride I promise that I will protect you.] (Youya) That day was the first time that Princess Lutra had opened up to me. Afterwards we mimicked the ceremony of the knights oath. The six-year old Princess Lutra must have forgotten about such a promise since its been years since that promise was even made. Just because of that promise, I carelessly got involved in whatever situation she was in and brought her back from the labyrinth. I am that girls knight and it is natural for me to protect the princess. It was a stroke of luck that she was discovered by us in the labyrinth. Within the hundreds of thousand possibilities that could had occurred, there is none where I would abandon her in the labyrinth. Now then, Im looking forward to see how that crybaby princess has grown. Hi guys! Hope you guys enjoyed the second volume so far! Thank you for your continuous support. However, I will only be releasing one chapter every week starting from next week as I havent been able to complete chapters as fast as I would have liked so Ill be slowing down their releases to give me more time to complete chapters. Ill likely continue with more chapters in the future once Im able to keep up at least three a week. Until then, I hope you guys enjoy the series as it has been a blast doing this series and I hope you will continue to enjoy it as much as I do. Volume 2 Chapter 7 [Youya, Welcome back!] (Luna) [As told, we changed the princesss clothes and washed her body. Be thankful okay, it was hard work.] (Til) [Thanks, you two. Heres your reward.] (Youya) During the short shopping trip earlier, i had bought a bunch of fruits that resembled apples in my previous life. I threw those fruits towards the two girls and the two of them happily caught them. It must have been really tough since the princess was encased in the cocoon for almost three days, she was unable to change her clothes and since she couldnt move, various stuff came out, staining her clothes. It wasnt just a hygiene issue. If the person had woken up in that state it would had been a terrible experience to be seen so Til did a good job. I couldnt be the one doing it since itll be bad if she woke up and saw a male cleaning her up. Although the girl with silver hair was alive, her body was still very weak. After escaping the Starfish Larvae, the blackening process caused by the curse began to slowly fade away. Her blackified skin was slowly reverting to its normal pale white. At this rate it should be about 2 hours before the curse completely disappears The pouch she was carrying also had several water bottles and preserved meals remaining, however after she was caught by the spider she was unable to even consume that. Starvation is one of the reasons why she is currently this fragile. Little by little, I poured the recovery potion into her mouth while Luna and Til were anxiously watching over the girl. [Shes very pretty.] (Luna) [Right? Although the two of us are pretty cute ourselves, she is on a different level. Looks like my sister has a new competitor.] (Til) [Til, you shouldnt go around calling yourself cute.] (Youya) [But its the truth right? There arent many girls that look like me and Luna around you know.] (Til) I cant refute her point. Luna and Til are both cute girls in their own rights. Although I think its better to be cute than beautiful though. The princess could be the very definition of the word beautiful. She is probably around 16 to 18 years old right now. I knew that she would grow up to be a very pretty girl but I didnt expect her to look this beautiful. [Luna, Til. This girl is in a precarious situation right now. Itll be bad to let anyone see her here so we will be waiting here until she wakes up. Since its about time for dinner, heres some money. Both of you head over to the bar.. Actually, Im afraid of leaving the two of you in the bar too. Both of you go get whatever youll like from the restaurant in the inn as a reward for your hard work today.] (Youya) Although Ill like to have dinner together with them, someone has to be around when the princess wakes up. I have also thought about sending the princes to a hospital. However a situation when the princess of the Laluzulu Kingdom was eaten by the Starfish Larvae in Greenwood is far from normal. There is likely a conspiracy going on behind the scenes. It is unwise to bring the princess to the hospital since we dont know who might be an enemy. Thats why after we got out of the dungeon, I hid my face with the hat and wrapped the princess in a cloth to hide our identities. [No can do. If Youya isnt here then the food wont taste good.] (Luna) [Uhn uhn. Anyway since the bar opens late at night, its fine for us to wait here. In the meantime lets have some snacks!. Jajan!. Heres some nuts that I picked up in the forest of God Trees! It was a popular snack back in the elves village too.] (Til) [Thats perfect. Til.] (Luna) [Enjoy~.] (Til) [Its delicious. Til is a reliable person.] (Luna) Luna and Til began to munch on some dubious-looking nuts. Its not good if Im not there huh. They are good children that are wasted on someone like me. [I understand. Then were remain here together until this girl wakes up. Are the two of you tired? You should get some sleep.] (Youya) [Uhn. Ill sleep. After eating some nuts I feel sleepy.] (Luna) [This is our preparation to become night owls!] (Ti) The two of them got into the bed together and fell asleep. Its nice that they are getting along well. While Luna and Til fell asleep, I continued to read a book while sitting next to the sleeping princess, occasionally feeding her a recovery potion. When the body is in a poor condition, feeding too much of a potion may cause it to have an inverse effect, thus its much more beneficial to feed it little by little instead. Just like this, about two hours has passed. Then the princesss eyelids began to move. [NOOOO. THE SPIDER. THE SPIDER AHHHHH.] (Princess Lutra) The princess started to scream uncontrollably, waking up Luna and Til. I grabbed the princesss shoulders firmly and looked straight into her eyes. [Calm down. I defeated the Hunting Spider and were outside of the dungeon. You are safe now.] (Youya) [Outside? I was rescued?] (Princess Lutra) With a half-trusting half dubious look, the princess began to scan her surroundings. After realising that we were inside a building, she heaved a sigh of relief. [When we were inside the dungeon after being eaten by the Starfish Larvae, we defeated a Hunting Spider and found you inside a cocoon on its back. Afterwards we left the dungeon and brought you to this inn in Greenwood.] (Youya) After realising she was safely within Greenwood, strength left the princesss body and she collapsed. In a state of shock, I hurriedly grabbed her body to support her. [Im glad that I was saved. Im glad.] (Princess Lutra) After being in that dungeon for an extended period of time, she began to cry and I continued to hug her in silence. Embracing a girl without her consent is an invasion of privacy, however it is precisely at these sort of timings where she needs to have someone by her side to give her a sense of security. Although I tried to release her, she continued to stay in my arms and I gently patted her back. After she calmed down, we resetted the situation and faced each other. The princess opened her eyes. [Uncle Youya..] (Princess Lutra) [I didnt think that you would remember me. Its been a while, Princess Lutra.] (Youya) She was the 6 year old princess that I met while on a quest a decade ago. However, it seems that she still remembered my face vividly. [After all, Uncle Youya is Lutras knight right?] (Princess Lutra) We hugged each other once more, this time with her face leaning onto my chest. Witnessing such a scene, only one person had a different reaction. Lunas ears began twitching and she ran towards me, pulling me away from Lutra while clinging onto me like a koala. Then, she said towards Lutra. [Youya belongs to Luna.] (Luna) It was her usual childish reaction. Her statement being a threat towards Lutra, with her fluffy fox tail repeatedly slapping the bed. [Its nice to see that some things will never change. Back when you came to Laluzulu, Phil had reacted in the exact same way towards me.] (Princess Lutra) [It seems that I was born under a weird star I guess.] (Youya) I am often being hugged by girls like this. Speaking of it, Phil did show this sort of childish reactions similar to Luna back when we first met Lutra. Seems that the two of them were both jealous of Lutra. [Princess Lutra, Why were you in that sort of situation? Honestly, right now I am unsure of how I am supposed to think about you.] (Youya) Lutra began to recall, placing her hands on her chin. [If its Uncle Youya then it should be fine. To make it simple, I was set up by my elder brother. For the succession of the Laluzulu Kingdom, when there are multiple candidates, the successor is chosen in a tournament and since we are a kingdom of knights. Gender doesnt matter and I am a participant. He probably wanted to get rid of me.] (Princess Lutra) I have heard about that story before. The kingdom of knights Laluzulu. Although it cant be be noticed in Greenwood, its name could easily be proven fact. [I had to visit Rumberg for an event and decided to drop by Greenwood on my way home. Since it was the Magic egg season, I decided to try my luck while raising my level in the dungeon here and was recommended by the knights to head to the Forest of God Trees to raise my level. It was then when the Starfish Larvae appeared. When I was hiding behind a God Tree, the knight, Emily thrust me into its path in tears, apologising as I was eaten by the Starfish Larvae.] (Princess Lutra) The capable looking Princess Lutra began to mumble. It seems that rather than hatred and anger, she felt more sympathy towards the knight Emily. [Based on his reaction, that knight was probably being blackmailed by your siblings.] (Youya) [I agree. My mother was a mere commoner so among all the candidates, I have the weakest standing. If my siblings decided to use their power, not just that knight but many other knights will have no choice but to obey them. I was surprised by the Starfish Larvaes stomach. It was complete dark and I couldnt see anything, and tried to move around to find the exit. That was when I was captured by a monster and tried my best to escape, however I found myself being poisoned and unable to move. Eventually I lost consciousness and when I came to, I found myself here.] (Princess Lutra) I was surprised by her explanation. So was Luna and Til. Even though she was caught off guard by the labyrinth, she was still capable of calming searching the labyrinth for an exit without losing her cool. Being capable of moving around without any light source and surviving attacks from monsters and traps for an entire day in completely darkness, that isnt possible without strength and a mind made of steel. [The main problem has yet to come.] (Youya) [Thats right. Since the knight was most likely being blackmailed with something, if I return to the castle then just like before my life will be targeted. Until I can solve the problem, everyone in the castle is my enemy.] (Princess Lutra) I would like to help Lutra, however her situation is currently not something I can solve. There is nothing else I can do. [At this rate, my siblings will be notified of my death for sure. The current situation is a definite chance for me. Above all, I hope that my siblings will think that they accomplished their mission so that I can make full use of this chance.] (Princess Lutra) [This situation is a chance.. That is an impressive amount courage you have there.] (Youya) Princess Lutras knight is going to report that she was eaten by the Starfish Larvae. Since she was most likely dead, there isnt any reason for them to investigate her death. [Because of how I was eaten, there will be almost no doubt that I am currently dead. However I wont be able to return to the castle until the right time. Fortunately, the tournament between the princes and princesses has already been confirmed to take place on the third week of the water moon. Until then, Ill like to remain dead and return to the castle just before the tournament.] (Princess Lutra) [That is a good decision. There is nothing safer than being dead right now. Is it still possible for you to enter the tournament once the battle has already been decided?] (Youya) Her decision making was decisive and her courage is second to none. This wouldnt be possible for a princess if she was merely pampered throughout her life. It seems that she has been through a lot in the castle. [Uncle Youya, I have a request to ask of you. Could you let me join your party until the battle for succession takes place? I have to become stronger before the battle starts. It cant be done on my own. It is possible only if I rely on my reliable Uncle Youya.] (Princess Lutra) Her words were definitely the truth. Although she was capable enough to aim for the exit inside the labyrinth, she wasnt able to exit on her own. It is still impossible for ordinary adventurers. [Princess Lutra. Personally I want to help, but Im sure you understand the risks involved for us if we invite you to the party. What about you? What can you offer for us that can convince us to help you.] (Youya) It may seem harsh, but this is expected of an adventurer. If I was alone, I wouldnt hesitate to offer my help. However, there is also Luna and Til. I cant be selfish enough to drag them into this mess on my own selfishness. This is also for Princess Lutras sake. You cant expect someone whom you just reunited with after a decade to help you in a complicated battle against an entire kingdom since you wont know how much the person has changed in that time. [I am capable enough to offer my strength to the party. I have the exclusive class that is only available to the royals as well as my swordsmanship that was honed in the capital through tutoring by the knights in the castle. To raise my levels I have also entered countless dungeons with the knights, I am confident in both my mental strength,critical thinking as well as physical capabilities. A Crusader that is capable of being both a healer and a shield for the party. Isnt that the class that is most suitable for your party right now?] (Princess Lutra) The Holy Knight class Crusader. It was another exclusive class that is only available to NPCs during an event in the game era, to the royal family of the Laluzulu Kingdom. In other words, it was the occupation of the founder of Laluzulu Kingdom, Princess Lutras ancestor. Crusaders had their attack power reduced in exchange for the ability to cast recovery magic. Currently, I was serving both as the partys tank and the melee damage dealer. If we had a dedicated tank in the party, I would be able to focus on offense and our hunts would also become much easier. Our problem of being unable to defend ourselves against ranged and magic attacks will also solved. Furthermore, Crusaders were capable of using the recovery magic Heal. They were all important problems in our party that we lacked. [Sounds enticing however it isnt a must for our healer to be a crusader. It is also possible for us to find a monk to cover up my healing needs. Our partys shortcomings can indeed be covered up by having you in our party, but I do not see how that is worth the risk of turning the entire Laluzulu Kingdom into our enemies. Finding a simple monk would also suffice.] (Youya) [When I gain the right to succeed the throne, a reward will also be prepared for you. Not only that, I will appoint you as a special knight of the Laluzulu kingdom, with the appropriate emblem to indicate so.] (Princess Lutra) An official emblem of knighthood. There isnt any adventurer who doesnt understand what that signifies. It is the act of being bestowed a rare sword of which only five exists in the world. [You sure about that? I will not elect to stay in the castle even if I am designated to be a sworn knight.] (Youya) [Of course it is. In the first place, you said it yourself ten years ago. That you would be my personal knight even if you are far away, you will definitely come to my rescue, just like what happened today. If that wasnt the case, then a miracle wouldnt had happen just like today. I beg you, you are the only knight that I have.] (Princess Lutra) She stared directly into my eyes, remembering not just my face but also the promise we made back then. Ive always been weak to strong women. I had to honor my promises. [If you bring up my promise just like this, there is no way that I can refuse can I? Fine, well accept you into our party, however I wont be treating you as Princess Lutra, but rather a fellow adventurer Lutra. Be warned that Im a harsh teacher.] (Youya) [I wouldnt expect anything less from the weakest undefeated knight that won the tournament with an inadequate status, defeating countless swordsmen just from your own skill. The world isnt kind enough to people that they wont have to suffer. Especially because of my circumstances, I have to become stronger.] (Princess Lutra) Those were two traumas that I wanted to leave behind, just leave it behind please! In the long history of adventurers, ten years ago there was a party that cleared impossible quests one after another, a party made of the strongest in their respective classes. However, because of that I was somehow given two nicknames and that was one of them. As expected of a world entirely driven by a chuunibyou naming sense. Luna who was behind me had eyes that were shining brightly while repeatedly muttering Weakest undefeatable swordsman. Ugh, I can feel my mental wound opening up. It hurts [Anyways, please take care of us from now on. We will be in each others care Princess.. No. Adventurer Lutra.] (Youya) [Thank you, likewise please look after me from now on as just Lutra.] (Lutra) We firmly shook hands. I was beginning to give up looking for another party member at greenwood, however it is a blessing that we managed to obtain another friend into our party like this. Furthermore, it was another Exclusive class Crusader. As usual my luck is growing right after meeting Luna. A reunion with Phil, meeting Til and now having a Crusader who is Lutra joining my party. Is this really just a coincidence? I have a feeling that somehow there was an otherworldly power working behind the scenes. [Now then, since the difficult things have been settled and the princess is awake now. Lets go out and have a feast! The princess will be coming along with us!] (Til) [Uhn. Seconded. Luna is hungry too.] (Luna) Luna and Til gave out a cheerful voice, blowing away the tense and heavy atmosphere. They are right though. Theres no point worrying about something that is out of our control. For now lets celebrate the welcome of a new member. Volume 2 Chapter 8 In a purely coincidental fashion, we reunited with a friend who was on her deathbed, the crusader Lutra. Im Hungry! Bar! Welcome celebration! Such cheers were repeated by the two children who were hungry. There wasnt anyone at the bar who didnt know Lutras face, so several preparations had to be done before we could proceed with our meal. [Lutra, thanks for showing me your status card. Ive pretty much grasped everything.] (Youya) [If its something like that its fine. Since we will be in the same party from now on, its important to understand each others capabilities.] (Lutra) Lutra showed me her status card. As expected, in this world only royals were instructed on the best skills to take and avoided the needless and unwanted skills. Having a firm grasp on your classs information was important as skill points were a valuable resource. In the game, Crusaders were only available for NPCs. Originally, her ancestors were NPCs that played an important role in an event for the game and she possessed that very same class , being one of their descendents. I remember the details of that event clearly as it was one of the most difficult events I have ever attempted. In order to clear the event, you would have to utilize the abilities of the NPC in the event, princess Renoir who possessed the exact same bright silver hair as Lutra. I had asked Lutra about what happened to Renoir and whether she had heard about her, and she told me that she was a powerful hero that existed over two hundred years ago. Thinking about the situation calmly, it was frankly amazing. The world that I thought was just a game is actually connected to the current world. Itll be nice to search for traces of the game in the future as I have the feeling that I would like to figure something out by examining those hints. But for now, I have to do something about Lutras current situation. [I cant help but feel envious after taking a look at your status card. Not only do you have an exclusive class but your status is amazing too.] (Youya) Lutra was level 25 and it seems like she was also blessed with her status, managing to gain three points every single time in physical strength, defense and magic power. Although Luna and Til were similar, Luna had always gotten three points in her strength and speed while Phil and Til both got three points in strength, speed and magic power. It seems that both special existences and those with exclusive classes possessed the tendency to get three points every level. [My ancestor, the battle princess Runoir with bright silver hair also had a status similar to this. It was an interesting phenomenon. It turned out that women with silver hair who chose to become crusaders would turn out to have a better status than an average person.] (Lutra) This is definitely not a coincidence. If it wasnt a coincidence, then it could be that the requirement to become a crusader would be to have the same status gain as the battle princess Renoir. Regardless, it would mean that all crusaders had access to an exclusive class as well as a privileged status were remnants of a powerful character back in the game. Without a doubt having Lutra is like spotting a diamond in a bargain sale. The crusaders specialty was their high defensive power and their access to defensive skills and recovery skills. It was an occupation that functioned a similar role to a tank and a healer. And similarly to other exclusive classes, there were things that a crusader couldnt do better than a warrior and a monk. They had lower attack power and lesser access to offensive skills while not having access to supportive-type magic that monks possessed. However, it is still a powerful class with just minor downsides. With both defensive and recovery capabilities, the partys survivability in dungeons and fights would be either confirmed or even better. Furthermore our party has a magic knight who is capable of casting supportive-type magic. In terms of offensive capabilities there are the powerful spells I possessed from Magic Customization, Assassinate that Luna can use with a 100% critical rate as well as the Spirit Archer class that Til possessed which allows her to use her bow while chanting. Our offensive capability was far higher than a well-balanced party containing a monk. It was near impossible to get a combination any stronger than ours, although we have an amazing combination, we still possessed weaknesses. Lutra was a princess of the Laluzulu Kingdom with her mother being a commoner and herself at risk of being assassinated. If her presence is exposed, there is a chance that we may be targeted by the entire royal family. Just from that consideration alone, I would have decline her request. However I couldnt break the promise I made with Lutra when she was small to become her knight and the lady herself has remembered. [Slow! Youya, its a feast! A feast!] (Luna) [If you dont hurry up the bar is going to close!] (Til) [Its almost done, please wait a moment.] (Youya) Luna and Tils patience were about to run out as they were hungry. [Lutra, first please put this on your hair.] (Youya) Taking out a hairpin from my magic bag, I handed it over to Lutra. She received the hairpin and pinned it onto her hair, surprising Til and Luna. I brought Lutra to the mirror at the front of the room. [Its amazing. My hair became black.] (Lutra) [It is a hair pin that has a special enchantment called the Blessing of Darkness. Its an enchantment that grants the user increased resistance to the darkness element, while causing the users hair to change colour. We cant afford to walk around with a girl possessing the unique Laluzulu silver hair.. By changing your hair colour it is more difficult for anybody to discover your identity. A persons hair is an important factor in their identity.] (Youya) Lutra is famous for her silver hair similar to the battle princess Renoir. That fame can become an important weapon for us. By changing the colour of her hair, it is easy to pass her off as someone who resembles the famous princess Lutra. Although it is quite a luxurious option to use an enchanted equipment with increases darkness properties as a disguise. [Its true, although it was just my hair colour that changed, it looks like Im a completely different person. However, it still feels inadequate. We have to change something else so that the impression would be even less likely.] (Lutra) Lutra took out a dagger from her bag we placed on the bedside and cut her hair. Her hair which extended to her waist was now shoulder length and tied it with a hair-tie. Like this, it wasnt just her hair colour that changed but her hairstyle had changed as well. The impression of Princess Lutra was completely gone. [You definitely look different now that you cut your hair, but are you really fine with that? Werent you always proud of having the same hairstyle as your ancestor Renoir.] (Youya) [I was definitely proud of my silver hair, however, what matters now is to succeed the throne. So long as that happens, I will cut my hair as many times as it takes.] (Lutra) Despite her strong words, there was a sense of sadness behind her expression. Her hair was a symbol of her pride from having the same hair as her ancestor, it was definitely a difficult choice for her to cut her hair. All because of a dream which she wants to achieve. [That is a good resolve. With this, no one can recognise you as princess Lutra. Now then, should we change your name as well? As expected it is difficult for us to call you Lutra when we are outside.] (Youya) [I agree. A second identity would be needed. But it is difficult to think of a different name on my own. Could uncle Youya be the one to give me the new name? Maybe it would be easier for me if you were the one who came up with it.] (Lutra) A new name Cant believe that I would have to name two people in this short span of time. For Lunas case, I gave her the same name as the pie that she liked. However, in Lutras case nothing particularly comes to mind. I took a glance over at the hair that Lutra had cut . [How about Selene?] (Youya) Lutra began to repeat Selene over and over. [Thats a nice name. Could you tell me what it stands for?] (Lutra) While smiling, Lutra asked me. [I know that you wanted to cut off any traces of being Lutra, but I thought that your silver hair was important to you. Since we dyed your hair black, I wanted to give you a name with the image of silver in mind. For me, silver represents the moon, thats why I chose Selene as it is the name for the goddess of the moon.] (Youya) Note: Selene is the name of the moon goddess in Greek mythology [Im surprised. Uncle Youya is surprisingly poetic and romantic. I really like it. Thank you, Ill cherish the name.] (Selene) Lutra.. I mean Selene smiled so brightly that I felt captivated by her. This cant do, I have to get myself together. In the future Selene will return to Lutra and inherit the throne. I will not lay my hands on her. Firstly, there is Phil and I am an old man. What am I going to do when I lay my hands on a teenage girl. In the first place I am her knight. I would be a failure of a knight to lay a hand on the princess. Til is also nearby, If I did anything strange Phil would definitely find out about it. [Take good care of it. Also I want to say something. Ill be blunt, there is also the option of throwing away your identity as Lutra and live the rest of your life as Selene. In any case, Lutra died once in the forest of God Trees. Rather than the political life with conspiracies in the life of a royal, the adventurer life may turn out easier and more enjoyable than that.] (Youya) I didnt bring this up with the intention of tempting her into the adventuring life. I did this as an elder in life to let her make her own choices, about the possible paths in her life and to choose whatever she thinks would make her happy. It would be a shame if Selene returned to the royal palace just because she was unable to consider any other possibilities. [Uncle Youya is as kind as everHowever, I will be returning to the castle no matter what. I cant leave the Laluzulu Kingdom to my elder brothers. If that happens the kingdom will fall into chaos. The citizens arent toys for the king to play with and I cant run away from my responsibilities just because I desired my own freedom.] (Selene) [It seems that I said something unnecessary. You will become a great queen.] (Youya) She chose to protect her people in exchange for her own freedom. Although she is just a teenage girl, she is a fine princess. [There is another thing I have to correct you on. The winner of the tournament wont be the person to become the successor, but the person to select the successor. I have no intentions of becoming the queen of the kingdom. I may be a candidate to become the successor of the throne, but I have zero experience in being a ruler. I am merely good with my body. The one that is worthy of being the queen of the kingdom is my elder sister who is competent both in her personality and magical abilities. If I win the tournament, I plan to make my sister the successor of the kingdom and support her by her side. All this after making uncle Youya a knight of course.] (Selene) I widened my eyes. She was going so far to even willing to throw her life away to win the inheritance tournament and yet she will be handing the throne to another person. It seems that above all this girl is considering the country first and the people. I dont hate this kind of person. In fact, I feel even more compelled to support her. And even slightly greedier. If she isnt going to become the king, I wonder if its possible to convince her sister to allow Lutra to continue adventuring with us after everything is over. [I understand. For the time being its time to eat! Ive brought back lots of potions as well as nutritious foods to help you recover. Its the welcoming party for a new member. Lets enjoy tonight as much as possible, whatever you guys want!] (Youya) [Luna was tired of waiting!] (Luna) [Hurry lets go! Selene is the newbie here so be sure to listen to us carefully!] (Til) [Luna will also teach what she knows!] (Luna) [Sure, please do so, my cute seniors.] (Selene) Watching the two children trying to behave as a senior made me laugh unknowingly. Lutra turned Selene changed into her casual wear from her sleepwear and we headed towards the bar together. Truth be told, Im also extremely excited. Lets make it an enjoyable welcoming party. Volume 2 Chapter 9 After completing our preparations, we finally arrived at the bar. We were recommended to this bar by the receptionist after I had asked for a place where we could enjoy a good meal as adventurers regardless of the price. As it was my first time arriving in Greenwood outside of the game, I wasnt familiar with the place nor do I know about the places we should go. It is precisely at this moment where we should rely on someone familiar with the town such as the receptionist or the owner of the inn. After arriving at the front door, I could tell that we had came to the right place. There were many adventurers of different races enjoying themselves in the bar. Having adventurers as your main customers is a rough situation as it is difficult to survive unless your performance is highly efficient for your cost to make up for possible damages in the property. [Youya, there is the smell of good meat *slurp**slurp*.] (Luna) [The smell of the vegetables here is great too. Im familiar with plants so I can tell a fresh vegetable from a bad one.] (Til) [I do not frequent lively stores like this. My heart is pounding from excitement.] (Selene) Before we managed to place our orders, Luna, Til and Lutra.. I mean Selene seem to be looking forward to the food here. When the waiter arrived, I asked for their recommendations. When entering a store for the first time, I tend to order their recommendations rather than pick out a dish I would like as I like to try out the stores most confident dish. [Luna and Til prefer juice to alcohol?] (Selene) [Uhn. Alcohol is bitter. Milk with honey is good.] (Luna) [Right? Juice is delicious you know! I am a believer of fruits!] (Til) In this world, a child would be considered an adult once they reach the age of 13, thus both Luna and Til are able to drink alcohol, however the two of them refused to drink as it was too bitter for them. Times like this made me miss the old days of having a drinking party late at night. [How about you Selene?] (Youya) [I would like to have wine.] (Selene) [The wine here wont be the same as the wine you drank in the past. Its much lighter and younger.] (Youya) Nobles typically drank wine that has been nurtured for a long period of time, however such luxurious goods arent present in general shops like these. The wine served here is typically a young wine that was made in the year and its method of production isnt suitable for long term preservation. [That is interesting. Ill have to get used to an adventurers wine so I am definitely going to order it.] (Selene) [Got it. Excuse me miss. Can I have one milk with honey, grape juice, one ale.. Actually cancel the ale and give me 2 wine instead.] (Youya) I ordered a cup of milk, 2 jugs of wine and a grape juice. It is a nice thing to drink wine from time to time as well. The drinks came fairly quickly in this store as the waiter immediately brought us our orders. With sparkling eyes, Luna gulped down her warm milk with honey. I was always wondering if her love from milk was derived from her fox traits as she seems to love milk. Til said that the grape juice tasted decent while Selene was surprised to see the wine served in a jug, Nobles often drank wine from a glass but adventurers gulp wine down from jugs. Selene learnt by observing the surrounding adventurers and followed suit. [Delicious, however is this really wine?] (Selene) [Well at least I think so. That is the taste of an adventurers wine.] (Youya) [I see. So this is the taste that uncle Youya and your friends often drink. It has no deep flavour to it, it tastes as if it was mixed with a bunch of different ingredients and the grape flavour is diluted. However, its still good and easy to drink. I like it.] (Selene) Following her words, she tilted the mug and drank another mouthful. The wine drank by adventurers often varies all the way from the grapes harvested to the method of manufacturing the wine. Nobles are picky with their wine and often only use delicious grapes from the trees. However, cheap wine for adventurers often only consist of using more and more grapes. Naturally, since it was made with inferior grapes in sweetness and quality, only inferior quality of wine can be made. However, it isnt edible the way it is as the sugar content and alcohol concentration was still low. Hence afterwards it was mixed with various ingredients such as honey, lemon juice, other grape wines and alcohol, increasing its volume while improving its taste. Thanks to that, the taste of the wine in each bar varies. There are even several stores that merely add water to the mixture instead. However, the shop here was amazing with good tastes. The wine was well made, sweet with a strong acidity and the taste of hidden spices behind it. My body began to feel warm drinking the wine. After the drinks came the food. [Youya look! Its a mountain of meat!] (Luna) [Wowow, now this is what you call a dish!] (Til) The recommended dishes came and the two girls became rowdy. [Its a deep fried dish. This is rare to see. Fried dishes are extremely delicious.] (Youya) [It tastes amazing!] (Luna) [Its delicious, however the oil may be a little too much. Its a little unbearable to eat.] (Til) The recommended main dish was thick roasted pork with a coating of sweet sauce. It could even be the meat that we delivered for the quest earlier today. Its been awhile since I ate a fried food. The meat juices bursted inside of my mouth as it mixed with the sweet sauce, completely overwhelming the aftertaste of the wine. Afterwards I took a gulp of the wine and realised that it was a mixture of lemon juice, grape juice as well as several species that went surprisingly well with greasy dishes. The food here was magnificently compatible. [Luna, Til. Juice is fine but how about trying some wine? This dish goes really well with their wine. Til mentioned that the excessive oil was bad but its pretty refreshing to match the wine with the dish.] (Youya) [Alcohol is bitter!] (Luna) [I dont understand the concept of turning sweet grapes into bitter drinks.] (Til) [Well, just try it.] (Youya) Without their permission, I ordered two more jugs of wine. Even if the two of them refuse to drink it, I could drink them afterwards. [If Youya says so..] (Luna) [Only because you are selfish enough to make us drink it!] (Til) The two of them took a jug of wine each. [Sweet! Youya, Luna can drink sweet wine!] (Luna) [This could actually be good.. With the meat, its delicious!] (Til) With huge and repeated gulps, the two girls quickly finished their wine and asked for seconds. The rate which they drank the wine at was also at a frightening pace. Although it was a cheap wine with low alcohol content, its alcohol content was inflated by adding more alcohol directly into it so it has quite a relatively alcohol content. Lets be sure to moderate their drinking afterwards. [So how is it Selene? The taste of an adventurers meal.] (Youya) [Based on just the taste, I have eaten much better, however my heart is also going wild from excitement at the atmosphere.] (Selene) [That excitement is the essence of an adventurers life. Be sure to enjoy it as much as you can.] (Youya) Selene smiled brightly as she stuffed her cheeks with meat. I was worried because she was a princess but it seems that being an adventurer suited her as well. . . . . . After satisfying our stomachs, we began to talk about our future as adventurers. The two girls who naively drank wine continuously were overwhelmed by the alcohol and slept with a blissful face. Even a heavy drinker would collapse after chugging five large mugs continuously. Lets be sure to stop them after two servings next time. However, thanks to this I can focus on the conversation with Selene. [Selenes status, level and skills are both satisfactory. However, your equipment is inadequate. Lets go shopping tomorrow.] (Youya) Thanks to the death battle with the Killer Ape, the labyrinth in the Starfish Larvae and the hunt for Shrimp meat back in Rumberg, My level was currently level 24 while Luna and Til were level 23. Selene who was level 25 was plenty strong enough. However, there is nothing we can do about her equipment. [Its okay though? My sword, shield and armour are all first-class items.] (Selene) [There isnt any problem about their quality, however all of them have the Laluzulu crest. Furthermore the material is too good and the manufacturing method is too different. Just by looking, people would suspect that we are either thieves or a noble pretending to be an adventurer. So long as you are Selene, it is better not to use the equipment that Lutra used to use.] (Youya) Missing posters about Lutra had begun to spread around some large cities, but it hasnt been widespread in the Laluzulu kingdom. However, the Laluzulu royals do not appear in public often so there is little risk of being recognised as a princess just by looking at Selenes face. Princess Lutra was famous for being born with shining silver hair for the first time in several generations, however right now her hair was a different colour. And she was safely unrecognisable by others. However, it is dangerous to walk around with the Laluzulu crest on her equipment now. [Do you have any spare equipment? What about your Magic Bag?] (Youya) Magic bags were highly valued and very rarely appeared on the open market. However, it wasnt impossible for the royal family to be able to get it with their power. If a princess was going to be sent to a dungeon to raise her level to prepare for her inheritance ceremony, there is no way that they dont have a magic bag. [It hurts me to say this but it was stolen by the knight.] (Selene] [For the goal of killing you, he did that to increase the possibility of you perishing inside the larvae huh. Either way we need to get you a new set of equipment. Give me a moment, Ill take a look at what items I can pass to you.] (Youya) There was a spare sword in the bag plus I was carrying my trusty sword with a self-restoration enchantment and a black magic blade on my back. I could give her both my spare armour and my spare sword. However the problem was her shield. Since I rely mostly on my blade for defense, whenever I came across a nice shield I would immediately sell it away. [I can hand over a sword and armor, however I dont have a shield. Alright, its decided. We will get a shield for you tomorrow.] (Youya) [Sure, lets do that. Laluzulus sword style relies on using a shield, furthermore most of the crusaders skill also rely on a shield.] (Selene) Wait a minute. Something feels off about what Selene just said. The sword style of Laluzulu relies on a shield? Ahh I see. Its the very fact that they had incorporated a sword into their battle style. [Hey Selene. Did you know that your ancestor, the battle princess Renoir did not use a sword?] (Youya) That was it. Back in the game, the overpowered NPC Renoir didnt use a sword, and instead relied solely on her shield for combat. Although that was possible only due to her unique shield. Probably, in the hundreds of years since she passed, her battle style must have been forgotten as it was passed from generation to generation. Its not surprising considering how there havent been a single silver- haired crusader in the past few generations. It cant be help that she was mistaught in the art of being a crusader since she was the only one in several generations to become a crusader. [Youre lying. My ancestor Renoir boasted a strength equivalent to an army, that cant be possible by battling with just a shield.] (Selene) [The battle princess Renoirs shield was a shield that both blocks and pierces the enemy. In the first place, her shield was made for the purpose of piercing her enemies.] (Youya) [Where did you hear about this? Renoirs shield was passed down between the princesses with silver hair. Naturally now it belongs to me. It is a superb shield with high defensive capabilities, however for offensive the best I could do was just to hit you with it.] (Selene) Could it be that the main gimmick of the shield was forgotten too? As it was pointlessly flashy, a large number of players in the game wished to use Renoirs skill in the game and there was even a campaign to ask for a crusader class to be implemented. Just what in the world is the Laluzulu kingdom doing, wasting that shields potential to be used as an ordinary shield. I could try to recall the battle style of the battle princess Renoir and consider how I can reproduce it for Selene. If I managed to replicate it and she masters it, she will become a powerful force to be reckoned with. It is a special skill that was the complete opposite of my Deflect. [Selene. I have read books about how the battle princess Renoir used to battle on the battlefield. I also know the secret within her shield. Tomorrow, when we get a new shield for you, lets try a sparring session. Ill use Renoirs shield and adopt her battle style in the battle which is definitely the ideal battle style for a crusader. It will definitely be a good reference point for you.] (Youya) [Even if its you uncle youya, I am unable to believe your words because the Laluzulu battle style was created by that very princess Renoir. It isnt a style that battles using solely a shield. If there is such a fictional book then it was merely a delusional one.] (Selene) [Youll know the answer once we fight tomorrow. Itll be a good way to test your abilities as well.] (Youya) Selenes pride was hurt as she showed a hateful look. On the contrast, I am looking forward to our sparring session tomorrow. Having the opportunity to fight using Renoirs shield that was adored in the game, there is no way i couldnt be excited about it. Battle princess Renoir was a crusader who had a unique battlestyle that depended purely on her own strength. She protected and attack with her life on the line with a shield. Right now I am just a magic knight and I wont be able to demonstrate the styles true power by replicating it. However, I should be able to perform enough to demonstrate to Selene the power of her shield-style. Until tomorrow, I will be imagining and practicing with the shield for our battle tomorrow, and teach Selene the true battle style of a crusader. Volume 2 Chapter 10 After returning from the bar yesterday, I borrowed Selenes shield before returning to bed with a sweaty body. The next morning felt great as I had only drank moderately last night, however in contrast to me [Lunas head.. Lunas head is going to break~~.] (Luna) [Ugh. As expected alcohol is a no-go. Juice is still the best.] (Til) The two children were whining in bed as they had drank too much wine yesterday. The result of drinking five large jugs of wine gave the two of them a magnificent hangover. In their current state there is no chance for us to enter the dungeon. Well in the first place, there was the need to arrange equipment for Selene while adjusting our partys movements as a four-man squad. As a result, we will be postponing the Starfish Larvaes labyrinth exploration to tomorrow instead. [The two of you stay in bed for today.] (Youya) [Uhn. Its regrettable but Luna will stay in bed.] (Luna) [Going out like this is impossible~.] (Til) Truth is if they were to drink an antidote potion, it would treat the hangover as it was basically a weak alcohol poisoning, it is something commonly done by adventurers. Adventurers would often drink an antidote after drinking before heading over to a dungeon. However, lets have them enjoy the hangover to remind them not to overdrink again. [Selene. You can change your clothes in the other room. Then, list the essentials that you need. Currently we only have the clothes that I bought for you the other day so clothing is a definite. Dont worry about the money since we still have lots in reserve.] (Youya) [Then Ill take your word for it. I especially would like a change of underwear..] (Selene) [I dont know what to do about that even if you tell me.] (Youya) I smiled bitterly. Why do young girls come so close to me like this being unprotected. Although I just woke up, my joints were already beginning to hurt. Its probably time for us to change rooms. Originally our room only had two beds. Luna and Til used one bed while I slept in the other, however I gave my bed up for Selene. Since it will be difficult to sleep on the sofa everyday, Ill talk to the innkeeper about a room change afterwards. . . . Selene and I seperated from the two children who were suffering from a hangover and walked around the town. Although the town wasnt as large as Rumberg, the shops were much more vibrant and had a larger variety. This is most likely thanks to the large number of adventurers who visit the town during the Magic Egg season. There are many accessories and equipments with excellent functionalities for intermediate adventurers in the city. Halfway through our trip, I began acting separately from Selene as the party leader to replenish our expendable items such as potions and preserved meals whereas Selene went on to purchase her essentials. I had thought about following her on her shopping trip but it would be embarrassing to follow her as she was buying basically all her essentials including her underwear. Although I handed over a large sum of money to her, I am secretly hoping that her sense of money wasnt over the top as she was still a princess . . . After replenishing our consumables, I waited for Selene at a big tree in the middle of an open square. [The price was much more reasonable than I thought.] (Youya) The replenishment of consumables was cheaper than I thought. I had expected the prices to be higher due to it being magic egg season but on the contrary the price was cheaper than the other cities. The quality of the potions were good and the preserved meals werent that bad either. After awhile, Selene appeared as she came running towards me. [Sorry for making you wait, Uncle Youya.] (Selene) [Dont worry about it, I just arrived a few moments ago. Did you finish your shopping trip safely?] (Youya) [I did. Ill return the change.] (Selene) [Im glad your trip went well. Keep the rest of the money. Itll be better for you to have some money if we are ever seperated.] (Youya) It seems that her sense of money was much better than I thought. I was expected her budget to be spent completely on clothes. I had heard beforehand about what she was going to purchase but Im glad that she managed to spend well within her budget. [Then Ill do as you say and keep them with me. Its finally time to buy my armour. Ive never gotten the chance to choose my own equipment my heart is pounding from excitement. Truthfully I wanted uncle Youya to choose both my equipment and my name.] (Selene) [Then for that reason, lets take a look at your equipment together.] (Youya) As expected Selene showed an embarrassed look as she held my hand. This reminded me of our time together ten years ago after my promise to become her knight, she was always embarrassed around me.I felt a little emotional after witnessing her small hands grow this large. [I am also looking forward to our sparring session later today. I will definitely not lose. I wont give in when Renoirs style has been tarnish.] (Selene) She is surprisingly unwilling to give in. Unwillingness to be defeated is a necessary trait of an adventurer, however I cant stay silent at this either. . . . The two of us entered a store to purchase the basic equipments necessary for Selene. The basic equipment for a crusader was a one-handed sword, a shield, armour and a helmet if necessary. Yesterday I equipped my spare one-handed sword and armour and tested them. The sword was comfortable enough for me to use without discomfort. Similarly for the spare equipment, it was a flexible armour with anti-blade properties and has excellent properties against fire and ice still felt comfortable to put on. Since shields were sold everywhere, I came here as the store looked to have high-quality equipments. In the meantime, if there were any good equipment being sold in the meantime I would buy them as a spare. Since we have plenty of savings after all. [Uncle Youya prefers leather armour to metal armour even after all this time. Even now you are looking enthusiastic. Me and the knights often only wore metal armours.] (Selene) [The skins of monsters and dragons more often than not are more durable and provide more protection than metal armours. Plus they are light and easy to move about in. Since I live and die by my blade, my sword is my lifeline and there arent any armour that can completely protect you from a sword. In the first place, if you were to wear heavy metal armour it would be difficult to go on adventurers isnt it? We would probably have to walk continuously for countless days and tens of hundreds of kilometers. You would collapse before you even got to fight any monsters.] (Youya) After listening to my words, Selene placed her hand on her chin and went into deep thought. [After your explanation now it makes sense. It would be fine if it was a half a day hunt or at best a full day, however if you were a competent adventurer you would be spending most of your time in the dungeon. In that case it would be difficult to wear metal armour.] (Selene) Unless you were a beginner, adventurers whose lives depend on their adventuring activities would never use metal armour. Your armour which was supposed to act as a safety net would become your biggest enemy. Even if you were to travel with light metal armours, only the vital areas would be protected by the armour and exposing other areas of your body. However there are still exceptions to this. There are super lightweight metal armours that exist with incredible durability. That metal was dubbed the Steel of God and it was the metal used to craft Renoirs shield. The armour that Leonard was wearing is also made from the same steel. It was probably the armour he got from the Tower of Trials. [Ive seen many good equipments in my time but there are also many impressive equipments here. Shall we take a look at their shields?] (Youya) [Yes. Lets do that uncle Youya.] (Selene) Selene walked over to the section where numerous shields are lined up. Although they are often generalised as a shield, there are many different types of shields. Such as a large two-handed sword or a one-handed shield. Besides their sizes, there are also lanturn shields with blades or spikes attached to them. Selenes attention was completely focused on one shield among the line of shields. It was a round shield with a buckler in the center. The legendary Renoirs shield was also a buckler, so its wasnt surprising that her attention was caught by it. [I think that either one of these two shields are good. Which shield is better?] (Selene) Although the two shields looked the same, the left shield was made of mithril while the right was slightly larger and made of adamantite. [It seems so. I would prefer the left although the right shield seems better in terms of hardness. Mithril has a higher defense against magic and its lighter, making it easier to handle.] (Youya) [I agree. Then Ill take the left one. Although isnt it really expensive to use mithril? Is it really okay to spend this much money?] (Selene) [Its alright. There is a need for such a shield and the amount can be recovered easily from your contribution to the party.] (Youya) The shield costs about the same as Lunas dagger and Tils bow added together. However, it is a shield which we will be betting our lives on, I have no intention to skim out on this. [I will definitely be sure to return your kindness with my work.] (Selene) Selene brought the shield to the shopkeeper as I paid him the amount. The store owner smiled and said. [Both of you seem to be excellent adventurers. Our shop is capable of applying magic coatings onto the shield, would you be interested in one?] (Shopkeeper) [Hou. Youre able to apply magical coatings. Please do so.] (Youya) Magic coatings was a type of coating that raised the equipments defense against magic by apply magic power and binding a thin layer of metal over the shield. However, since the plating wears off after receiving several magic attacks, it is necessary for us to periodically restore the coating. However it is still a useful process since it gives the user several chances to defend themselves against magic attacks. [Roger that.] (Storekeeper) [Is it possible for you to apply the coating to another equipment other than the shield that we just bought?] (Youya) [I dont mind, however itll be fifty extra per equipment.] (Storekeeper) I had an idea after the storekeeper mentioned the coating. If it was a magic coating, would it be possible to cover the Laluzulu emblem on the shield? [Have you heard about the rumors that the Laluzulu Kingdoms princess, Princess Lutra was eaten by the Starfish Larvae?] (Youya) We heard the rumors float around in the bar yesterday during our dinner It was normal for a national incident such as this to have rumors float around, however it feels too early for the rumors to be spreading. There is the possibility of someone spreading her death deliberately. [I have heard about that rumor.] (Storekeeper) [Truth is, we picked up a shield that most likely belongs to her in the forest of God Trees and it would be troubling to use it with the rumors spreading around.] (Youya) [Well of course you would be.] (Storekeeper) [Could you apply a coating onto the shield as we cant use it with the emblem on the shield?] (Youya) From the storekeepers point of view, this excuse would be expected. If we were discovered with the shield, it would be likely that the kingdom would ask us to return the shield, furthermore the store owner would also be deprived of a potential business deal. [I dont mind. Show me the shield.] (Storekeeper) I took out the shield from my magic bag and handed it over to the storekeeper. [Hmm its a good shield. Just wait a moment and the shields will be ready in about two hours.] (Storekeeper) The storekeeper went to the back and prepared a receipt for us in advance and went to the workshop that was within the store. While we were alone, Selene opened her mouth. [Uncle Youya.. Why did you do that?] (Selene) [If there is a magic coating then there is the possibility of using your shield while hiding its materials and the crest. Like this, the mythril shield that you chose will be even more important as youll have to keep your shield once the coating wears off. No one would suspect anything if you took out a different mythril shield after one becomes worn out.] (Youya) [But doesnt this mean that the storekeeper now knows my shield is in your possession?] (Selene) [Dont worry. First-rate craftsmen do not talk about personal information of their customers. I can tell that shopkeeper is a top-tier craftsmen.] (Youya) You can tell a first-rate craftsmen just by looking. It should be safe for us to trust this shopkeeper. [Ah so thats the case. Im surprised at the development but Im also glad I will be able to use a shield i am familiar with. Is it possible to coat the sword as well?] (Selene) [If you try to coat a sword its sharpness will decrease and it will become blunt.] (Youya) [Well that would definitely be difficult.] (Selene) This is precisely the reason why it is a coating technique that can only be done on a shield. It is also possible to do it on an armour however it is much more costly. Plus my spare armour would have a better performance anyway we need not force ourselves to get a new set of armour. Now Im looking forward to our completed shields. . . . After bring the purchased items back to the inn, Me and Selene were completely equipped standing in the courtyard. It was time for our sparring session. [Are you seriously going to battle me with just a shield?] (Selene) [Ah. Just like how the legendary battle princess Renoir did, I have shield on my right arm and a free left hand.] (Youya) For this battle, I am borrowing Selenes shield which was passed down from the legendary Renoir herself. It was originally a silver shield made from the Steel from god however thanks to the coating it looks much more metallic. Its shape was just slightly larger and thicker than a standard round buckler. However, its true potential lies in the holes several centimeters in diameter at the bottom of the shield. Just as I remembered it in the game. I poured some mana into the shield to test my theory and the shield responded as I imagined. I borrowed the shield from Selene yesterday to practice the shield-style of battle as well as how to channel mana in many different ways. For equipments that require mana to function, each of them has a unique gimmick which has to be performed properly in order to activate their abilities. As I have encountered several different magic swords, Ive managed to pick up the correct way to channel mana as well as how to do them appropriately for different magical items. [I dont know what or how uncle Youya plans to defeat me using Renoirs supposedly true battle style, but I will strongly utilize the sword of the Laluzulu kingdom that has been drilled into me since I was a child. This is the true battle style used by the legendary hero.] (Selene) Selene was holding a shield in her left hand and a wooden sword on her right. After several preparations, the battle has finally begun. The rules for this battle was simple. The first one to land a blow on their opponent is the victor. For me, that would be to pierce her using the buckler, however my buckler has a short range as compared to her sword. I was at an extreme disadvantage.. If the battle princess Renoirs shield was a normal shield that is. [Now then, come at me anytime. Or is Selene just all talk and afraid of attacking on her own?] (Youya) [Your intentions are as clear as day. However I will still bite it nonetheless.] (Selene) Since my opponent has a wooden sword, I cant just recklessly charge into her range. I closed the distance slowly while carefully observing her movements to watch for her attacks preliminary movement and prevent it with my shield. A capable fighter using a sword and a shield will most likely use their shield to create an opening while countering using their sword to attack. A buckler was small for a shield, however in exchange its handling and ease of usage increased thanks to its small size. Now then, since the match wouldnt be exciting if we were just waiting around like this, I increased the pace of the match, rushing and quickly entering within range of Selene, throwing her tempo off. While her stance was thrown off by the sudden change in pace, she slashed with her sword. Using the buckler and its roundness, I passed the blow to the side. Compared to a sword, the buckler was much closer to my body and slightly larger, making it easier for me to deflect her blows. The buckler might unexpectedly suit me. I properly deflected Selenes attack using the buckler. The battle princess Renoir used her buckler in her dominant hand, making it easier for her to maneuver and increase her charging power while at the same time increasing her defense by having a shield on her dominant hand. I carefully observed Selenes sword. It appears that she was avoiding releasing a heavy blow in order to preserve her balance and form. As a result it allows her to release strong and accuracy blows, piling up sharp attacks one after another . It was interesting and at the same time a powerful way of utilizing a sword. [Uncle Youya, your defense is as amazing as usual. However, it isnt a method of attacking in the slightest.] (Selene) I replied Selene as I deflected another slash. [Thats because I havent gotten into it yet. I just wanted to understand your fighting style while observing your capabilities. There are still things I have yet to show you. 7 times. Do you know what this number represents?] (Youya) [What is it?] (Selene) [The number of times I could have killed you in this round.] (Youya) Selene took a deep breath as she launched another flurry of attacks. This time, the openings she had were gone and her attacks became much heavier. I knew about it from the start, that her swordsmanship was likely a little below a top-class swordsman. It is easily understood from how she was raised and how long she has been training. However, her spirit was still far from a top-class swordsman. Equally important to your techniques, your spirit was something that hard to be honed as well. Now then, Im pretty much done with grasping Selenes sword style. Its time to finish this match. Shields were always meant for receiving attacks, however it is also possible to use them for launching attacks. [Lets do this!] (Youya) It was a chance for me to counter by opening a gap with force. I used my buckler in a swift manner and swept her sword with a backfist, knocking it away with the back of the buckler. Selene dug her foot into the ground and launched herself backwards trying to open up a distance between us. However it backfired and instead opened a large opening for me. Utilizing Gods Strength to increase my speed to a godlike level, I lunged towards Selene. Twisting my waist, I transferred the energy to my shoulder then to my arm, aiming to strike Selenes forehead with my buckler. Before the buckler collided, I immediately activated the hidden function of Renoirs shield. As my arm stretched towards Selenes forehead, a roar could be heard from the shield as a thick pile spike made of Steel of God appeared and stuck out from the bottom of the shield at the speed of sound. This is the special gimmick within the battle princess Renoirs shield, the shield that was used for both defense and offense. The tip of the spike, with the double acceleration from Gods Speed as well as their release of the spikes close to sound, stopped right before impaling Selenes forehead, with the tip of the spike slightly splitting the skin on her forehead. A gust of wind blew as blood flowed down her forehead and her beautiful hair danced in the wind. It was the end of the match. Selene lost all strength in her legs as she fell to the ground from the shock of the spike. [Ah.ahh.ahhh. Its not blown off. My heads still here. Im properly alive.] (Selene) She was in shock to the point that the blood drained from her face and her facial expression was completely frozen. She clearly did not expect that a spike launching at the speed of sound would not strike her between her eyebrows, knowing that if the blow had connected, her head would have been blown off. [This is Renoirs original style of battle. Overwhelming her opponents with her speed and power, breaking down their defense before feeding them to her spikes. She also wore a gauntlet on her left hand, however lets leave that for another day. Having spikes in a shield is quite a convenient thing. Just like this, when receiving a heavy blow, you can pierce the ground with the spikes and firmly root yourself to the ground. Once you learn to place your entire bodys strength into this form, you can stop an opponent several times your own weight. If I were to teach you, Selene you would be able to use this in no time.] (Youya) The spikes were extremely useful both for offense and defensive. Its a pity that this gimmick was lost to the kingdoms history. I will be sure to teach Selene how to utilize her magic power in order to activate the shield of Renoir in its original manner. Selene seemed to receive a shock far larger than I imagined as she continued to stay on the ground without moving. After a brief moment, the sound of water flowing could be heard as a pool of water formed around Selene who was in a girls sitting position. It seems that stopping the spikes right before her forehead was much more frightening that I thought. [Well, uhm. I was expecting to give you a shock but I didnt think it would have that much of an effect. Lets return to the inn. Ill prepare hot water for you.] (Youya) Colour returned to Selenes face as her expression changes and her face became reddish. [UWAHH I WAS SEEN BY UNCLE YOUYA UWAHHH] (Selene) Selene began to cry uncontrollably as she was embarrassed from being seen wetting herself. It seems that I overdid it. What should I do? I pinched my cheeks as I was troubled about what to do. Lets return to the inn for a change of clothes. Its a good thing that she bought a change of underwear earlier this afternoon. Volume 2 Chapter 11 Yesterday, I had a conversation with Selene about how her ancestor, the heroic princess Renoir used to battle with a single shield. However she was unconvinced and as a result we decided to have a mock battle between the two of us. However, I had pulled the rope too tight in our battle. Although I managed to stop the spike in time, Selene had the impression that she was struck by a high-speed spike through her head when in reality, only a small chunk of skin on her forehead was grazed. As a result of the shock, she accidentally wet herself in the courtyard. The material used to produce the spikes from the shield was a special liquid made of Steel of God. Its shape and hardness could be altered by passing magical power through it. That is how a thick and long spike larger than the buckler itself can be produced. Currently, we were in our room at the inn while Selene was changing her clothes in the back room. She had suffered damage to her pride earlier both as a knight and as a girl by losing not only the simulated match but also peeing in shock at the end. I was pondering on how should I approach the situation while taking care of our swords in the room. Without noticing it, the futon in front of me began to wiggle. [Youya, Luna is finally energetic again! Never drinking alcohol again.] (Luna) It was Luna. I learnt that it was easy to understand Lunas physical condition just by looking at her tail. This morning while she was suffering from the hangover, the fur on her tail had shrunk but now the tail returned to its usual fumofumo shape with much larger volume, indicating that she was feeling better once again. [Im glad you have recovered. How is Tils condition?] (Youya) [I dont feel fine but its better. My head still hurts. I cant believe Youya and my elder sister are drinking such poisons so often.] (Til0 [That is because you both drank too much. Its much better if you drank in moderation. It was fun when you are drinking, wasnt it.] (Youya) Luna and Til began to recall what happened last night. [Uhn. Just as Youya said. Luna felt *pokapoka* while she was drinking, it was fun.] (Luna) [Now then you mention it, youre right. That could have been my first time feeling such a way. Luna, Next time lets be sure to stop at 3 cups!] (Til) [That sounds good but the world began spinning on the fourth cup. It would be fun if we just drank three cups. But having the world go *gulugulu* and *guaa-aaa* was super fun too. If it didnt hurt this much the next day I would do it again!] (Luna) The two of them seemed to be enlightened about drinking alcohol, although they may be getting a little too excited. The next time we have a drinking party, itll be fun if the two of them could get used to drinking alcohol. However if the two of they overdo it again I can always just bar them from drinking again. The door opened and Selene returned from the back room. It looks like she finished cleaning her body and changed her clothes. It was a good thing that we had bought a change of clothes before the sparring match .Although she wasnt wearing anything fancy, her fashion sense was good. [Uncle Youya, I accidentally showed you an embarrassing act.] (Selene) Her face started turning red. As expected it seems to be difficult for her to adjust in such a short amount of time. [Dont worry about it. Honestly, that kind of stuff happens often when you are going out on adventures.] (Youya) [Is it supposed to be comforting that we will be embarrassed often.] (Selene) From incontinence to vomiting and other harsher things like drowning in dungeons, there are many other worse things that can occur in a dungeon. Before meeting Phil and Leonard, I had experienced numerous such incidents to the point that I can say that I have experienced hell. There was an incident where a party of adventurers I was in had dived into an underground-type dungeon for several days, and in the midst of the chaos inside the dungeon, one of the men had attacked another woman in our party. Another man who was in love with the woman fought the other man to protect her, however the girl in her frenzied state mistakenly attacked and murdered the man who fought to protect her, tried to run away before getting caught in a trap and dying in front of the entire party. The man who had initially assaulted the woman was also in love with the woman, and as a result of his grief, he voluntarily charged into a monster and lost his life. As a result, I was left alone in the depths of the dungeon, prepared to die for several days. The dungeon was at a level where a party of four would be able to barely get by by working together, at the time I didnt think that I would had make it out alive on my own. However it was at that moment that I came across another party, and pay them in exchange for allowing me to accompany them all the way back to the surface. Compared to those days, these sort of incidents actually felt pleasant instead. It was also because of this that I do not plan on accepting any other men into the party other than myself. In a desperate situation it is easy for a person to throw away any sense of rationality. Ive seen that happen so many times that I actually think it would be better to have a larger number of one gender rather than a gender equal party. I have also heard about how sexual activities help the party to alleviate their stress in a dungeon but that sort of stuff is still too early for Luna and the girls. Until my eyes turn black I will absolutely never let that happen. [Well I wont allow such an incident to happen when we are exploring in the dungeon, however be sure to keep your spirit under control during a sparring match and strengthen your mental strength. Carve what happened in our sparring match into your mind and remember it. After all, we even went out of the way to apply coating onto your shield. I hope that you will eventually be able to use Renoirs shield effectively.] (Youya) Even now, Selene is growing one step at a time. She was above an average adventurer as a combat resource due to her status as well as her exclusive class. However i do not plan on forcing her to adopt Renoirs style of battle but I do hope that somehow she will be able to incorporate Renoirs spike into her fighting style as its a shame to let the spikes go to waste. Ill be trying my best to help her in the meantime. Even if she were to use the spikes in public, no one would notice that it was a feature from the shield of Renoir since even Selene who was princess Lutra herself didnt know about it. [Thats so.. I will be sure to make use of that spike. Youya, its a shameful request but even with your explanation, I am unable to understand how to utilize the spike. Is it possible to go over the spike once more afterwards?] (Selene) [If its something like that then I wont mind. Lets practice together.] (Youya) In any case, I am glad that her mind wasnt broken by the result. The end of the battle could easily be at a level of fear for her own life. It will probably be impossible for her to have another sparring match with me but it should be fine if its on the level of a training. Luna who felt energetic after recovering from her hangover came over and sat on top of my lap. [Luna, what do you plan to do?] (Youya) [Its unfair to only talk to Selene. Luna wants to talk with Youya.] (Luna) [Sure. What do you want to talk about?] (Youya) [Uhm. You see.. Yesterday Luna couldnt do a sparring match. Now that Luna has recovered, Luna wants to do 2 matches!] (Luna) [I understand. Then Luna can go ahead and change your clothes, Once youre ready we will begin.] (Youya) [Uhn. Today Luna will finally win! Its frustrating not to win once Youya starts attacking.] (Luna) Lunas sparring match was a daily routine for us. We will ending the training today with two mock battles. Previously it was a one-sided offense by Luna whose goal was to land an attack on me. However she has improved so much to the point that it became difficult for me to keep up, thus I changed the rule allowing me to counterattack if there was an obvious opening for me. But that just merely increased her motivation to win the sparring matches. Luna was still a genius who was growing at a tremendous rate. [Luna, when I asked you to change your clothes I meant that you could head to the back room to change.] (Youya) [Bothersome. Luna wants to hurry up and train.] (Luna) Luna began changing her clothes on the spot. Nothing I say will change her mind so I gave up trying to convince her. Selene asked Luna. [Luna, arent you afraid of the match? His one blow from our match. It was so powerful and quick.. The only thing I could see was my impending death.] (Selene) [Youyas sword is amazing! Just the sword is scary but wooden swords arent scary. If Luna gets hit by his wooden sword then Luna may die. But Youya is amazing after all. Luna believes that Youya would never harm her. Is Selene afraid?] (Luna) Luna looked at Selene with innocent eyes. [ A little.] (Selene) [Then you can just tell Youya that you dont want to train with him anymore. Although its weird you dont want to train with him although you trust him.] (Luna) Lunas words were both harsh and strange however that was just how she felt towards Selene. Luna finished changing her clothes and picked up her wooden sword before wagging her tail. [Youya. Luna is ready!] (Luna) I crossed my arm and picked up my wooden sword. Right now, I cant think of anything to say to Selene although I couldnt bear to see her in this state. Ill be sure to follow up with her once I come back. I stood up and headed towards the courtyard. [Wait a moment!] (Selene) Selene shouted with a loud voice. [Im coming as well. I would like to watch Lunas training as well as your mock battle.] (Selene) [I dont mind.] (Youya) [Luna too.] (Luna) With this, I headed over to the courtyard for a second time today. . . . For Lunas training, we had to select another type of slash for her to practice as she had just recently mastered both the thrust and the Yokonagi. In addition to her repetition training, we had just added another slash, the Kesagiri. It was a slash that began from the persons upper body, heading downwards. Since it was assisted by gravity, it was a powerful blow that was easy to learn with high power. On the other hand, it required different muscles from the thrust and the yokonagi, so it should take some time before Luna completely masters the slash. Even so, she is a natural with the blade. She improves tremendously day by day. She will most likely take three more days to master the kesagiri slash. To help her training progress even by a second, I performed several demonstrations and explanations until she got the hang of it. Selene watched this scene from the start to the end. [Youya, the lesson finally ended! Time for the match!] (Luna) Luna said with a energetic voice as she loved our simulated battles. It is definitely much more fun to train when you are able to feel yourself improving everyday. [As usual, today youll be trying to land one hit.] (Youya) [Will try my best!] (Luna) Luna quickly got into her stance. Just by looking at her stance, I could see her growth. There wasnt any openings however it was easy for her to transition into an attack. It was the stance that she came up with in order to defeat me in an actual battle. I flipped a coin into the air. It was our bell as the battle starts the moment the coin lands on the ground. Now then, I wonder how will Luna fare today. . . . With this, the second match has ended. Luna who gave her all for both matches was exhausted and fell to the ground. [Ug.. Luna didnt land a single hit today and got hit so many times too.] (Luna) [You were close to landing a hit today. Out of your twenty chances you nearly got me in ten of them.] (Youya) Whenever Luna showed an opening, I would immediately counterattack with an attack of my own. It was to prevent Luna from launching reckless attacks and think about defending herself in the midst of her attacks. This would eventually resulting in nullifying her opponents attacks as she will be able to react even when an opening is shown. [Its frustrating that Lunas attacks cant reach. Youya has no openings. Luna tries to open an opening by attacking but that opens an opening for Luna.] (Luna) [That is the correct train of thought, but its much harder to execute than it is to come up with it. Learn to come up with the combinations of attacks required mid battle and you will improve.] (Youya) Recently, Luna has begun to mix in feints with her attacks. However, I made sure to counterattack when she made several naive feints lest they become a habit. [Tomorrow Luna will do her best!] (Luna) Luna had the sixth sense of a genius, however her greatest strength came from being a graceful loser. She doesnt just try to apply what she learnt during her training, but think of the next step on her own and try to improve on her own. There are very little people in the world who would be willing to do this on their own. I have trained many people up to now, and once a swordsman becomes afraid of advancing on their own, they will become passive. As a result, their growth halts to a standstill and repeat the same mistakes without improving or learning from them. A mind that is critical of failure while active in learning from them. That was the secret to Lunas growth. [Selene youve been watching Lunas training the entire time. Did anything come to mind?] (Youya) Selene had watched Lunas training with serious eyes, especially glued onto Luna. [ I feel ashamed of myself. Even though a young girl such as her is trying her best, Im sitting over here cowering in fear. I was naive and overconfident and I wont become any stronger like this. Furthermore Ive understood what her words meant. It is strange for me to trust uncle Youya but not in a sparring match. Even with a wooden sword, uncle Youyas attacks were sharp and powerful. However, it didnt matter how many times she got hit. It was as if she was absorbing your techniques and making them her own. Even if she is still a small girl, she is strong.] (Selene) Looking over at Luna, her face became reddish as she was weak to praises. [Uncle Youya, once more I hope you will continue to train me. Of course with mock battles included. Its confirmed after watching this girls battle. Uncle Youya will definitely be able to make me become stronger.And I have made another resolution. I will definitely pick up the battle princess Renoirs style with the shield, and become stronger as a crusader.] (Selene) [Is that really alright? Youll be throwing away everything you learnt your entire life.] (Youya) [I wont throw them away. The sword will always be a part of my battles. Even if the technique changes, the foundation is still the same. I am sure that I will cower once more, but at that time I will definitely overcome it so please be sure to guide me then.] (Selene) I let out a slight smile as Lunas hard work seem to have resonated with Selene. That will be a precious experience for Selene. [I understand. Ill properly beat the hidden power of Renoirs shield into you. Tomorrow we will have another mock battle. Can you do it?] (Youya) [I can. Ill be sure to prepare a change of underwear for tomorrow.] (Selene) I was surprised to see Selene crack a joke and smiled wryly. That was how Selenes special training began. Today we will focus on her training for tomorrows mock battle. As long as there is the courage to stand up, the fear will one day be overcomed. [Ughh. Luna and Youyas time will be reduced, but Luna will endure it as a senior.] (Luna) Luna said some interesting things in a strange manner. Me and Selene started to laugh. . . . The next day, we entered the dungeon of God Trees. The monsters and treasures have respawned and the number of adventurers were higher than ever. Yesterday, Selene had devoted her training to using the spikes as well as the foundations of being the front line of the party. She will be showing the results of her training in our adventure today. Our partys overall strength will definitely increase with a tank as well as a healer if we fully utilize her power. Lets try our best to wield the power of our four-men party together. Volume 2 Chapter 12 Today our main objective was to go on an adventure in the labyrinth within the Starfish Larvae. It is our first adventure as a party of four consisting of the Crusader Selene, the Thief Luna, the Spirit Archer Til and me, the Magic Knight Youya. With the addition of a tank cum healer Selene, our partys safety net has become much safer and stable than before. Luna and Till were energetic as usual and Selene was ready to leave, dressed in my spare dragon skin armour with Renoirs shield on her dominant right hand and a gauntlet on her left. She also had a spare sword hanging on her waist. It was an indication of her conscious effort to pick up Renoirs battle style. The sword on her waist was not her main weapon but rather a spare for the absolute worst scenario. In this world, there was a weird interaction when a person was capable of wielding two different weapons on one arm. Only the first item would contribute to the users status. In Selenes case, it was the gauntlet. Whenever the user switches their equipment in a dungeon, the users status would remain the same although they were using a different weapon. Hence, even if Selene swapped out her gauntlet with a sword, her status wouldnt have a rise in attack power. [Everyone our goal today is to enter the Starfish Larvae once more.] (Youya) Since it was the day after respawn day, we didnt have any difficulty in hunting monsters in the forest of God Trees. However, it is necessary for us to enter the labyrinth at least once to determine how much the hand of the pendulum clock has moved in this period of time. This would allow us to estimate when the egg will spawn in the forest. [Uhn. Luna is confident. Since the last time Youya has taught Luna a lot of things about traps and stuff.] (Luna) [Today we will be sure to complete the dungeon before our bodies become heavy again!] (Til) The last time we entered the labyrinth, the two of them were completely overwhelmed by the sheer number of traps and its curse. By the time we had arrived at the exit, the two of them were exhausted and were in a terrible state. This time they looked much more confident about conquering the labyrinth. Feeling relaxed and being confident is a good thing, however if the tension from the labyrinth was diminished and they were to get caught in another trap, there wouldnt be a reason for us to laugh anymore. I can only hope that they would concentrate when we are in the dungeon. [Are you okay Selene?] (Youya) [Im fine. There isnt any problem, Im just a little intimidated.] (Selene) [Understood. Dont push yourself.] (Youya) Previously Selene was betrayed by her bodyguard and shoved into the Starfish Larvaes path, accidentally entering the labyrinth and went through a frightening experience. While we were hunting monsters in the forest of God Trees, our target, the Starfish Larvae appeared in the distance. To avoid being eaten, the surrounding adventurers began to disperse and search for the closest God Tree. Soon after, the adventurers around us were completely gone and we began to walk towards the Starfish Larvae. The massive creature began increasing in size as its green outer shell with a pattern resembling an eye became more and more visible. Its mouth devouring everything in its path. The fear it appeared to instill was bone chilling and so intimidating that only someone who knew about the labyrinth would stand in its path. Luna and Til began clinging onto my arms while Selene pressed her face against my back. This was the case if you were extremely frightened to the point that you arent able to move, but looking at it is actually a beautiful pattern. The Starfish Larvae was finally approaching us as our surroundings was blocked by the sight of its mouth. [It could actually be this fear that is preventing any rumors about the Starfish Larvae and the labyrinth in its stomach. For anyone else to even attempt this would mean suicide and the person who mentioned the labyrinth would be delusional.] (Youya) While we were swallowed by the Starfish Larvae, I muttered to myself. Not just that but the people who miraculously got eaten and survived the labyrinth would recommend everyone to run away to prevent getting eaten. It was impossible to think otherwise. It is impossible to attempt entering the labyrinth unless it was a game where you would be able to put your life on the line to verify it. Furthermore if someone were to attempt to get eaten while the Starfish Larvae was enraged, the person would only have death waiting for them. Now then, the labyrinth in the Starfish Larvae. I hope we will be able to exit quickly this time. . . . I opened my eyes. The three girls were still grabbing me tightly. [Ladies? Its already over, weve entered the labyrinth. Could you three please let go of me? I cant prepare the light crystal like this.] (Youya) [Uhn. Understood. It was scary.] (Luna) [Fuu.. Its as bad for your heart as ever.] (Til) [I concur Even if we know whats coming, it still takes a lot of courage to stand in the Starfish Larvaes path.] (Selene) After everyone let go of me, I took out the light crystal from the hidden room, revealing our surroundings and the labyrinth. [Luna and Selene, both of you take a light crystal. Til, Im sure you dont need one?] (Youya) [Of course since I have these jade eyes of mine.] (Til) I was envious of Tils special jade eyes. Even in pitch darkness she is capable of looking at the surroundings. I tied the light crystal to both Luna and Selenes heads. [There are even items that are as convenient as this.. Even without mana it is capable of shining continuously.] (Selene) [It is a pretty rare magic tool. If you lose it we dont have a replacement for it nor can we replenish our stock so please take good care of it.] (Youya) Selene nodded her head with a determined look. Although it is possible to replenish our light crystals by heading to the level reset room, but it would be impossible for us to reset our levels if we depleted the light crystals in the room as it was required to activate the level reset function. In fact, I had even left light crystals in the event that there are other adventurers who discover the room. After our conversation, we got into our party formation. Luna was at the head with her exploration skills. Right behind her was Selene while Til was all the way at the back while I am in the middle. This way, it would be easier for me to react and deal with any trouble that comes to us, whether it was the front or the back. [Luna, look at the ground directly in front of you. There is a trap two steps ahead of you. A colour difference in the ground is the characteristic of a pitfall trap.] (Youya) [Now that you mentioned it, it looks obvious. However, isnt there a chance that the ground happened to look different?] (Luna) [Whenever the colour of the ground changes to indicate a pitfall trap, the area of the ground would have an unnatural change in colour similar to a square area. It is unlikely that this sort of colour change would happen naturally.] (Youya) [Ah. Thats true. Its easy to understand.] (Luna) I explained the method to distinguish a pitfall trap in the ground. Although it was possible for her to learn the skill Trap Detection, but as demonstrated it is possible to detect a trap based on experience and knowledge. I would prefer to use her skill points on something else. [Luna, did you level up the skill I told you about yesterday?] (Youya) [Uhn. I levelled Increased Drop Rate to level 2, the maximum I can.] (Luna) [Thats good enough, itll help us tremendously.] (Youya) Increased Drop Rate functioned exactly as its name implies. With each level, the drop rate of an item is increased by 0.2 times. Once you raise it to level 10, an items drop rate would increase to 3 times its original drop rate. Basically tripling our harvest. There isnt any reason to argue against taking this skill. It was a skill that everyone wished to have, however the prerequisites for taking this skill is quite a troublesome task. It cant be learnt unless the total skill points placed into the exploration tree is 20. In Lunas case, she had 10 points into Presence Detection, 5 into Lockpick and 5 into Treasure Sense. Lunas current level was level 23 and her total number of skill points were 27 from leveling up 22 times and her initial 5 points. She was only able to get 2 points into Increased Drop Rate as 20 points were focused onto the exploration tree and 5 points was placed into Assassinate. In the case of an ordinary Thief, they had two skills that they had to learn in order to become a reliable fighting force. One skill to increase their chances of inflicting an abnormal status as well as a skill to increase their attack multiplier whenever their target has a status abnormality. As they required multiple skills just to participate in a battle, they did not have the leeway to place 20 points into the exploration tree, hence the skill wouldnt even appear in their skill tree at all. Speaking of which, there was no definitive proof about the prerequisites for the skill in this world Furthermore even if someone discovered the skill, they wouldnt tell anyone about it. Adventurers wouldnt easily reveal their skills especially something as valuable as this. [From now on, you will put skill points in Increased Drop Rate until it is level 10. It will completely change how efficient our hunts will be from now on.] (Youya) [Lets do it! Lets earn lots of experience to level up. With Youya around it wont be long.] (Luna) I smiled bitterly at Lunas response. Normally it would be hard to raise our level beyond level 20. The experience required for us to level after level 20 increases dramatically, causing the majority of adventurers around the world to be about mid twenties. Furthermore the monsters in this level will become more ferocious and difficult to hunt.. Thanks to the large competition and difficulty of the monsters, it becomes much harder to raise our level. However, in that regard, we have a dungeon such as the labyrinth in the Starfish Larvae that makes it much easier for us to find monsters. Without the labyrinth, raising our levels at this point would become much harder. [As we discussed yesterday, Ill have Selene act as our partys shield. It is a difficult role. Put your spirit into it.] (Youya) [Leave it to me. Being the partys shield is the best job for a crusader. Ill show you that I can do it.] (Selene) Selene gave a reliable response. With this, our party continued into the labyrinth with Luna guiding us. . . . Since we were travelling on a different route from the last time, the number of monsters present here was plenty as they hadnt been thinned out at all. We quickly encountered our first group of monsters. Twenty metres ahead of the straight path stood a small group of Horned Boars. It was a monster that greatly resembled a boar which we also hunted for our Pork (Average) collection quest. Back then there was an entire herd, however this time there were only four of them sleeping soundly. If it was just four of them, we could annihilate them with magic and arrows from Til before they could notice us, However, in order to let Selene act as our shield, we decided to attack them front on. It was our first fight together with Selene. I couldnt look forward to having our first battle in a situation where we could be wiped out due to our tank being inexperienced. First we had to have a battle where it would be safe for Selene to fail. Selene walked forward towards the monsters, however she had not noticed that the Horned Boars were soundly asleep. [War Cry] (Selene) Selene activated her skill as a high pitched shrill echoed throughout the path. It was a skill that caused a foe to focus their aggression onto themselves. Warriors and Magic Knights were both capable of casting War Cry, however whenever a crusader activates that skill, it gains a bonus effect where the monster would have an increased aggression towards them and a longer duration.. The Horned Boars woke up and rushed straight towards Selene who held up her buckler in response. No matter how high your defensive stats were as a shield, with this large of a distance and their large body, anyone receiving 4 charging Horned Boars would definitely be blown off, especially with a buckler. Normally that is. Selene poured her magic power into the shield and activated the special function of Renoirs shield. Yesterday, I taught her about the special liquid hidden within the shield. A variation of the Steel of God that was in a liquid state which could be solidified by pouring mana into it, producing a spike larger and longer than the buckler capable of piercing into the earth, rooting the shield into the ground.. This was the method that the battle princess Renoir resorted for defense. By firmly rooting yourself to the ground, you enable yourself to directly receive an opponents charge. Selene dropped her hips and leans her entire bodys weight onto the shield before activating another skill. [Fortress] (Selene) ( the kanji for the skill directly translates to castle wall but Im using fortress since it seems more fitting and mainstream.) The shield began to illuminate as the light stretched out several metres to both sides originating from the center of the shield. It was the special skill exclusive to crusaders that increased the effective range of the shield, your own weight, muscular strength, defense and magic defense, making it possible to defend against multiple enemies. Although its effects only lasted twenty seconds, this skill makes it possible to be a tank far superior to a warrior or a magic knight. It is a skill with a maximum level of 10, however it was a skill that was the very definition of a crusader. Having no intentions about running and acting as a shield for the party. In the next moment, a heavy crash could be heard as the four Horned Boars crashed against the shield and the light. The shock received by the light was transmitted to the shield as Selene gritted her teeth enduring the shock. The ground was gouged out as Selene was pushed back but her shield remains sturdy without any signs of losing her balance. After several seconds, the Horned Boars rush was completely halted. Luna and I rushed towards the boars at the left and right of Selene while the Horned Boar directly in front of Selene was shot by a barrage of arrows. After watching its companions being killed, the last Horned Boar tried to escape, exposing its back to Selene. Selene retracted the spikes and readies her shield. As I demonstrated in the mock battle yesterday, Selene took a deep breath and lowered her waist and before extending her arm, the spike protrudes from the shield at the speed of sound. With the double acceleration from the arm and the spike. It was the move that I used to defeat her during our bout last night, however there was just one crucial difference between her attack and mine. For crusaders, this blow could be strengthened even further. [Shield Bash!] (Selene) Shield Bash was the crusaders only attack skill. Its unique characteristic was dealing damage based on its users defensive strength instead of attack power and had an excellent power multiplier as well. Her defensive power which was raised by Fortress replaced her attacking power. A large gong resonated throughout the path as the spike penetrates the Horned Boar. It possessed so much kinetic energy that the insides of the monster was thrown out of its body and all over the pathway. [So much power.. Im surprised.] (Selene) More than the observers, the one who executed the attack was more surprised than us. This was the reason why the battle princess Renoir abandoned the idea of using a sword. Rather than using a sword and a shield, using a gauntlet and a shield would raise her defense power even further, increasing the power of Shield Bash. Her favourite strategy was to defend against an attack with her shield before killing him in a single hit with Shield Bash. This strategy had several merits to it. Her gauntlet had the effect of increasing the users magic power. If her magic power was increased, her recovery spells would become better as well. However, a gauntlet capable of raising the users magic power was rare. The gauntlet Selene was wearing is just a simple durable gauntlet. In order to make use of the crusaders special characteristic, using a shield and a gauntlet was the optimal loadout rather than using a sword. Yesterday, after listening to my explanation and after several discussions, Selene decided to adopt Renoirs style of fighting. [Selene, that was a good showing of a shield. The last move was good but catching their rush was good as well.] (Youya) [Its so easy to assassin enemies if they are not moving! Thank you Selene.] (Luna) [Maa. Im capable of hitting fast moving targets regardless. But its nice to shoot with confidence once in a while.] (Til) We can feel relieved knowing that we have a shield capable of attracting and holding enemies. With this, we can focus on launching attacks more than ever and our hunting efficiency will improve. [Having friends is a nice thing. Ive been having a lot more fun than usual. Now, lets hurry on ahead. I still need more training in order to practice this style.] (Selene) Selenes breathe became harsher with excitement. Although she looked much more mature than Luna, on the inside she wasnt that much different from Luna and Til. If she had a fox tail like Luna did, the tail would inflate and be waving back and forth. Nonetheless, she was still a reliable child. Lets continue to work hard for the party from now on. Volume 2 Chapter 13 With the addition of an excellent tank, our second adventure in the labyrinth was going so smoothly that it was incomparable to our first attempt. [Shield Bash!] (Selene) Selenes spike penetrates through a giant caterpillar with a green shell. Although it shared similar characteristics with the Starfish Larvae, it wasnt as large and was only about five metres in length at most. The pattern on its back was capable of intimidating its enemies and depicted eyes similar to a swallowtail larvae. It had two eyes that looked like jewels. Its name was the Terrafish Larvae Note I have no clue what the name is so I just came up with one myself. If anyone could confirm, its name is ʳx It was a rare existence that can only be found in the labyrinth of the Starfish Larvae with a small spawn chance. Unlike the Starfish Larvae there wasnt a second enraged phase that occurs once you defeat it, so we could defeat it with confidence. However,, it was still essentially a miniature version of the Starfish Larvae that is quite powerful. Selene activated Fortress and directly received the creatures charge despite its massive weight and speed. However, even after its movement came to a halt, Tils barrage of arrows and Lunas Assassinate couldnt damage it due to its hard outer shell protecting it and its vital points. Afterwards, we finally managed to defeat it by breaking an opening in its outer shell by using Napalm Strike and dealing the finish blow with Selenes spiked Shield Bash. After having its flesh completely gouged inside out, its body turned into blue particles and a red jewel drops onto the ground. It was the Terrafish Larvaes eye. [Youya. Its a weird item drop] (Luna) [U~wah. Its a beautiful jewel isnt it.] (Til) [It is but once you remember that it was the eye of that giant caterpillar, you dont even feel like picking it up.] (Selene) The name of the jewel is Insect Ruby. (Note: Again, Im winging the name. Kanji is xt夦礯) [What are you talking about. Insect Rubies can be used when creating equipments to enhance their magic power. It is an item that every magic caster and monk wants to obtain. Its also effective for crusaders. Lets make a custom-made gauntlet for Selene using this.] (Youya) When using a ruby jewel as material to create an equipment, an equipment with special properties can be created. Especially materials with high potentials such as increasing magic power are expensive and rare to obtain. As one would expect from a rare monster of a rare dungeon. The Insect Ruby was a rare item with about a 5% drop rate. It seems that the Lunas newly obtained skill has already started to show its effects. [Isnt it better to sell this kind of expensive items and divide the money among ourselves? If its just me reaping the benefits I will feel guilty.] (Selene) Selene mentioned without any intention of reaping the benefits for herself. [How did you come to the conclusion that we should sell it? It is a rare monster item drop you know. We could possibly never come across another one just like it ever again. There is no way that we can sell such a valuable item. Furthermore the stronger Selene gets the stronger our party becomes. It doesnt feel greedy at all for you to make use of the jewel.] (Youya) [Uhn. Luna thinks so too. If Selene wasnt here it would had been hard for us to get it in the first place.] (Luna) [Me too. I was completely shocked you know. The huge bug suddenly appeared and charged towards us. Even though I fired my bow and my spells. It was too fast and I wouldnt had made it in time.] (Til) [As they mentioned, it would have been bad if we didnt have Selene as our tank and shield.] (Youya) As the narrow path stretched out as far as we could see, it had suddenly appeared in front of us and began charging towards us. Since it was a huge caterpillar 5 metres long and is large in width as well, we had no room to escape in this narrow path. With a monster chasing us at a speed of about 70 kilometers an hour, it is impossible for us to escape. It was akin to living a nightmare. In such a situation, I am completely inadequate as a tank. It was a situation where I didnt have any room to use my Deflect and my abilities to their potential. Thankfully for us, we had an unmovable wall in Selene that was capable of receiving the monsters charge as a level 25 crusader. We are currently safe and alive currently because of her. Otherwise, in the face of that monsters charge, I would have no choice but to go all out and activate both my Gods Strength and open the door to survive that encounter, exhausting myself before we managed to arrive at the exit. [Selene, you did great managing to use Shield Bash after receiving that charge.] (Youya) [I was reckless. Until the end of the battle I couldnt feel the pain in my arms.] (Selene) Even though she was specialized in defense, as expected receiving that charge cause a large amount of damage onto her arm, if it was just slighter faster or stronger then she would had probably been unable to stop that charge. Selene began healing her arm with Heal. Luckily for us she was capable of casting recovery magic. With this, even if we were to get damaged during our battles we will be able to continue fighting. Originally, if we were to crack our dominant arms bones or our legs, that person would automatically be out of the battle. After finishing her spell, Selene opened her mouth to cover her embarrassment. [Its nice to know that people can rely on me as well. All this time I had been raising my level with a babysitter, the high-levelled knights that were in charge of protecting me would often be the ones battling the monsters. Doing my own battles feels nice for a change.] (Selene) As I reached my hand out to Selene, Selene gripped my hand and we shook hands. [Luna will do it too!] (Luna) [Ah Im part of the party too. Everyone in the party has to do it!] (Til) The four of us placed our hands together as we did a celebration cheer. It was somewhat embarrassing but it didnt feel that bad. We continued to carry this momentum all the way to the exit of the labyrinth. . . . [Arrived at the exit! Nano.] (Luna) [Todays trip didnt take very long did it.] (Til) The two girls held each others hands and began a victory dance. It was strangely cute to watch. [This feels like a dungeon that you can easily clear together with your friends if you knew what you were doing. Initially when entering for the first time, you would feel intimidated at the atmosphere and how dark it is. No matter how much you proceeded in the dungeon, it was scary to think that you might not even be heading in the right direction. But now that we know where the exit is, it is much more enjoyable.] (Selene) Selene arrived at the correct conclusion about the labyrinth. Selene new battle style was being sharpened with each battle and monster we encountered and I am certain that her power will be essential for our party in the future. It is impossible not to have fun when we are having this sort of adventurers in a party. That pleasure is something that I am fairly familiar with. [Now then, I still have a job to do. Selene, Luna, Til. Reflect on our battles today and what we should do in the future to better improve our coordination. Ill listen to the results of your discussion later.] (Youya) I could just outright inform them about my opinions on the battles earlier today, but that would be too easy. I would rather have them be more self-aware of their mistakes and strengths plus itll be more fun to help each other improve that way. Above all, our party would truly become a true party by communicating like this. Just like this, the scene of three beautiful girls talking to each other became much livelier than before. Suddenly I felt like I am glad that I decided to invite Selene into our party. However, Phil was going to catch up with us in a month. It could be even more exciting with five people in our party. By then we will have to somehow obtain that item that increases our partys maximum number of members. [Before that, I have to a job to do.] (Youya) I took a note of the hour hands current position before comparing it with the note I made two days ago. With this, I can roughly estimate when the magic egg will spawn. [Everyone. I managed to find out when the egg will spawn. It will spawn at midnight five days from now. And the star chart hasnt change the last time we came here which means that we know exactly where it will spawn too.] (Youya) The three girls who had their discussion interrupted turned their gazes towards me. [Hehh. You can really use this star chart and the clock to determine the location and time of the magic eggs spawn.] (Til) [Youya is an Esper.] (Luna) [Luna, Til. Im pretty sure that I have explained how they work the last time we were here..] (Youya) I answered with a slight nuance. Since It was the first time Selene had seen this, I decided to explain once more how the star chart and the clocks mechanism worked. [So its this sort of interesting concept. I didnt know that there was such a secret to obtaining the Magic Egg.. Using this you could obtain as many eggs you wanted.] (Selene) [That sounds about right. Although, if you have more than one Magic Pet in the party, the pets will go into a fight with each other and more often than not the weaker pets would escape until only the strongest one remains. In that regard, we only need to get one egg. Neither do we plan on staying in Greenwood forever.] (Youya) Theoretically, with this secret we could hog the magic eggs all to ourselves and sell the excess eggs to the auction house, securing our income for the rest of our lives. It was one of the goals for every adventurer to secure a living, however it wasnt an enjoyable method. I want to be at the top and enter dungeons that are much more difficult than this. [That side of you is why I like Uncle Youya.] (Selene) [Luna agrees! Luna doesnt want the same dungeon forever.] (Luna) [Uhn uhn. We will become the most successful party in the world so we cant be held down to just one dungeon. Wherever there are strong monsters, we will go.] (Til) I was happy at their responses and started to laugh as everyone looked towards the ceiling. For normal parties, there wasnt a single person who wasnt look for stability and safety. Well, although having the monopoly of the magic eggs sounds like a safe source of income, that isnt actually the case. Eventually, someone will catch on about the situation and you will be targeted by other adventurers for your life and information. [Yosh. Lets go home. We now know which tree and the date and time for the eggs spawn. Afterwards itll just be to secure the egg. With this much of an advantage it will be disgraceful if we didnt secure the egg.] (Youya) [Leave it to Luna! Climbing trees is Lunas specialty. Even if someone happens to eye the same tree as us, Luna will get the egg faster than anyone else.] (Luna) [Im looking forward to it. Luna is the quickest and lightest on her feet among all of us here.] (Youya) Speaking of which, foxes were always good at climbing trees. Looking at her ears, it looks like she was proud of her tree-climbing skills. [In that case, if someone happens to be there then Ill fire an arrow coated in paralysis poison towards them.] (Til) [Stop that. Theres a chance the person will actually die from the arrow. Supposedly the guy is part of a larger clan then they will definitely perform a witch hunt for us.] (Youya) [It was just a joke. Im not serious about shooting them with an arrow.] (Til) Til turned her head and puffed her cheeks. She was definitely serious about shooting that arrow. [Now then, lets hurry up and return. We have to eat dinner soon then it will be time for Luna and Selenes training.] (Youya) [Uhn. Do your best.] (Til) [Thank you for troubling you again uncle Youya.] (Selene) Aside from entering the dungeons, I was also preoccupied with grooming my two disciples. I have my schedule completely occupied. We have five days until the egg spawns. Lets continue to raise our level while training the two of them thoroughly. If we continue to exploit the labyrinth within the Starfish Larvae without competition, it is possible for us to reach level 30 in a month when it would normally take three years. If that happens, we will be able to travel to another town with a Magic Pet. Volume 2 Chapter 14 Our second adventure inside the labyrinth of the Starfish Larvae had just finished. With this we finally managed to identify when and where the next Magic Egg will spawn. Having this information was an absolute advantage for us over all the other adventurers who had zero information about the spawn. After returning from the labyrinth, we had a conversation about how we should spend our time until then. The consensus was to continue raising our level and train until it was time to obtain the egg five days from now. This is all for us to become the strongest party, plus Selene had to become stronger however little for her inheritance ceremony. . . . Currently it is the fifth day after we confirmed the spawn of the magic egg. The egg will be spawning at midnight tonight in the forest of God Trees. After spending five days in the labyrinth of the Starfish Larvae, my level became 26, Luna and Til was level 25 while Selene was level 27. It was an incredibly fast pace as we were able to continue hunting monsters without worrying about competing with other adventurers. There will not be another dungeon quite like this in the future. The first trip to the labyrinth was a rough one, however the subsequent trips were much easier as the girls were starting to become comfortable hunting in that dungeon. In addition we also had Selene who served as our tank in the hunts. The preparation we had to do for the Magic Egg was incredibly time consuming as well. Yesterday I spent the day investigating the area indicated by the star chart in the labyrinth to prepare ourselves for the spawn. Today too we will not be adventuring in the afternoon but rather after a light training session, we will be looking around the city to recover our physical strength and prepare ourselves for the Magic Egg competition. . . . [Its my victory today once again.] (Youya) [Uwwuu. Today I was unable to do it again. Its frustrating.] (Luna) Luna collapsed into a kowtow position as her fox ears fell down onto her face. Our usual sparring session after training ended with my victory once again. [Youya, why did you decide to wrap your usual wooden sword in a cloth today?] (Luna) Luna glanced over at the conspicuous change for my wooden sword. Until now I had used a bare wooden sword for our sparring sessions but today I had covered the blade of the sword in a cloth. [Its because Luna has improved a lot the past few days. Until now I always had room to hold back, however its becoming much harder to hold back now. I am not willing to risk accidentally landing a serious blow onto you without taking any precautions.] (Youya) Until now, I always had confidence in our mock battles that I wouldnt be hit nor would I accidentally land a heavy blow onto Luna. However, her growth over the last few days has been remarkably faster than before to the point that I didnt have the confidence I had before. I would like to avoid taking the battles as seriously as possible however little by little I have no choice but to do so, thus I decided to put the cloth on to prevent hurting Luna. [Until now Luna has been losing so Luna hadnt noticed it. Luna is happy~.] (Luna) Luna stood up with her tail wagging back and forth. Her drooping fox ears were also revitalized as they were standing sharply on her head. [You are definitely become stronger. At a pace far quicker than any of the disciples I have taught until now. Here. Its a reward.] (Youya) I smile widely as I took out a bamboo tube containing a cold drink from my magic bag and pressed it against Lunas cheeks. Then Luna took the bamboo tube with a bright smile and drank its contents. Seriously, this girl is a genius at what she does but she is still a child on the inside. Then, I looked over to my other disciple. [Dont forget to drink a stamina recovery potion.] (Youya) [Eeekk. Please let me go. At this rate I wont be able to survive for our adventure tonight.] (Selene) Selene was completely exhausted and had almost no stamina left. Since she had made a request to drill the entire Renoirs shield-style into her, I had given her a intense training regimen for the past few days. Everytime she got an injury or a bruise, she would heal it using her own recovery magic. Afterwards, her mana and fatigue were recovered using recovery potions. To use recovery potions to assist with a persons training was a luxury, however time wasnt on Selenes side as her inheritance ceremony is occuring two and a half months from now. We only have one month for her to fully grasp Renoirs shield-style and develop her own style from there. Selene took a sip of a recovery potion. [Once you are done drinking the potion, you can drink this. Its banana milk. Its the perfect drink for helping your body recover.] (Youya) It doesnt matter how much a persons status increases, their stamina was still something that had to be trained. It is impossible to become the strongest just by raising your level, and every adventurer knew that. For Til, although she is constantly cracking jokes, she was properly performing her own training every day. Using a bow requires both stamina and physical strength. Without either, it would be impossible to have the incredible precision she had for hours on our adventures with just talent alone. She was properly doing what she had to do, that was why I could trust her. [Thank you. It helps alot. Its delicious.] (Selene) There was the scene of Selene completely immersed in drinking the white fluids down her throat. Now then, the training for the two disciples has finally ended. Now was the time for my own training. Even though I was training the two of them, I also had things to gain from their training. However, this didnt excuse me from performing my own training. I wholeheartedly focused my senses into swinging the sword to let my body recognise the sensation of swinging the blade. I went through all the basic nine slashes, finishing each slashes with maximum accuracy and as perfectly as possible. With the first swing, I recognize the shift in my body when performing each slash. Second is to perform large adjustments onto the swing. Third to perform finer adjustments onto each swings. Fourth to confirm the result of adjustments and the fifth to engrave the motion into my body. Once I complete the tuning, then the rest of my body will automatically adjust to the changes. Slight moments of hesitations, small misalignments in the angles and the stagnation of kinetic energy in the muscles. Everything must corrected and arent allowed at all. This was my sword that I have used for several decades. Everything must be optimized to match the image in my mind back to the level I had with my original status. After the tuning was completed, it was time to finish the day with a final check. [Nee, Youya. Youya is strong, and yet after our training Youya is always swinging your sword with vigor everyday. Why?] (Luna) [I noticed that too. If you were a swordsman of his caliber I dont see why youll have to do that.] (Selene) I smiled bitterly at their responses. [Youre mistaken. This is necessary for me. Truthfully, I can feel my techniques collapsing and failing everyday.] (Youya) The two of them had looks of dismay on their faces. I see, I must have not talked about this before. [While staying weak, I arrived at the maximum level of 50. In that state, I polished my swordsmanship to compensate for my weakness. As a result, after my level was reset, my status rose much higher than it was before. It is incomparable to what it was before. Even with the status correction from being a Magic Knight rather than a Warrior. My current power and speed is much higher than it was before.] (Youya) Warriors overall had better status corrections as compared to Magic Knights and obtained better attack power, defensive power and speed. However, even with the differences in status corrections, I had already reached a similar status when I was level 22, and now my stats have overtaken my previous status. [With my current status and body, Im relishing in the fact that my sword strikes harder and faster than before. However, it is a fact that the difference in strength and speed is causing the delicate balance I had between my techniques and my status to crumble. It is for that reason that I am trying to repair the balance in my mind everyday and adjust my techniques to my current status. Otherwise I would have to throw away everything I have learnt to compensate for my weakness and that is something I am not willing to do. I do not want to lose the sword that I have spent decades honing.] (Youya) I began the final check as I closed my eyes and imagined a imaginary enemy. Utilizing the nine different slashes that have been fine tuned earlier, I imagined and performed the nine slashes in a combination that could be considered as the most effective that i could perform. An elegant blade capable of utilizing all nine slashes in quick succession. If there was the slightest error in any of the slashes, the nine successive slashes would crumble in power and speed. As the sword flows from one side to another, prevent the energy from stagnating as per the image created earlier before delivering the final thrust with the strength of the entire body. Yosh. That was a satisfactory ending. I thought as I exhaled deeply. With this, the final check was complete and the tuning was complete. Truth be told there is no reason to perform this check on a daily basis. It is enough to just perform this whenever there was a small change in my status. However if it was performed with a huge difference, the difficulty in tuning would increase dramatically. To a swordsman, the most important thing was to do your due diligence everyday. [Youyas sword is beautiful as usual.] (Luna) [I agree. It was exactly as I heard. As expected of the weakest strongest knight.] (Selene) (I dont remember what is the exact nickname for Youya. Itll be checked when posting the chapter on the site) The Weakest Strongest knight.. Huh. It was a title I received after I won a competition that consisted of many powerful knights and received the championship title. Not only is it an embarrassing name but there was another reason why I did not like the name. [Its a shame for Selene, but that nickname isnt suitable for me anymore.] (Youya) [Why is that so? Its a fact that you achieved victory in a tournament to decide the strongest knight. Uncle Youya who was given special permission to participate in the tournament certainly defeated the elite knights who were participating in the tournament and won fair and square. Hence the name was fitting for you who was inferior in every aspect and yet still won the tournament with your overwhelming skill.] (Selene) I shake my head in response as she was misunderstanding my intentions. [The reason that I attained victory in that tournament was because of the rules. In that tournament we had to battle using wooden swords and the moment someone lands a clean blow onto their opponents vital spot, then it would be the end of the battle. However, in an actual battle those knights could easily receive ten of my attacks and disregard their own defense to focus purely on attacking me. On the other hand, if I were to receive even a single blow it would be over. Now do you know how advantageous that tournament was to me in a battle between swordsman? It was impossible for me to defeat any of the top knights in that tournament.] (Youya) Having speed and strength in that tournament was advantageous due to the rules, however there was no competition between the individuals attack power and defensive powers. It was because of those rules that I was saved and managed to win. It is disgraceful but I had only realised that I obtained the victory then only because I was saved by the rules and not of my own strength. After that, I was ashamed of my own conceit and decided that I would become a first-rate swordsman and would become stronger. [That may be true but it doesnt change the fact that you were the one who won the tournament.] (Selene) [I will admit that, however I wont accept the title of being the strongest. I feel guilty towards the knights who were clearly far stronger than I was. Ill only say this once but I do not plan to give up being the strongest. I have the bonuses from the level reset and the strength that I obtained from struggling with the weakest status possible. I will continue moving forward using both of them as my weapons.] (Youya) Surely, that was my current motivation to seek strength. Now that it came to this, it is a good time to reveal my wish to her. [Selene. I am asking you as the person who is also Princess Lutra. Should you win the inheritance tournament, please let me attend that tournament once more. This time, I will win with my own strength and truly become the strongest knight. I will definitely win as Princess Lutras knight and dedicate this victory to you. It is because of this that I wish to ask you.] (Youya) This is something I had to do to redeem the pride of the knights from my weak victory and abandon the false title of being the strongest that I obtained. It is my apology to the knights for falsely snatching away the title of the strongest, and also a test for me to move forward. Selenes face turned red and looked straight at me in a rigid manner. [How about it? Selene.] (Youya) She regained her composure after I called her name. [Uhm. Ah. Its nothing much.. I promise that once everything is over we will host another competition to decide the strongest knight.] (Selene) [Thank you.] (Youya) Selene seemed to receive a shock as she turned her face. She was behaving weirdly. [Now then. Since were having a break lets go shopping together. We cant afford to not go sightseeing when were in such a beautiful place. Lets enjoy ourselves until the day is over.] (Youya) [That sounds great! Luna wants to eat all the delicious food in the city!] (Luna) It seems that Selenes mind hasnt returned to her body yet. Looking at the surroundings, it seems that Til was done. Lets head over and meet up with her before our sightseeing trip. . . . In the shopping district, we began taste testing several kinds of foods at different stores. Selene had finally returned to the usual Selene once we began to eat. However, rather than having a heavy meal at one store, we were buying and sharing several smaller meals from one store at a time before moving on to the next, sampling as much delicious food there was possible. Rather than just walking around the town sightseeing, we could enjoy the trip much more this way. [Meat mochi is delicious. Luna wants to eat it tomorrow too.] (Luna) , Among all of the dishes that we ate, Lunas favourite was a meat dish, ribs wrapped within glutinous rice and steamed, having a sweet and salty taste. The combination of the salty meat wrapped with sweet glutinous rice produced a delicious juice that was quite marvelous. [I think that this is good too. Its fun to stretch the bun and the sour and sweet cream inside is good too.] (Til) Tils favourite was a dish similar to rice cakes. And was one of Greenwoods specialities, made from the local produce. By grounding up glutinous rice to make rice cakes, they added tropical fruits such as mangoes into the cream which was wrapped within the rice cake. It felt extremely refreshing to be able to enjoy the taste of the different fruits within the cream. Many of the foods here were made using glutinous rice and rice cakes, which makes it seem like gluttonous rice seems to be a specialty for Greenwood. [Selene, which was your favourite dish?] (Youya) [Lets see. My favourite was from the third shop we visited, the freshwater fish skewers. It feels strange to me that its taste came from merely seasoning it with salt.] (Selene) [Ah so its that dish. That was certainly delicious. It looks like it was caught from the river nearby, Its freshness was on a whole different scale.] Mountainous foods such as animals and mushrooms, fresh crops from fertile fields were delicious but ingredients from a beautiful river were on a similar level. Greenwood is a nice place and the food here is wonderful too. My stomach is so bloated that it was pushing against my armour. We also entered several stores hoping to make use of the rare drop, the Insect Ruby from the dungeon however, the results were disappointing to say the least. None of them were capable of producing a gauntlet enhanced by the item. [Its a shame.] (Selene) [Yeah. Even though we managed to obtain something this rare. But lets just focus on enjoying ourselves for the rest of the day. Lets postpone making your gauntlet in another city.] (Youya) The smiths in this city were not capable of making a gauntlet enhanced with the ruby. In that case, we will focus on utilizing the ruby in the next city. Fortunately, the next city that we will be visiting once we are level 30 is a smithing city, the City of Flames [Alright, lets reset our minds and enjoy ourselves in the city. Recover our strength and ensure we are in perfect physical condition for the race to obtain the Magic Egg.] (Youya) [Luna will do her best! Do her best to eat more food!] (Luna) [I want to visit another weapons store. I have to purchase several spare threads for my bow.] (Til) [I want to visit an accessory shop. Recently Ive been perspiring a lot and the ribbons colour has become dull.] (Selene) Everyone had an idea of how they wanted to spend their time in the town. It makes me happy that the girls are enjoying themselves in the town. In the end, we enjoyed our time exploring the city in Greenwood until the late evening before finish a light dinner while enduring the urge to drink any alcohol. Then, we finally departed for the forest of God Trees. Lets continue to ride this momentum and obtain the magic egg. Volume 2 Chapter 15 It was finally time to enter the forest of God Trees as the time rapidly approached midnight. The forest was extremely large and it takes about an hour for us to reach the designated God Tree from the entrance. However we were entered the forest around 10:30 pm with 30 minutes buffer time. This way, even if we were to encounter any unexpected incidents we would still be able to make it. [Youya. There are so many people. Although there were many of them, there are more people than usual.] (Luna) [Well. There are many people who do not know when the egg will appear. However they are aware that it will be spawning sometime this month. Give and take 5 days, depending on the latest known date when the egg was seen, adventurers will gather in the forest, regardless of night or day.] (Youya) The moment the Magic Egg appears, the surrounding area will be illuminated with light. If you are in the forest the moment it spawns, you will be able to identify which day the egg will appear every year. There are many people who do know about this and they are often the ones who put the egg on the auction house. Which means that the flock of adventurers who are trying to enter the forest are all veteran competitors in this race for the egg. And after someone obtains the egg, everyone else will turn into a pillager, hoping to snatch the egg for themselves. In that sense, the difficult part of the entire event is not to locate the egg, but to safely escape with it. [Uwaa. Camping for a week. Everyone here is determined in their own way. What kind of strange dance are those people doing? And that song, what is that?] (Til) [There are many different kinds of superstitions that come from this event. They believe that if you performed the dance, the Magic Egg would appear in front of you. Only people with bad taste would spread this kind of rumors.] (Youya) Of course, it is false. However the amazing part about this sort of superstition is that it is impossible to call it a fraud. Regardless of whether you perform the dance, the probability of the egg appearing before you is still one in a hundred. So long as it is possible, then you can get away with calling it a ritual. [Im astonished. We definitely have to try harder now.] (Til) By the way, there is a reason why none of the girls have brought up anything about where and which God Tree would spawn the egg as Ive banned the topic for tonight. The moment someone utters anything relating to the egg, they would be banned from eating any meals in the bar. It is clear as day to anyone about what these girls live for. However this may be a needless precaution as anyone eavesdropping would be skeptical about our information as it is a common strategy used to deceive people by spreading false information. Plus the deeper in the forest we go, the lesser number of adventurers around. There are also hundreds of trees in this vast forest dungeon making it difficult for every tree to be covered by adventurers. [Youya. Its weird. Weve run this deep into the forest but there are no monsters at all.] (Luna) [Thats because theyve all been hunted. Between the Starfish Larvae and the adventurers, for the past three days they have been hunted continuously after they were respawned.] (Youya) [Hee.. So thats the case. If only there was a monster similar to the giant crab we fought back then that could spawn monsters indefinitely.] (Til) [That is an exception. That sort of monsters are rare and hard to find.] (Youya) Monsters who are capable of altering their surroundings such as the Hermit Crab was very rare. At the very least, none of them exist in any dungeon within Greenwood. If there was such a monster that existed in any other towns suitable for us, then it would definitely be our next destination. Thanks to its troublesome passive skill it would make our lives much easier. However such a thing didnt exist. And the number of dungeons suitable for adventurers level 30 or more arent plentiful. Itll be difficult for us to find the luxury of having an entire dungeon to ourselves. [Youya, a little further.] (Luna) Luna has a good memory. So long as we have visited the place once, she would remember the entire route that we took. Since we took the same route back yesterday, we were able to precisely estimate the amount of time required to arrive. [There are also several adventurers around us.] (Luna) The worst case scenario would be if there were any adventurers who marked and decided to camp at the correct God Tree. However, the tree wasnt in this area. Itll be fine so long as the adventurers are present only in this area. . . . Finally, we arrived at the God Tree indicated by the star chart. I was making sure that we werent being followed on our way here, however that effort was redundant. Although that was a relief, one of my fears had came true. There were adventurers who had marked the God Tree we were heading to. They had came here. [All of you get lost! This place is marked as the Wolfgangs territory!] (Adventurer) There was a pair of two adventurers. Although there were over 30 God Trees in the immediate vicinity, they seem to be adamant about marking the area as their territory. [We understand. Well back away from here.] (Youya) Although it was possible for us to start a dispute here, creating noise here would attract other adventurers in the area. That would be bad so lets behave maturely here. [Wait a minute.. Isnt it that pimp old man?] (Adventurer no.2) [Seriously? Then, that beastgirlC] (Adventurer no.1) [Did you call for Luna?] (Luna) [Eeeek.] (Adventurers) It was at that moment Luna showed her head from behind me. It was the pair of adventurers who were trying to hit on Luna and Til back in the guild. Its no surprise that they were afraid of her. After all they must have received quite a trauma from her attack. [We arent backing down from here! If we do, our boss will absolutely slaughter us! You are definitely not getting close to the trees here!] (Adventurers) Based on their responses they must belong to the lower echelon of their clan. It seems that Wolfgang wasnt the name of their party but rather a clan that they had joined. However it doesnt appear to be the compassionate sort of group but more of a dictatorship sort of group. [We understand. Well go somewhere else so stop looking at us like that.] (Youya) We were definitely not going to get into a quarrel but itll be troublesome if they were to call their friends here. We decided to turn back as they stared at us move away from the location. . . . Although we said that we would change location, we did not plan on giving up the Magic egg. After turning the corner we hid behind the trees close to the target God Tree. [Our luck was bad. Their intuition was right on the mark.] (Youya) [Muu. Luna could always blow them away with the same punch.] (Luna) [There are situations where force is necessary however if it isnt needed then we dont have to resort to it. Luna, Ill tell you the plan. Be sure to listen to it carefully.] (Youya) I took out a pocket watch from my pockets. This is an expensive watch made by a dwarf using special metals that accurately shows the time that isnt affected by large shocks and impacts. [10 seconds before midnight, you will rush towards the God Tree at your full speed. At your max speed, there is no way for the two of them to stop you.] (Youya) [Leave it to Luna! If its that then Luna will do her best.] (Luna) Luna possessed a lightweight body with overwhelming speed. Not only that, the two of them will stiffen with fear if they saw Luna rushing at them. [Til will be the backup. You said that maneuvering in the forest was your specialty previously. Then you will approach the tree to a distance closer than the two of them without being noticed. If they somehow managed to stop Luna, Til will be the one to close the gap and secure the egg.] (Youya) If the two of them somehow manage to stop Luna in her tracks, then that would mean that their attention was completely focused on Luna. That will provide Til more than enough time to secure the egg. [Leave it to me! To me the forest is my friend.] (Til) Til looks dependable. The two girls in question began preparing for the plan.Til erased her presence and blended into the darkness, slowly approaching the target. In the meantime, Luna began to prepare for her dash. [Uncle Youya. What should I do?] (Selene) [The two of us will be preparing to rush out if the two of them are in danger from anything.] (Youya) [Im afraid.] (Selene) [Dont worry about it. If its the current Selene then you are plenty strong.] (Youya) In the first place, Selene who had the foundations with a sword and a shield drilled into her was already strong. That Selene who had underwent special training has become much stronger as compared to before. It was unnecessary for her to be worried about people on their level. [Its not that. Its obvious that the two of them havent undergone any proper training, I dont know if they were capable of defending themselves. I dont have any confidence that they would live after suffering an attack with a spike.] (Selene) [. Spikes are prohibited.] (Youya) It is true that itll be difficult not to harm them if she was to use the spike. She could easily pierce a hole into their bodies or break their bones. Now then, what will happen. . . . It was 30 seconds until midnight. Luna was currently wearing a pair of sunglasses. It was a piece of special equipment that can only be obtained from the labyrinth. It would be dangerous if we did not equip this equipment before the egg spawns. As soon as the time turns to midnight, the mechanism of the spawn will activate. However, Luna and Til will be moving before then. Team remaining untill midnight is 20 seconds Luna began a forward-bent posture and pours her energy into her legs. It was finally approaching 10 seconds before midnight. [3.. 2.. 1.. Lets go!] (Luna) Luna rushed out, reaching her top speed in three steps. The adventurers who were caught off guard were staring at Luna with a dumbfounded look. Time remaining 7 seconds. While retaining their dumbfounded looks, the two of them rushed to stop Luna. Luna lightly tapped the first person. Time remaining 5 seconds. Luna jumped over the second person with a flashy jump, somersaulting in the air before landing on the ground. After regaining her bearings she immediately accelerates. The adventurers tried to catch up but they couldnt even come close to Lunas speed. Her running figure with her fox tail hovering behind her gives of a majestic setting. Time remaining 2 seconds Luna arrives right in front of the tree. Time remaining 0 seconds. Midnight finally arrived. It was an explosion of light capable of illuminating the entire forest. It was because of this that I had Luna and Til equip sunglasses. If someone were to look directly into the source of light their eyes would be thoroughly cooked. By the way, I told Selene to close her eyes while I was wearing my spare sunglasses. In the middle of the light, Lunas feet touched the tree trunk as she began to run vertically upwards the tree, directly towards the largest tree branch which held the Magic Egg, grabbed the egg and jumped. She landed on the ground, killing the impact using her flexible body, heavily reducing the shock sent to the egg and returned to our current position. The light finally died down as the adventurers looked around their surroundings trying to look for Luna, however she had already disappeared. Til who was going to be Lunas reinforcement also came back. [Youya look! Its a huge egg!] (Luna) Luna held out the Magic Egg with a look of satisfaction on her face. It was an egg slightly larger than an ostrich egg with a unique glowing emblem imbedded into the shell. I immediately took the egg and put it into my Magic Bag. [You did great Luna.] (Youya) [Uhn. Did her best!] (Luna) Luna hugged me as she rubbed her face onto my chest and her tail swung happily. She was as cute as usual. [Everyone, shall we return?] (Youya) [Uhn. Those people are annoying.] (Luna) [Right? Plus I have errands to do.] (Til) [Once we return I would like to drink to celebrate. We couldnt drink at dinner earlier.] (Selene) [Lets do that. Tonight looks like a good night to stay up.] (Youya) We laughed along in celebration and hurried home. On our way home we passed by multiple groups of adventurers on the way. They were most likely adventurers who were aware that the light was the signal that the egg has appeared. They were probably going to search for the person who had the egg in their possession. Its a shame to waste their efforts but I do not plan to advise them against it. It wouldnt be fun to be assaulted and lose the egg in the process. I finally got the Magic Egg that I have been wishing for. Lets be sure to take care of it well. With the existence of a Magic Pet our party will start to make more progress. Volume 2 Chapter 16 However, not everything went as smooth as we expected it to. Unluckily enough, we got involved with the men who were trying to recruit Luna and Til into their party. The two of them seem to belong to a clan called Wolfgang. Lets be sure to talk with the receptionist afterwards about what kind of clan the Wolfgang is. There is a high chance that they will be a threat to us in the future. Until then, the more information we can gather about them the better. Even though I was thinking about that, it was late at night. It was impossible for us to talk to the receptionist so long as the guild is closed. More than that, I had something else I had to do. [For our success in securing the egg. To everyone. Cheers!] (Youya) [Cheers!] (Luna & Til & Selene) We bumped our mugs. After returning from the forest, we returned directly to our room in the inn. Although it was an occasion that we should celebrate at the bar, celebrating our success for the Magic Egg in a bar.. I would rather pull my eyes out. Furthermore we would be exposing ourselves to Wolfgang. With these reasons, we returned to the inn. The food and drinks that we were currently eating were foodstuff that we purchased during the day. The food that we liked was secured in the Magic Bag before we left for the dungeon. I was currently drinking my favourite ale, Selene was drinking wine while the two girls who had sour expressions the last time they drank alcohol were enjoying milk and grape juice instead. Although I had talked to them about drinking alcohol moderately, the two of them still seem to be wary about drinking alcohol. It was a pity since I was looking forward to a drinking party with Til and Luna. [Uncle Youya. I was surprised. That it was so easy to get your hands on the Magic Egg.] (Selene) [It wasnt that easy. We had to survive entering the labyrinth at least twice while be capable of deciphering the star chart and the pendulum clock at the end. Both of them are difficult tasks] (Youya) [That is true.. However that star chart. Normally I dont think you would be able to notice it.] (Selene) [It comes with experience. I have seen similar things in my travels.] (Youya) It doesnt seem appropriate for me to tell her that it was a memory from my previous life. It should be fine to hide this fact form her. Selene looked into my eyes with longing eyes. It isnt that I dont know what she is thinking. However it isnt mutual. She has likely noticed it from her own observations however if she still decides to follow me, then I will respect her decision. In order to divert the conversation, I brought the attention onto the MVP who managed to grow a beard made of milk. [Luna. You did great today. It was a brilliant showing.] (Youya) [Naturally. Lunas tree climbing skill is the best in the world.] (Luna) Luna had a look of satisfaction on her face but thanks to her milk beard it could not be seen. [Ah. I could had done my part well too. Youya, next time make a strategy that I can play a part too okay.] (Til) [Ill consider it. However the plans I make are only for the people who are the most suitable for the situation.] (Youya) The right place for the right person. It is the party leaders role to give out instructions for the situation based on the strengths of each and everyone of the party members. In Tils case, her bow will have many opportunities in the future. In a short while she will definitely be the most useful person in our party. [Uncle Youya, could I please take a look at the Magic Egg?] (Selene) [Of course.] (Youya) I took the Magic Egg from my bag and handed it over to Selene who received it. Luna and TIl who were intrigued by the eggs were also looking over. [Youya. The egg is alive.] (Luna) [Uhn. There are sounds coming out of it. What kind of creature will be born from this egg?] (Til) [In the first place how are we going to get the egg to hatch?] (Selene) The girls did various actions such as caressing the egg, sniffing it and poking it. However, getting the egg to hatch is a fairly high hurdle to cross. The Magic Egg is definitely sturdy, however it will still be broken if it were to receive the full brunt from a monsters attack. Plus carrying it around for everyone to see would basically be begging for someone to steal it . [Hee. This is troublesome. Since the egg weighs about 2 kilograms itll be difficult for us to carry it on our backpack all the time.] (Til) [We only have to maintain physical contact with the egg for about 200 hours. Itll be better if we just held it while we were sleeping since itll be safer than carrying it around in public. In any case, we wont be able to perform the second method in Greenwood.. There is no hurry to hatch the egg.] (Youya) I plan for us to leave Greenwood when we reach level 30 which should take us at least three weeks. Assuming our total sleeping time is 8 hours everyday, we will accumulate a total of 168 hours by the time we reach level 30. Furthermore the time required to move to the next town is about 5 days, which adds another 40 hours to our timer. Its a coincidence but our hatching work will end the moment we arrive at the next town. [Youya, whats the second method?] (Luna) [After warming the egg, you will place the egg into a hot spring mixed with spiritual energy for thirty minutes. If you do that then the Magic Pet would be born immediately. Our destination after Greenwood will be the City of Forges, The number one smithing town on the continent, Flaregard. It is also famous for its hot springs heated by the nearby volcano.] (Youya) (Note: Should I change the title of the city to *The city of forges* since its a blacksmithing city. ) Flaregard. The worlds number one blacksmithing city. There are two secrets as to why it is number one. First would be the dwarfs whose favourite things were fire and iron. The second would be the Sacred Flame which has never been extinguished ever since the world was born. The Sacred Flame is the flame from god which was capable of melting everything, even Orichalcum which was known to be incapable of being smelted in any furnace. It is because of this flames existence that it came to be known as the worlds number one blacksmithing city. Due to the Sacred Flame there are many different magical metals that can only be processed at that city. Furthermore due to the influence of the flame and the nearby volcano, the spas in the area were full of hot springs. [Youya. What is a hot spring? Luna doesnt know.] (Luna) [It is a pond with lots of hot water. Once you enter it, your whole body will feel good. Especially the hot springs in Flaregard. It is something that you definitely have to try once in your entire life.] (Youya) [Want to go! Luna, loves feeling good! Especially together with Youya!] (Luna) Entering the hot springs isnt just that. There is a secret property held within their hot springs which was their springs filled with spiritual power. Just by soaking your body in the water, your entire body can be rejuvenated, your fatigue can be washed away and any illnesses can be cured. It also has the property of speeding up a persons recovery from any injury.] [If you look forward to going then you should work hard for the sake of reaching Flaregard earlier. Besides hatching the egg, you should do your best to raise your level as well. That way we can depart earlier.] (Selene) [Thats right. Tomorrow we will do our best too.] (Til) Selene and Til were both fired up as well. Truth is, that isnt the only reason why I targeted Flaregard as our next destination. There are also hidden elements that are present over there. Similar to the Magic Egg only being available in Greenwood, it is a place that I definitely have to go. That is why I chose it as our destination after we reach level 30. [That is right. We definitely must become the strongest and raise our level to 30 as soon as possible and leave Greenwood. Next is to decide who will be the one to take care of the egg. It is impossible for me to do so as the sofa is too small. If I were to go to sleep with the egg then it would definitely fall onto the ground before the morning.] (Youya) Since Selene joined our party I was moved from the bed to the sofa. One bed was for Luna and Til and the other for Selene. I had already requested the innkeeper for a room with three beds, however we had to wait for the current user of the room to leave before we could move in. Until then, I will continue to sleep on the sofa. After finding out that I was sleeping on the sofa, the girls had offered to let me sleep together with them, however I refused both sides. Luna and Til were both fundamentally kids. It isnt good for their education to grow up experiencing sleeping with a member of the opposite gender. On the other hand Selene was a princess. When thinking of her future, itll be bad if it was known that she had slept with another man even if I wasnt willing to lay a hand on her. [Luna wants to take care of the egg!] (Luna) [Me too! Me too!] (Til) Luna and Til both raised their hands. [Thats great. Then the two of you will take care of the egg. Speaking of which, I have not mentioned anything about what kind of creature will hatch from the egg. The egg consumes the magic power of the person taking care of it to develop. Naturally it will follow the heart of the person as well. Depending on the magic power they consumed, the creature that hatches will follow suit. Which means that what hatches from that egg, depends on you two.] (Youya) During the game era, after analyzing the different interactions and conversations between NPCs and players, the hidden parameter which determined the monster was confirmed to be the users race. (Note: This paragraph was vague, at least on my understanding of the words, about the parameter discovered in the game so I decided to add some context.) After understanding how the mechanics of the egg worked, it is possible to target a specific pet to hatch from the egg, however it is difficult to accurately influence the hatching. However, if I were to choose one I would choose the dragon the size of a kitten, a Faerie Dragon. Faerie Dragons were capable of casting recovery magic, provide protective buffs to the party and is resilient itself. If we werent lucky enough to get that, I just wish to have something that the girls would like. Regardless of what comes out, if it was grown using the heart and magic powers of Luna and Til, I am sure that a good pet will hatch from the egg. [Luna will do her best!] (Luna) [I will try my best too. It feels as if it is our child. ] (Til) The two girls motherly instincts were stimulated as the two of the sandwiched the egg between them. Lunas ear began twitching, going *piko**piko*. It is a gesture that Luna does whenever something comes to her mind. [Til. You were right. If its our child..] (Luna) It looked as if the two of them were communicating through their ear movements as both their ears went *piko**piko* one after another. [Ah! That is a good observation! You are smart.] (Til) Til let out a devilish smile as she came to a conclusion. I have a bad feeling about letting this conversation go on. [Well thats that. Well leave it to the two of you to take good care of the egg.] (Youya) [We understand!] (Til) [Leave it to us!] (Luna) Their responses were filled with energy. Selene has been squirming quite a bit since earlier, it seems that she might have something to say. [Whats wrong? Selene.] (Youya) Itll be bad not to give her the opportunity to speak up before ending the conversation. [I feel like I would like to sleep with the egg too. I wonder if its possible to lend me the egg from time to time.] (Selene) Luna and Til stared at Selenes face. And.. [Uhn. Its okay!] (Luna) [Youre extremely reserved arent you. It was expected from the start.] (Til) The two of them replied instantly. The two of them were good kids. There was no chance that they would reject her request. [Thank you. Im glad that you think so. Everyone, lets take good care of the egg together.] (Selene) Now then, I wonder what kind of monster would hatch from an egg taken care by the three of them. It is interesting to wonder about that. In the game there wasnt any eggs that were being nurtured collaboratively, there might even be a magic pet that I didnt know of. Although, that might be me imagining too much. [Now then, the talk about the egg is over. Lets return to the celebration. Its late to be celebrating tonight but lets make it a grand celebration!] (Youya) [OUHH!] (Luna & Til & Selene) Afterwards, the atmosphere heated up as everyone laughed and drank to the fullest. In the midst of our celebration, I began thinking of Phil who we left behind in Rumberg. Tonight I will be writing a letter to her before going to bed to keep her updated our progress. Me, Til and Luna were all doing well, plus we even managed to find a new companion for our party. However, that made finding the item even more important. The item that could increase our partys limit to five. Even if we failed to do so, I want to meet up with Phil as soon as possible. There were many things that I wished to talk about with her. While such thoughts continously passed through my mind, I continued to gulp more ale down my throat. Tomorrow, lets continue to become even stronger than before. Right now we have already obtained the magic egg. We can now focus wholeheartedly to raising our level as quickly as possible. Lets just say that I have a little trick up my sleeve for tomorrow. Volume 2 Chapter 17 In the end, we continued the celebration until it was extremely late at night and afterwards I continued to write a letter for Phil, resulting in lost time for sleep. Between Greenwood and Rumberg, there is a delivery service carried out by trained bird-type monsters, by using that service my letter should arrive at Greenwood by tomorrow. Somehow the futon feels much warmer than usual. When I fully opened my eyes, there was the sight of a cute girl sleeping in front of me. It was Luna who was sleeping soundly. It is amazing how she somehow managed to find space to sleep on this small sofa while I was asleep. Ever since we arrived at Greenwood, I was relieved that Lunas habit of entering my bed had finally disappeared, I wonder what kind of wind will be blowing our way this time. Even more amazing, is the fact that somehow the Magic Egg was sandwiched between the two of us. With this, I think I can understand what Luna was thinking. [Seriously.. This girl.] (Youya) I smiled bitterly at this girls sneaky tricks. I began rubbing Lunas ears as they had an interesting feeling to it, like a *kunyu* sensation to it. It is surprisingly really fun. Luna began to become restless as she opens her eyes. [Good morning Youya.] (Luna) For the time being, lets flick her forehead. [Ouch. Youya is cruel.] (Luna) [Im not cruel. I told you not to sleep on the sofa did I not? Itll be uncomfortable if we had to sleep together in such a small place.] (Youya) Even though I have been sleeping alone, I havent been sleeping very comfortably. Luna who deliberately tried to squeeze herself into a small gap must be feeling even more tired. [Uhn. But it was important. Luna wants to sleep with the egg together with Youya.] (Luna) [Is it okay to tell me the reason?] (Youya) [If Luna and Til slept with the egg, then it would be Luna and Tils child. But if Youya slept with the egg together with Luna and Til then it would also be Youyas child. Luna wants Youyas child.] (Luna) That was the case. I couldnt be angry at that. [Then are you satisfied now? Next time do not come onto the sofa again.] (Youya) [Uhn. Luna wont come onto the sofa with the egg again.] (Luna) Wait, something feels strange about what she just said. Suddenly, I felt a presence behind me. [Luna, you did great! Tomorrow will be my turn!] (Til) It was Til who was laughing with a strange laugh. Behind her was another person. [Thats wonderful isnt it? If you werent against it then I would like to do it too.] (Selene) It was [Im an old man but Im also a healthy man. Arent you afraid about sleeping together with a male?] (Youya) I have to warn them although they are being extremely careless. [Ahahahaha. You would never lay a hand on any of us you know.] (Til) [Thats right. Even Luna and Til who may be young but they are certainly beautiful girls. Even with this much favor from them, we can rest assured that you would never do anything strange to us. On the other hand, even if you did to me..] (Selene) Luna and Til who were listening to Selenes words to the end had a shocked face. [Just kidding. Its a joke. Thats just how relaxed we are.] (Selene) Luna and Til began to walk off as they began sneaking somewhere. [Luna, what do you think?] (Til) [It is dangerous. Youya is in danger.] (Luna) [I have to send a report to my sister.] (Til) [Luna is neutral.] (Luna) [ [Ahh thats bad. Now that it comes to this, we have to bring Youya into our bed once he is asleep to protect him.] (Til) [If thats the case then Luna will cooperate.] (Luna) Whether they are seriously trying to hide it or not, their intentions are clear even though their voices were not completely audible. Selene face became red as the two children continued to tease her. Nonetheless, it was a perfect tease in every sense. It is nice to be trusted to this extent however it isnt good for them to lower their guard this much to a male. It could be a good thing for me to show them how ferocious a man can be before they have to experience any man outside. . . . After that, we talked about various things. Somehow, it was decided that I would sleep in Luna and Tils bed with the egg tonight and tomorrow in Selenes bed. Til was saying that it was unfair for Luna to be the only one to sleep together with me and the egg. Somehow unbeknownst to me Til had thought that way. Although I had refused that notion I eventually relented to their pleading. It was a strange request although there was a legitimate reason this time. Next time Ill be sure to be firm on my stand. [Youya, what dungeon will we be entering this time?] (Luna) [If we were to search for the Starfish Larvae there is a chance for us to run into those people from Wolfgang again. Plus the monsters in the labyrinth are definitely becoming lesser. This time we will be entering a different dungeon.] (Youya) Although many monsters were being eaten by the Starfish Larvae everyday, we had already been hunting in the labyrinth for more than five days. The number of monsters were evidently beginning to diminish. Due to this, we will be entering a different dungeon. The name of our destination is the Wailing Forest with a recommended level of 28. It is the most difficult dungeon available in Greenwood. [Heh. Im getting excited. Although the labyrinth is nice, Im quickly getting bored of it.] (Til) [The next dungeon will also have plenty of monsters. However, the monsters there cant be defeated using the traditional methods easily. It is an extremely difficult place to fight monsters. However we will be hunting them down and raising our levels as quickly as possible.] (Youya) For the Wailing Forest, although it was the most difficult dungeon available in Greenwood, there were many adventurers above the recommended level who came here looking to obtain the Magic Egg. Because of that, the monsters who werent usually being hunted were also being hunted.Those monsters werent the average run of the mill monsters that could be hunted. [Uncle Youya, that sounds intriguing. Fighting a powerful opponent makes my heart beat with excitement.] (Selene) [I feel the same way. However dont get too excited. The monsters in the labyrinth were definitely not average by any means. However the monsters we will be facing arent ordinary monsters in the slightest. It is something similar to a boss. It is a special monster that can only exist as the only one of its kind. It is a totally different level from the monsters we have been hunting.] (Youya) Bosses. There are three features that distinguishes them from normal monsters. First would be that they are a unique monster that would never spawn another until it was killed. Although it will respawn every week during the respawn day, it will definitely appear in the spot where it is supposed to be. And it will never leave that location. Second would be their overwhelming strength. For this boss, the four of us together would barely be able to defeat it. Thirdly, bosses have a dedicated list of item drops that can appear according to their rank in addition to the normal drops that can appear. Furthermore the drop rates for rare item drops will increase as the bosss rank increases. At the bosss current rank, it is possible to obtain the item which allows us to increase the number of party members to five. Its drop rate right now is 30%. With Lunas Increased Drop rate at level 4, the drop rate rises to 1.8times the original number to 54%. With that high of a drop rate, there is a good chance for us to obtain the item if we challenge the boss today and next week after it respawns. If we were unable to obtain this item then it is likely that we wouldnt be able to head over to the new town. [Is everyone ready?] (Youya) [Uhn. Always ready!] (Luna) [Today is a super ready day too.] (Til) [Shall we leave?] (Selene) Thus we finally left. However before we leave for the dungeon, first we have to confirm whether there are any quests for us to accept in the dungeon. . . . I was facing the usual receptionist in the guild. [Just to confirm. Youre heading over to the Wailing Forest right? You do know that the recommended level for that dungeon is 28?] (Receptionist) [I understand that. However I am already level 26. Furthermore we already have a balanced four-men party.] (Youya) [No matter how I look at this, there is something wrong with your partys progress. How is your level increasing this quickly?] (Receptionist) [Maximum effort, strategy and hunting efficiently.] (Youya) Level 20 to 30 would take at least a year if the party has been hunting diligently. However even then it is considered an extremely fast pace. An average adventurer would usually take at least 3 years to break the level 30 barrier. It is often the case that adventurers would never be able to exit the level 20 range once they enter. However in our case, it is even more unusual to increase our levels by three in just 10 days. [So are there any quests available?] (Youya) [Yes there are. Lets see.. If you encounter the monster that inhabits the river in the Grieving River, then you can look for Eel Meat (Average). It is a very tasty and popular item however the monster rarely appears on the surface of the river and prefers to stick to the bottom of the river, making it difficult to obtain the item and the supply for the meat is low. The item can be sold on the market at a very high price.] (Receptionist) [I understand. I would like to accept that quest.] (Youya) If we were to utilize some items and Tils bow then we should be able to complete the quest. Eel is also one of my favourite foods. Especially eel wine stew. Lets be sure to leave some of them to bring to the bar for us to enjoy a good meal. As a matter of fact, I was considering whether to hunt the eel to raise our levels. Adventurers do not often hunt monsters who reside in the water.. Or rather, most adventurers cant hunt monsters that live underwater. At least not in the traditional way. Thanks to that, there is a high possibility that the monsters underwater would remain untouched. The fact that we somehow managed to obtain an eel collection quest is an added bonus that just confirmed what we will be hunting in the dungeon. [Im expecting great things from your party. Youya-sans party has a 100% success rate until now, and that has helped the guild a great deal.] (Receptionist) [You can expect us to complete the quest this time as well. However if there are other adventurers who are hunting the same prey as us then you can expect to wait until the next respawn for the quest.] (Youya) [You dont have to worry about any competition since eel meat hasnt been circulating at the market for awhile.] (Receptionist) If thats the case then Im relieved. Rather than the rarity of the monsters themselves, there are also cases where the monsters themselves have been hunted and their materials have been sold to the guild. The guild often settles the matters about their quests after going through the standard material exchange with the adventurers, causing situations where adventurers unknowingly sell drop items that could otherwise be used to complete quests. That was a sign of a bad work ethic by the adventurer and it will be better to confirm the existence of such quests before anything. Even the guild wishes to increase the completion rate of their quests. [With this the procedures for the quest has been completed. Now, there is something that I wish to ask of you. Do you know the name Wolfgang? We have gotten into some trouble with them and I am trying to gather information about them.] (Youya) [That.. is definitely a problem. They are quite infamous in the area for causing trouble. Truth is most of us are of the consensus that they should have their adventurer privileges revoked however for some reason the higher ups seem to be pressured against it.] (Receptionist) The guild was pressured? If that was the case then there should be someone powerful preventing the guild from taking any action. Probably a famous merchant or a noble. It seems that many things are happening behind the scenes [That much information is enough. Thank you for the help.] (Youya) [I am sorry that I couldnt be much help to you.] (Receptionist) [That isnt the case. I am glad that I am able to rely on the guild when I am in trouble. There are also trashy guilds that perform dirty deeds without reforming. I am glad that this guild hasnt lost its path.] (Youya) I resolved myself with the intention of answering violence with violence. If they were the kind of people that came at you straight on with brute force, then they arent the kind of people who would accept a peaceful resolution. If we were to get mixed up with them, then Ill be sure to repay the favor. . . . When I was searching the the girls to rendezvous before heading to the dungeon, they were already caught up in an incident with four men. Out of the four men, two of them were the same men who tried to solicit Til and Luna into their party. [So its you people who dared to enter the Wolfgangs territory and steal our Magic Egg.] A man with horrible facial features and a skinhead began throwing toxic words around. Looking at him, his age should be approaching 30. This time, crossing paths with them was within our expectations. They were likely expecting us to come to the guild sooner or later as it was our livelihood and waited for us to exit the guild so as to not cause any trouble in the guild. As evidence of the skinheads superior level, I am unable to see his level. [Steal? There isnt such a rule. We merely found and secured the Magic Egg. Dont go around throwing false accusations onto us.] (Youya) I shrugged my shoulders as I threw a casual reply. The blood vessels on the skinheads head began to pop out. [Listen carefully old man. I will destroy you right here and now and have you return the egg to me. However that isnt enough to repay the debt you owe us. You will be paying us for reparations for a total amount of one million gil! Plus the women behind you will be joining our clan. I will make full use of their abilities. Im sure we will be able to get plenty of customers with them. They are wasted on an old man like you. I will be sure to make use of them to the fullest.] (Skinhead) The skinhead began to scan the girls with his perverted eyes. Luna and Til hid behind my back while Selene glared back towards him. [It seems that you are confident in your abilities.] (Selene) [My level is 40. Far superior than any of you. You arent even in the same caliber as me.] (Skinhead) Boasting about his level, I know firsthand how vain that can be. Levels are merely a measurement of experience points. What is important is the persons status and his skills. That is something I came to understand painfully. [If thats the case then lets decide it with a battle. Ill comply with your request. And bet the egg, all our money and the girls as you wished. However, if you lose the battle then I want all of you to get out of Greenwood and never come back again.] (Youya) It doesnt feel pleasant to treat Luna and the girls as a trophy but even if we got them to back off from this incident then the disgusting eyes they would be subject to will never end. It would be better if we could decide everything in black and white right here and now. [Old man. You may want to look good infront of the girls but its impossible. Your level doesnt even come close to 30. Hahahahaha. However since the great me is kind. Ill agree with this reckless old mans duel.] (Skinhead) The skinhead agreed with my battle terms. At that moment, a sharp sound rang inside my head. Similar to the game, in this world when two parties decide to have a duel, a Duel will be established and both parties will be forced to fulfill the agreements that have been decided beforehand. [The battle starts the moment the coin falls to the ground.] (Youya) The victor for a Duel is decided when a person surrenders, dies or gets knocked unconscious. There are many cases where the person loses their life. [The great me is feeling generous today. Because I wont torture you, and Ill be killing you.] (Skinhead) I flipped the coin into the air. A spinning coin flew through the air. That instant, the skinhead came at me with a fiery charge, drawing his sword and throwing out a thrust. The battle had formally started the moment the Duel was accepted. Using the coin as a signal for the battle was merely something done for convenience. The moment my consciousness was focused on the coin, the skinhead threw a surprise attack. The skinhead is surprisingly knowledgeable about the Duel. However, that is the same for me. [Honestly.. This guy. His character just doesnt change for the better.] (Youya) I am well informed about the kind of dirty tricks people with bad characters would perform. I pretended to focus my attention onto the coin while staying aware of the skinheads actions. I lowered my body slightly. The skinhead who performed a large attack was careless and full of openings. I straightened my arm the same time the skinheads thrust cut through the air. With the added momentum of the enemys charge, I launched a cross as a counter. [Gods Strength.] (Youya) The instant my fist collided onto his face, using my customized magic spell to drastically increase my strength while reducing the effective time of the spell to several seconds. If I were to cast the spell the instant he acted, I wouldnt be able to finish the chant in time. Having faith in his actions, I preemptively casted the spell and began the chant before flipping the coin. The fist which had its power increased tenfold thrown in a counter against his charge blew the skinhead away. His body landed and bounced off the ground, continuing to bounce four times. All the bones in his body were likely broken as his body was convulsing. It was painful just looking at his pitiful state as all of his limbs were bent in impossible angles. In the worst case scenario, even if I didnt hold back he could had died. Looks like his level wasnt just for show. There was the appropriate defensive force to back up his level. [This Duel ends in my victory. You guys are that guys friends arent you? Are you going to bring him to a healer? Or would you like to continue in his stead?] (Youya) I turned to face the remaining three men and the two men who were involved in the previous incident looked like they were about to flee at any time. [Heee. This old man.. Is more dangerous than a wild monster. Oh. We arent part of Wolfgang. We dont even know who that old man is. We were merely ordered to follow him!] [Thats right. We are just bystanders. We have absolutely no relations to him!] It was a magnificent showing of scum remaining as scum. With this kind of attitude they will never be able to find a suitable companion to stick through thick and thin together. However, the third man merely silently went over to the skinhead and carried him away, disappearing into the surroundings. [Luna is shocked. Luna though that Youya is kind and would choose to forgive him. The last time Youya only smiled and let them go.] (Luna) [Luna, Im not kind to everybody in this world. I am only softer towards newcomers in this world. Every person is bound to make mistakes in their life. People who are able to learn from their mistakes will become amazing adventurers in the future. However, if they continue to perform bad deeds and make mistakes, then even I wouldnt be able to help them.] (Youya) Just like the skinhead from earlier. Forgiving someone of his character isnt considered kindness, but rather foolishness. [Huah, Youya is thinking about a lot of different things.] (Luna) [However, you chose to use your fist rather than you sword. That was definitely very uncle-Youya like. If you were to use a sword then he would had definitely been killed.] (Selene) [It might have been better to kill him earlier, however Im not too fond of needlessly killing another. I may just be naive though.] (Youya) I will reflect on this battle later. There is still some resistance in me towards killing other humans. If it is necessary then I would do it without hesitation, however I would like to avoid doing so as much as possible. [Youya is great like this. Luna likes this side of Youya.] (Luna) [Uhn. Me too.] (Til) The two girls came over and hugged me. It doesnt feel that bad. [Despite the hindrances, its time for us to head towards the Wailing Forest.] (Youya) Everyone nodded as we proceeded to walk through the magic door. The next time we open our eyes, the battle between the eel-type monsters in the river that was left mostly untouched and us will begin. As well as the enemy of the hidden room. It is our first ever boss battle. We will not just be gaining experience points from this battle, but actual battle experience in a fierce battle for our lives. Just what will these girls learn and develop in the midst of an actual battle? I am excited to find out. Volume 2 Chapter 18 The Wailing Forest which was Greenwoods most difficult dungeon has a unique characteristic which raised its difficulty. It is a forest that was alive. The wind that blows through the forest produces a eerie groaning sound throughout the entire forest which interferes with a persons train of thought. Meanwhile, the trees in the forest were not just alive, but also capable of movement. As soon as an adventurer passes by, the trees will begin to rearrange themselves, altering the path and disorienting the adventurer. Thanks to this, it is rumored that the eerie noises coming from the forest isnt just from the wind, but from the screams of the exhausted adventurers lost within the forest. That was how the name Wailing Forest came about. [Why are we walking along the river instead of entering the forest!] (Til) Til who listened to my explanation raised her voice as we hadnt entered the actual forest. Currently we are walking upstream of the river that flows around the perimeter of the forest. [Once we enter the forest we will be able to begin hunting monsters. It would be an excellent adventure for us right after the monsters have respawned, however it is meaningless for us to enter now.] (Youya) Excluding the fact that maintaining our sense of direction was difficult and pain in the ass, it is a good place to hunt monsters. However six days have already passed since the monsters have respawned, any monsters there were living in the forest have long perished. Popular dungeons often have prey up till the fifth day after they respawn and even if you were to search for monsters after then they would have already been hunted. Typically most adventurers would spend the entire five days hunting and spend the rest of the week resting and waiting for the monsters to respawn. We are part of the minority who continues to hunt everyday without taking a break.. This was a major reason why we were raising our levels at a pace much faster as compared to other adventurers who werent. [But even if that was the case, there wouldnt be any monster around if we were to remain in this kind of place.] (Til) [That isnt the case. I am properly trying to search for monsters. Even though we are merely strolling along the river, there is a proper reason for this. Luna, are you properly paying attention to Presence Detection?] (Youya) [Uhn. Leave it to Luna, Luna is properly searching inside the river.] (Luna) The river we were walking along had a gentle flow with a width of 10 metres and a maximum depth of 5 metres. Although it was a shallow river, there are still monsters swimming around. However, most adventurers do not typically hunt in the water as attempting to hunt an aquatic monster in the water is akin to an act of suicide.Even if we had an overwhelming level difference, it doesnt make a difference if we were to drown from lack of oxygen. Humans were not built to fight on equal grounds against aquatic life in water. On the other hand, if we were capable of hunting aquatic monsters underwater, we would be able to monopolize the entire aquatic species of monsters. [Til. Its a present.] (Youya) [This is.. A weird arrow isnt it.] (Til) [Well thats about right. Its a handmade arrow from Phil. Back when we were still adventuring together it was an arrow she made.] (Youya) At the tip of the arrow was a barb to prevent the arrow from being pulled out, however this barb was especially large for the arrow. Furthermore transparent threads were connected to the arrow. [This isnt your typical thread is it?] (Til) [Its a magical thread. It has the ability to stretch as long as you want so long as you pour magic power into it. When you pour your magic power into the arrow, the thread will stretch until you decide otherwise.] (Youya) [Fuu, so in other words were going fishing.] (Til) [Exactly.] (Youya) As expected of Til. She caught up quickly. Meanwhile Luna and Selene were tilting their heads in confusion. Im sure they will understand it once we demonstrate the arrow in action. . . . After walking upstream for thirty minutes, Luna ears began to twitch quickly, producing a *piku**piku* sound. It was the gesture she did whenever she found an enemy. [Youya. Monsters. Extremely long and big monsters at the bottom of the river!] (Luna) [Yosh. Good job finding the monsters.] (Youya) To hunt an aquatic monster, the first hurdle to cross would be to actually finding the monster. However, to find the monster by swimming is practically the same as begging the monster to eat you. It could be taken as if Presence Detection was a requirement for hunting aquatic monsters. [But Youya. If its that deep we wont be able to beat it.] (Luna) [Uhn I agree. Even with the arrow itll be tough to penetrate even three metres reliably into the water. In that depth the power of the arrow will be diminished and it will not penetrate into the monster.] (Til) [Well, just wait and see.] (Youya) I took out several pairs of gloves from my magic bag and several black stones. I passed Luna and Selene the gloves while I held the black stones. [Til, we are going to begin luring the monsters onto the surface, keep your bow on nock and get ready.] (Youya) [Got it. Ready anytime.] (Til) Til readied her bow as she readied the arrow on her bow. Her entire atmosphere changes as she poured her concentration onto her bow. The black stone is a special kind of magic stone which explodes several seconds after a strong shock is applied, producing a large shockwave. It is an item that drops from several monsters with a certain drop chance and is fairly popular among adventurers due to its versatility. It is commonly called Sound Bomb. I threw the black stone towards the river and the moment the bomb struck the surface of the water, its detonation was imminent as it slowly sank into the river and exploded at the bottom. With a huge splash, the large eel-type monsters with black bodies that usually lurked at the bottom of the river were blown into the air and fell back onto the surface of the river. It seems that the monsters lost consciousness or were stunned from the shockwave of the Sound Bomb, and continued floating on the surface of the water. [Til!] (Youya) [Leave it to me!] (Til) Til released the arrow tied with a magic thread made by Phil. The arrow which was thicker than my arms penetrated deep into the two metre long eel.. Into the Numeri Anguila. [PIGYAAAAA] The Numeri Anguilla which lost consciousness violently woke up with a roar. It is a monster with strong vitality that wouldnt die from merely being penetrated by one arrow. [Luna, Selene, grab the thread and pull!] (Youya) [Uhn. Understood.] (Luna) [I understand it now.] (Selene) Luna and Selene who were wearing the gloves firmly grabbed the thread and pulled it. In one breath, the Numeri Angilla was launched into the air, landing right in front of our feet. The next moment, I drew my blade and slashed its neck, severing its head from its body. Even if it has a lot of vitality, there isnt a living being that can survive being decapitated. I quickly grabbed the specially made arrow and threw it back towards Til. [Hurry up and catch the remaining two eels. Itll be troublesome if they woke up.] (Youya) [I know that already.] (Til) Til quickly recovered the arrow and released it a second time, piercing a second Numeri Anguilla which was being pushed downstream by the irregular current produced from the shockwave. Her archery skills were as amazing as ever. Similar to the first one, Luna and Selene pulled the thread as I severed the monsters head as it landed onto the ground. Although the monster appears to be easy to kill above ground, if a battle were to commence underwater, this tactic would never work. In fact our roles would be reversed. If the Anguilla were to wrap its body around mine and restrict my movements, I could easily be forced deeper into the water and drown. Rule number one in a battle is to never battle in the opponents zone. If we are unable to defeat it underwater, then well just drag it out of the water. This is how you perform a safe hunt. [Now lets continue at this pace! Tonight will be the Eel festival!] (Youya) [Tons and tons! Next is Lunas turn to cut the head!] (Luna) [I too would like to smash its head with my spikes.] (Selene) Luna and Selene were saying scary things with tremendous vigor. As expected, the monsters inside the river were left untouched. The Sound Bomb which is vital to our fishing plan is an item that is often dropped in dungeons for levels 35 and above. However at that level there are many other items which are much more valuable to collect than the Sound bomb. Its no wonder that these guys were left untouched by other adventurers. The Numeri Anguilla is a level 26 monster. Its time to enjoy this meal with both tasty amounts of meat and experience. . . . . Our hunt for the Numeri Anguilla continued as we slowly but surely continued upstream. There were plenty of other Anguillas for us to hunt as their numbers were left untouched by other adventurers and the amount of Eel Meat (Average) we needed for the quest was secured early into the hunt. Currently we were trying to secure several of them for our own dinner at the bar where we will pass the meat to the chef and have him cook it for us. I am already looking forward to dinner tonight. Courtesy of Lunas Increased Drop Rate, we also managed to get a rare item drop, the Anguillas rubbery skin. We could utilize this to create an armour with high lightning resistance since there are higher leveled monsters that are capable of manipulating thunder, Ill be sure to take care of it so as to not lose it. [Youya, Tired.] (Luna) [Right? I already dont feel like looking at that black and slimy thing.] (Til) [I am having fun though.] (Selene) Since we were just doing monotonous work, walking upstream while occasionally fishing out the Anguillas, it seems that the two children have already gotten tired of it. It could also be due to the steep incline of the area as our physical strength was being sapped away walking upstream. [Dont say that. The hunt for Numeri Anguillas is about to end. Plus, we are about to see a sight that would make your troubles go away.] (Youya) We arrived at an open area with a completely different landscape and the scent of water in the air becomes thicker. [Uwaaaa, Pretty.] (Luna) [Amazing. Its going *dote**dote*!] (Til) [So this is a waterfall. Ive read about it in books but this is my first time seeing one.] (Selene) A gigantic waterfall came into our view. This is the famous location within the Wailing Forest, the Lamenting Falls. With a height of above 100 metres, an overwhelming amount of water falls from the sky and lands onto the lake below with a roar, producing a beautiful rainbow. There arent many sights like this in this world. [Youya, Luna wants to get a closer look!] (Luna) [Im good though, I definitely do not want to get closer to the water falling from the sky. It feels like Ill die if I get hit by that.] (Til) [Lets head towards it!] (Selene) With that mass of water falling from that height, if you were to be directly hit by that water you would definitely be washed off the face of the world. Luna stared at the waterfall with glittering eyes nearby. [Nee. Youya, Is this our destination for today?] (Luna) [Thats right. Behind this waterfall is a hidden room. In that room there is a special monster, a boss that regularly spawns there.] (Youya) [Wait a minute. Are we going to go through that waterfall? Well die!] (Til) [That is why no other adventurers have been able to notice the room.] (Youya) A cave behind a waterfall. Although this waterfall has existed since the games beta, if it was the waterfall during the beta then this would be a totally different matter. I would avoid being reckless in our leveling as much as possible. [I wonder how are we supposed to enter the cave? Even if we were to survive receiving a direct hit from the water falling from above, if we were to be pushed into the water directly beneath it, we would be completely engulfed by the pressure from the waterfall and there would be no way for us to survive.] (Selene) [Truth is, it is possible to stop the waterfall for several minutes.] (Youya) I took a look at my pocket watch. There were a few minutes left to go. At the core of the Wailing Forest, there is a magical vortex with a sign next to it that says: Where the tears of lamentation drops, offer the song of a monkey. The forest begins to dance and the tears will begin to stop. Exactly as it looks like, this was a cipher to reach the secret room where the boss spawns. The tears of lamentation refer to the Lamenting Falls while the monkey refers to the monkey of the zodiac signs. When expressing time using the zodiac signs, the monkey represents the time between 3pm and 5pm. In other words, at the Lamenting Falls, when someone begins to sing a song at within 3pm to 5pm in the afternoon, the waterfall will stop for several moments. Once the waterfall stops functioning, it becomes possible to reach the hidden room behind the waterfall. As always, the deciphering of riddles in this world is hard to understand. Looking at my watch, it was 3pm. [Luna,Til,Selene. Which one of you are the most confident in their singing?] (Youya) The three of them began to think. [Impossible for Luna. Luna doesnt have any songs to sing.] (Luna) It is difficult for me to ask Luna to sing when she doesnt have any memories in the first place. [Uhn. I will pass too. I am good with lutes but to say that I am good at singing would be pushing it. My sister is good with singing though, and I didnt want to compete with her so I went for the lute instead. Musical performance are my specialty.] (Til) [I could sing, but I wouldnt call it a talent of mine.] (Selene) Speaking of which, Phils singing was always the best, I feel like listening to it again. [Then Selene, Could you please sing a song?] (Youya) [If it is necessary.. Its embarrassing but Ill try my best.] (Selene) Selene went as close to the waterfall as possible and began to sing. It was a beautiful singing voice that had the beauty of a beautiful flower and powerful as if there was a powerful force driving it. It was a voice that suited Selene well. It was a voice that I used to hear often back when I was in her kingdom. Then, the waterfall began to change. The loud impacts of the waterfall began to echo as a gigantic tree appeared from above the waterfall, as if it was swaying to the right then to the left. It appears that this is the dance of the forest. As Selene song ended, the gigantic tree got caught between the two edges of the waterfall right before it could fall, blocking the waterfall causing the water to be pushed to the sides. Without the water to conceal the entrance, a secret passage hidden behind the waterfall appears. [That was a beautiful song. Lets hear you sing again next time.] (Youya) [Eee, if uncle Youya is pleased with it.] (Selene) Selene became bashful as the two childrens spirits left their body, staring at the water with sparkling eyes and leaving me and Selene alone [Uwah. The tree really stopped the waterfall.] (Til) [There is really a hidden passage behind the waterfall. Now that it stopped, lets go.] (Luna) The two girls looked like they would disappear into the passage any second now. [Now then, lets hurry. It will only be a few minutes before the waterfall push and crushes that big tree.] (Youya) Everyone began to run towards the stone scaffolding that appeared behind the waterfall with astonished looks as we entered the hidden passage. At the end of this path, is the boss hidden in a concealed room. This will be our first boss fight as a party. Lets crush this boss and gain even more confidence as a party while praying that we will obtain the item to increase our party members limit to welcome Phil. Volume 2 Chapter 19 We entered the secret passage hidden behind the waterfall. The thought had crossed my mind but it doesnt seem like itll be that easy to reach the boss room. [Fortress!] (Selene) Selene activated her skill as a wall of light emerged from the center of Renoirs shield and directly received the Lizardmans heavy shoulder charge. The Lizardman was an extremely muscular bipedal reptile who held an axe in his hands and a pad on his shoulder, resembling something people wore in the 1890s. (Note: I am unsure on what this part means so itll be great if someone could confirm this for me. Raws: ֤˳֤ȤѥåɤǤ嵱Ȥoĩ롣) Two of them had appeared at the same time. The other Lizardman that appeared was currently my opponent. The Lizardman raised and dropped his axe as I deflected the attack and drove my sword into its neck, severing its carotid artery. After severing its carotid artery, I continued to move behind to its back and slashed his back once more. The Lizardman fell to the ground as blood gushed out from its back and neck, turning into blue particles as it landed onto the ground. On the other hand, the Lizardman which charged directly into Selene had its weak points exposed to Luna who flanked and thrust her dagger directly into its body. Meanwhile, the last member of the party, Til was also busy. [These bats, there are so many of them.] (Til) [We can only rely on Til for the enemies in the sky, do your best.] (Youya) Til was continuously firing arrows this whole time. Her opponents were the Mouse Bats, bats with large buck teeth that were also strangely fleshy for a bat. It was a monster that mostly spent its time in the air, and only Til was capable of attacking them unless they were descenting for an attack. Even while muttering complaints, she was accurately shooting arrows onto the Mouse Bats, knocking down one bat after another. No matter how many times I see it, her archery skills is an exciting sight. One of the surviving Mouse Bats signature buck teeth began to glow as it suddenly descended towards Til who had just released an arrow and was unprotected. [Finally Luna is able to land a blow.] (Luna) Our partys middle guard, Luna followed up with a thrust from her dagger into the body of the Mouse bat. The blade penetrates deep into the Mouse Bats small body and turns into blue particles. [Thank you Luna. Fuuee, I was a little bit surprised by that.] (Til) With this, all the enemies have been safely defeated. Somehow we managed this far without suffering much damage. [This is already the seventh ambush since we entered the passage.] (Selene) [Amazing amount of monsters. Luna is surprised.] (Luna) [I have already used up most of my arrows and my inventory is going red soon. I have to start creating new arrows soon.] (Til) [At least it seems that no one has entered the passage ever since the monsters respawn earlier this week.] (Selene) Since this path was hidden behind the waterfall, the number of monsters here have not been controlled by other adventurers. Thanks to this, its basically an all-you-can-hunt buffet for us. Normally we would welcome the monsters with open arms however we would prefer to conserve our strength for the battle against the boss making these encounters a pain in the ass. [Selene, from this point on avoid using your skills and preserve them for the battle with the boss.] (Youya) [I understand.] (Selene) Fortress and Shield Bash were both powerful skills in their own right however they still required mana from its user, itll be better for us to consider conserving our mana and strength from now on. . . . After walking through the secret passage, we have finally arrived at the the end of the passage in front of the boss room. Once we open the door, the boss battle will begin. [As expected Im exhausted. Lunas legs are wobbling.] (Luna) [Ive lost some of the feeling in my arms. The monsters here are strong and persistent, and they have their own strange abilities. It was tough.] (Selene) [Itll be tough for us to battle the boss with how it is now.] (Til) The three girls each had an exhausted look on their faces from the repeated battles. It wasnt unexpected since we had fought another five group of monsters before finally arriving at the boss room. In a short period time, we have already encountered and fought twelve battles. Aside from our mana, our physical strength and spirits were already completely sapped. [Lets continue on to the boss room! Is what I would like to say but its time for a change of plan. Lets take a break and have some food while drinking recovery potions.] (Youya) [Hurray! As expected of Youya. Luna is happy.] (Luna) [Snacks, food!] (Til) [Physical condition aside, is this really okay?] (Selene) [Its fine since this is a one-way trip. Since weve already defeated all of the monsters on our way here, there isnt any chance of a sneak attack from the back whereas the boss will never take a step out of its room. We should only challenge the boss once we are fully prepared for the battle.] (Youya) As such, I took out a sheet from my magic bag and spread it out on the floor. The two children took off their shoes and sat on the sheet. I smiled bitterly and began to pour cold juice into cups and handed them to everyone. Times like these are when I appreciate the handiness of the Magic Bag as items that are placed into it remain as it is. Food placed inside will not go bad, making it possible for us to enjoy cold drinks and even snacks when were outside. [Ah! Youya, is that the fruity rice cake! It was really delicious.] (Til) [That is why I thought about buying it. I thought it was delicious too.] (Youya) Til immediately began eating the rice cake. [Delicious~~.] (Til) I wonder just how tired she was as she started shedding tears while chewing on the rice cake. Looking at such a Til, someone stomach began grumbling as I turned towards the source of the sound. Initially I expected it to be Luna however the source of the sound was Selene whose face began turning red. [Well, our chances of winning will be higher once we take a break. Lets challenge the boss after our tea break.] (Youya) I smiled bitterly as I took out a stamina recovery potion and a greater mana potion and enjoyed the relaxing atmosphere of drinking tea and snacks in front of the boss room. Just like this, my physical strength, energy and plenty of mana recovered. With this, we should be able to put up a good performance. . . . After we were done eating snacks, I began to explain our plan in approaching the boss. The boss attack patterns and skills as well as our party formation against it. In this world, bosses ere an one of a kind unique existences. Only one of each boss can exist in the world at any given time. They are a rare existence, and their unique drop items were materials capable of creating excellent equipment with powerful effects. They also provided heaps of experience points and at the same time, depending on the rank of the boss it is possible to get items from the bosses special item drop table once they are defeated. However fighting a boss doesnt only provide merits, but also a crucial demerit. Bosses in this world had overwhelming strength as compared to adventurers. Monsters in this world often gather in packs and groups to make up for their weaker individual strengths while adventurers would form a party and battle these groups of monsters. That was how the power level in the world was balanced. However, bosses were an exception. Bosses were designed to appear alone against a party of adventurers at the recommended level whom had researched the bosss abilities beforehand and prepared additional provisions for the battle. Even then, it would be a close battle that could go both ways. Every boss in this world is strong. In the first place, it was difficult to even search for the bosss location, making it a life vs death battle to even get to the boss location. Yesterday I had already given a debrief about the information and strategy for the upcoming battle, but I will be going through the information once again to make sure that everyone is on the same page. Right now, we may not be at the recommended level for the battle, however our party has the potential to compensate for our lack of levels. So long as we do what we have to do, we will win the battle. [Youya, Luna remembers it perfectly. Its fine.] (Luna) [Me too, me too!] (Til) [I agree. I have understood the information thoroughly in my head. However, I am definitely afraid of the battle. It is a monster that even Youya is afraid of.] (Selene) [The boss is on a whole different level from any monster you have battled up until now. You may not be feeling it right now but once you see it, your nerves will begin to appear. And similarly it will be a large obstacle to overcome in order to defeat it. However, anything is possible and nothing is impossible.] (Youya) (Note: The last bit in Youyas sentence sounds like a japanese proverb and I have no clue on how to translate it so if anyone could clarify it would be great. Raws: ΤˤʤΤ⡢ΤˤʤʤΤ) This will be the first battle where the girls will be facing the possibility of death. However, so long as I am alive, I will never let that possibility become a reality. [But thats strange. If the monster is as valuable as Youya says, then why is it still here? Wouldnt other adventurers target this monster as their first prey?] (Luna) [Put it simply, there isnt anybody who understands the gimmick behind the waterfall. Every boss in existence only appears in a hidden room. However, just as Luna said. When the method to arriving at a boss room is discovered by an adventurer, it will often turn into a scramble for the right to challenge the boss. The peaceful method to decide who gets to challenge the boss would be the first-come-first-serve basis, however if the peaceful method isnt accepted, then it would turn into a battlefield where the last party standing gets to challenge the boss.] (Youya) The drop items unique to each boss and the shared boss-item tables were both valuable enough for adventurers to chase after. For dungeons with a boss room, adventurers would often camp out the entrance to the room several days before it spawns to be the first party to challenge it, however any adventurers that come after who disagree with the system would often use violence and threats against the first party. The value of information in this world was high. Even if you managed to find a way to safely arrive at the boss room, it didnt mean that the people who had already arrived would readily let you in. Fundamentally speaking, the known boss rooms are often being monopolized. By monopolizing the boss room, every two weeks you will gain access to additional rare items and large experience values. [Scary. Luna didnt know about killing other people just for a monster.] (Luna) [Nothing can be done about that. So long as there is something that you wish for, especially when it is a unique boss drop item. There wouldnt be another method in the world to obtain that item.] (Youya) A monster that only spawns one of its kind every two weeks. Along with the drop rate of 5% for rare drop items that was fairly common for all bosses. However, that causes a situation where every adventurer will be targeting the boss to obtain as much rare items as they can. As for the items obtained from the boss, it is possible to obtain enough money to survive for the rest of your life. As such there are many people who aim to monopolize the bosses present within lower leveled dungeons to obtain rare items for a fairly low risk to the point that adventurers would be willing to kill other adventurers for it. Unfortunately, the boss room present within the dungeon at Flaregard is already discovered as well as the method to arrive at the room. It is inevitable for us to join the battle for the boss as there is a drop item that can only be dropped by the boss there that I want. Although just for that boss, the entrance to the hidden room doesnt appear until the boss is respawned, and since the method for traveling directly to the boss room was discovered, adventurers stopped entering deeper to clear out the dungeon, providing an abundance of monsters and unactivated traps in the dungeon. In regards to the battle for the boss room, it is still a peaceful battle as it is basically a game between the adventurers who aim to reach the boss through the hidden path, and us who will most likely be travelling the hard way. [Were are lucky that this is a boss that no one else besides Youya knows about. Itll be tiring for us to fight other humans before the boss battle.] (Til) [I agree. I dont particularly feel like picturing that right now.] (Selene) [Exactly as what Til mentioned. Now then, the time for chit-chat is over. Shall we begin?] (Youya) The girls nodded confidently and stood up. Then, the four of us looked towards the entrance of the boss room. I pushed open the door and entered the door without any permission. Boss rooms in these world has two ironclad rules. First: Only one party can be present at any time. Second: Until the battle is over, nobody will be able to leave the room. Even Return Stones are rendered ineffective. The boss room is a spacious room with uniquely coloured green walls, with a large throne-like chair in the middle of the room. However, unlike a throne befitting a king, it is just a crudely made chair that is large in size. There was a figure sitting on the chair which was large enough to make me look like a newborn-infant. It was a boss with the head of a cow and a human body. A Minotaur. In one of his hand held a large axe which was suitable for his large physique. [Human..ArrivedLong timeWell donePuzzle..Door..Proven wisdomNext..Is power.. Show me.. Defeat this Minotaur.] (Minotaur) The Minotaur let out a horrifying roar producing an overbearing wind, sending chills down my spine. However it wasnt just a normal roar, it was a roar capable of stiffening a persons body with fear. As expected, everyone was rigid at the start as the Minotaur began to approach us. However, that rigidness was immediately dissolved. [Everyone, dont be frightened. Just remain calm and do as we planned. Afterwards, all thats left is to win!] (Youya) I let out a battle cry, and began running into the battle towards the Minotaur. The Minotaur began gathering power and activated his skill. It was a skill that the Minotaur would always activate at the beginning of the battle. If we were to receive that attack head on, its the end. Now then, this is my first boss battle ever since the reset. Lets win this, and push our party forward even further! (Note: Im going to just italics the name of each monster as they are introduced, but not when it is repeated. Also, for the ending it was slightly altered as the raws stated something similar to putting foil on? So im just going to assume what it meant. Raws:ѩ`ƥ˲ĤƤ餪) Volume 2 Chapter 20 The fight against the boss, the Minotaur has begun. I started running directly towards the Minotaur as Selene caught up, giving an apology for being late to the front. The Minotaur stood up from its crudely made throne, lowers its hips and points the large horn on its head in our direction. The horn then begins to glow. Its coming. Selene held her shield up in an attempt to receive the attack. [Dont get hit! Dodge to the side!!!] (Youya) The situation was dire from the start, Selene who was delirious from the Minotaurs roar earlier had forgotten the precautions that I had told everyone in advance before the battle. However, somehow Selene regained her senses as she attempts to jump to the side. The next instant, a large impact roared throughout the room as the Minotaur disappeared from the throne. The ground between me and Selene begins to shake as if an earthquake had struck the room. Looking behind us, the Minotaurs horn pierced the wall in the corner of the room. That was the Minotaurs signature move, Horn Crash. It was a skill that required a set amount of distance to accelerate to its maximum power, but it was the Minotaurs most powerful charging technique. Just attempting to follow him with my eyes made it seem as if he had disappeared. It was said that the moment the Minotaurs horn begins to glow, everyone has to jump to the side immediately. It wasnt an attack that can be received using Fortress, it is an attack that is impossible to match. However, it was an attack with a large range of motion, giving an opening of several seconds even after the horn begins to glow. Meanwhile, in that opening, it is a given that we have to dodge that attack. It may seem like a dangerous attack that easily slaughters every opponent, however it is an attack that is easily rendered ineffective if you were cautious from the beginning.. [This is the power of a special monster If I took that then I would be dead] (Selene) Selenes voice trembled as she started to lose her grip on the battle. I hadnt realized that her heart was this fragile in a life-threatening battle. The Minotaur finally recovered from his charge and turns around, charging with his axe. Its target was Selene. Selene, while panicking directly received the axe with her shield. As a result, Selenes body was blown and crashed into the wall from the Minotaurs heavy attack. That is the result if she were to receive a blow head-on without using the spike to stabilize her footing. [Gah Hah This level of strength. Am I supposed to keep defending against this?] (Selene) As Selene leaned against the wall, trying to recover from the previous attack, the Minotaur approached Selene and raised its axe. Selene began trembling as she stared directly at the axe, without any indication of preparing her shield. In that instant, arrows began to rain all over the Minotaur. Til was running around at a distance, biding her time releasing arrows one after another. However, that wasnt all she was doing. [Lightning Arrow] (Til) She released the beginner-tier magic, Lightning Arrow which struck at the speed of lightning simultaneously. It is a newly-obtained skill after she obtained the passive skill, Arrow Generation which increases the power of her arrows. Since it is a beginner tier magic which only struck a single target, it has a short casting time with high attacking power, furthermore it has a low mana consumption. As compared to the advanced tier magic, Thunder, it has a far higher damage to mana efficiency in this situation. Til began to shower the Minotaur with a volley of arrows and thunder. [GUUUUMOOOOOOOOOO!!] (Minotaur) While getting struck by countless arrows and lightning arrows, the Minotaur stare directly at Til. It looks like it had changed its aggression completely towards Til as it ran towards her. [Selene, what are you waiting for? Hurry up and use War Cry!] (Youya) [Eh? Uhn.] (Selene) Her reaction is too slow! The Minotaur is already approaching Til in a charge. Our original plan was for Selene to hold the Minotaurs aggression using War Cry. Otherwise, Til who was our partys specialized attacker would be targeted first. If Til who has low defensive stats were to fall here, we will lose our partys main firepower. Selene herself knew this fact. However, when the Minotaur released Horn Crush as its first attack, it was an attack which was meant to completely annihilate everything in its path. Selenes head was completely dominated by fear after nearly losing her life and getting blown away from the monsters basic attack. [Mr. Cow. You cant just focus on the front, your sides are open. Assassinate!] (Luna) Unnoticed, Luna who was running parallel to the Minotaur with similar speed almost condescendingly releases Assassinate as the ringing unique to critical hits could be heard throughout the room. Assassinate is a skill that has a drastic increase to the damage dealt whenever it landed as a critical hit. The Minotaur whose weak point on its flank was stabbed by Luna, stomped the ground and bellowed in fury. [GYUUUNOOOOOOOOO] The Minotaur raised its axe filled with fury and swung it downwards Luna. However it was easily avoided by Luna who did not overstep her boundaries as she immediately jumped backwards to avoid the attack, increasing the distance between her and the Minotaur. In our party, Luna played the vital role of being the middle-guard to follow up on our backline, Tils attacks whenever she sees an opportunity to land a deciding blow. I had placed firm emphasis on that teaching. Although the Minotaur was irritated at Lunas attack, its focus returned to its original target, Til. However Til had already created a distance between herself and the Minotaur and was preparing another volley of lightning and arrows. The Minotaur continued towards Til in rain of lightning and arrows as it caught up to her with pure speed and swung its axe. The axe which was moving towards Tils head.. Was obstructed. [Good job Luna, thanks to you I made it in time.] (Youya) Thanks to Lunas distraction which caught the Minotaurs attention for a few moments, I managed to close the distance and intercept the axe before it reached Til. Originally it was Selenes role to be the tank, however as she was currently overwhelmed by the Minotaurs strength. Until she recovers, I wont have a choice but to be the tank in her stead. I activated War Cry to catch the Minotaurs attention. It has lesser of an effect as compared to a crusader, however it is still effective for a short amount of time as the Minotaur swung its axe down towards me. I used my signature Deflect to divert the blow away. It was an extremely heavy attack, however with my current status it is possible for me to completely divert it away. Selene earlier was also supposed divert the attack rather than receiving the attack head on. If it was the usual Selene, then it was possible for her to do so. That was how I had trained her, however fear has clouded her judgement. Doesnt matter how much power or skill a person possesses, so long as there isnt the presence of mind capable of demonstrating it, it may as well be all for naught. In order to obtain the strength in your heart, it must be capable of overcoming your own fear. I continued to take control of the Minotaur subsequent attacks while Til was continuing to fire volley after volley of arrows and lightning arrows towards him, slowly but surely damaging him. Suddenly, the Minotaur threw away his axe and its two hands began to glow, resembling the activation of a skill. It looks like it was coming as I immediately raised my concentration and focus to the limit. [GAAAAAAAAAAAAAAAAA] Hurricane Rush. It is a flurry of powerful attacks coming from both its fists. One, two Three. Even though I could deflect each blow to an extent, heavy fists continue landing one after another. Through my Deflect, my posture was steadily collapsing as the weight of each blow was higher than its normal attacks. The effect of the skill also included an increase in his defensive stats, making it pointless to interrupt the attack. For now, all I can do is to endure it. At the ninth hit, with my posture completely disrupted, I had no choice but to receive the blow head on as I received the punch with my sword. While the punch was about to land, I jumped backwards and was blown backwards. I rolled on the ground in an attempt to kill the momentum before standing back up. Finally, his skill ended as the Minotaur suffered a backlash from the powerful Hurricane rush and remained on the spot. [Full of openings! Assassinate] (Luna) [Just how much do we have to attack before you fall!] (Til) Luna landed another blow with Assassinate as Til fired yet another volley of arrows and lightning. [GUUUUUUUUUGGGGAAAAAAAA] The Minotaur screamed in pain as it continued to accumulate damage from all the successive attacks. However there wasnt any time to be relieved. From that one flurry of attacks, even with Deflect I still lost about 30% of my health. This is a boss battle. Once again, its aggression was focused on Til who had dealt a significant amount of damage and begins attacking her once more. Matter of fact at the moment is that I am unable to fight back against this opponent. Just Deflecting is taking all I have. Furthermore with each hit my accuracy is decreasing as my arms become numb. To add insult to injury, as I am unable to participate in the attacks, our damage output is garbage compared to our maximum potential. In order to have a better chance of winning this battle, Selenes power is necessary. Even if she did not continue in the battle, we could win but it will still be a tough battle. However, if we do not help Selene recover from this beating then she might have the memory of running away from this difficult battle. Fleeing from one battle and leading to another. Sooner or later she will never learn to step up whenever the push comes to shove. Having a tank whose first thought is to escape will never be a competent tank. While receiving the minotaurs heavy blow, I shouted at the top of my lungs. [Selene! How much longer do you plan to just stand there!? Are you the kind of warrior that can only pick on monsters weaker than you!] (Youya) Selenes shoulders shuddered at my sudden outburst. [No matter how weak I was, I had always challenged the strong with feelings, with a craving for victory far stronger than anyone I have ever faced. Yearning for the strength to overwhelm them with my own. Isnt that the figure you have always looked up to? You said that you always wished to be like me. Unfortunately, my strength was always a counterfeit. And yet you still continued to look up towards me. Thats what I have always thought about you. If that is true, then show it to us, and bring out your courage!] (Youya) Selene who was in a visibly miserable state lost her voice as she appeared unable to say anything, neglecting her own stance as her chest sunk into her knees. For an instant, her consciousness seemed to disappear, dissuaded by the power of the minotaurs basic attack earlier. [GUMOOOO!] (Minotaur) The minotaurs attack continued as he threw another kick towards me. I tumbled to the side in order to avoid the first attack and stood up with conviction. With a swift motion, I took out the black magic sword and circled around the minotaur, slashing his open side. [GUMOOOOOOooo!] (Minotaur) Even with Selene being in this state, Luna and Til continued to say nothing. Instead, they continued to convey their thoughts to Selene through their actions. No matter how afraid they were, they continued to perform their role and do what they had to do. [Selene, if you dont stand up in this battle then you will never be able to change. CHOOSE! Continue to chase after the figure you wish to be, or continue to be satisfied raising your levels and your status! As your teacher I am telling you now, your strength and techniques are enough! Open up your eyes and look! Is this beasts attacks sharper or faster than any of my attacks during your training!?] (Youya) I may be forcing a hard decision onto her, but I know fully well how difficult it is to repair a broken spirit in the heat of battle. However, if we neglect this opportunity, then Selene will never be able to grow. Selene grinded her back teeth together, however the person herself didnt move an inch. Just when I thought it was hopeless. [War Cry!] (Selene) Selene activated her provocation skill, pulling the monsters aggression towards her. She activated a dangerous skill despite her trembling legs. The minotaurs attention turned towards Selene as it charged towards her. Meanwhile, its axe regenerated and appeared in its hand. It swung its axe towards Selene as she held shield, however she hadnt activated her spikes. She looked directly at the minotaurs axe without blinking and lowered her upper body, holding her sheld at an angle. [Nice.] (Youya) The spikes are effective and convenient to use, however it isnt something that should be activated without any thought. Ideally, the spikes should only be used for powerful attacks that cant be avoided. Aside from that, we should be handling the situation using our own techniques and combat skills while using the spikes to increase the effectiveness of Shield Bash. By learning to deflect attacks to the side, you receive lesser damage as compared to receive an attack head on, plus it makes it easier to transition into an attacking stance. Furthermore, once it is used it cant be used for a short period of time. This method also has the merit of allowing the person to reserve their Fortress for another time. This is the battle style of the Battle princess Renoir. Her current figure in battle is heavily reminiscent of the figure of Renoir seen in the game. No, Im mistaken, its not just her. Although she was using a shield, I could see a trace of my sword somewhere in her shield. That was proof that my teachings are being embedded into her. [Uncle Youya. Im sorry. My eyes are finally opened. Its attacks are heavy but its much slower, sloppier and softer to sink as compared to Uncle Youyas attacks.] (Selene)- Selenes voice was still trembling, however I could feel her conviction behind her words. [Selene is late! However, now we can finally fight as planned.] (Luna) [Right? Selene is our tank, Youya is a close quarters fighter, Luna is our middle guard while I am in the back guard. That is how our party battles.] (Til) Luna and Til shouted out a clumsy encouragement each as Selene smiled back while receiving the minotaurs attack. With this, we can finally demonstrate our original battle plan against the boss. Me and Luna crossed eyes as we began to run towards to the boss, Luna continued to the right while I turned to the left. Gathering magic power onto my left hand, it condenses and turns into a flame, burning brightly. [Assassinate.] [Napalm Strike.] Now that its attention was completely occupied by Selene, I can afford to release a powerful attack. My left hand was imbedded into the minotaurs flank as the explosive effect of the spell runs through its body. Meanwhile, Luna landed a critical attack using Assassinate. Simultaneously receiving a super high power spell on the left and the right, the minotaur was completely pushed back. [UGAAAAAAAAAAAA] (Minotaur) Without missing a beat, the minotaur further lowered its waist and turned its head towards Selene. Its horn began to glow. It was the characteristic of Horned Crash. In response, Selene began pouring mana into her shield, preparing to release her spikes. Is she starting to get too excited and forgot my instructions? The explosive power of Horned Crash wasnt something that could be prevented. Even if she uses her spikes and Fortress in preparation, it isnt enough to protect her against the attack. It is an attack that cant be stopped. However, looking at Selenes composure, I decided to stay silent. She clearly remembers my words and wasnt panicking just like earlier but with a look of conviction in her eyes. This was the move that she planned to bring for victory. Selene began to run forward. Continue to run forward. With all your might! [HAAAAAAAAH.] (Selene) The minotaurs horn locked onto the figure of Selene who was currently running forward with her full strength and its skill was activated. The instant it was activated, Selene launched her spikes onto the ground and applies her entire weight onto her shield. [Fortress.] (Selene) A wall of light appeared from Selene shield, the crusaders special skill that increases their defense multiple times for several tens of seconds. However, Horn Crush was still too powerful to be stopped by her increased defense. However, that didnt happen because Selene had ran forward. By closing the distance between her and the minotaur, the distance required for the minotaur to reach his sure-kill level of power was reduced, hence reducing the amount of power she received. When the minotaur collided with Selenes wall of light, Selene was being pushed back, causing the spikes to gouge out the ground under her, throwing dust everywhere. In the end, Selene stood strong as the Minotaur failed to penetrate Selenes shield and was actually damage by the recoil of its charge, breaking its horn. The minotaurs defense was wide open when his horn was broken. It was an opportunity to push the offensive. [Til!] (Youya) [I know that!] (Til) I began chanting as Til concentrates her volleys of Lightning Arrows and normal arrows onto the minotaurs stomach, gouging its flesh while simultaneously burning the area. Electricity begins to crackle on my palm as the air around my palm begins to tremble. My long chant is finally over [Superconductive Bullet!] (Youya) My customized magic made from Lightning Storm. By increasing the casting time and sacrificing its area of effect, the spell was remade into a single shot of lightning with explosive range and power. I fired the spell onto the exposed flesh at the minotaurs belly, further gouging out its flesh while burning the surrounding area, inflicting damage incomparable to Tils damage and paralysis onto the minotaur. The next attack will decide the battle. [End it, Selene!] (Youya) While I called out to Selene, I began moving towards Selene as she nods back, increasing her pace towards the minotaur. Twist your hips and stick out your arms, eject the spikes as the arm is accelerated, increasing the acceleration of the spikes to the maximum. [Shield Bash!] (Selene) [Gods Strength!] (Youya) I have watched her repeat this movement countless times, making it easy for me to match her timing. Just before her spikes crashed into the minotaur, Shield Bash converts her defense power into attack, and I amplify her increased power using my Customized Magic: Gods Strength for several moments. Together with a loud explosion, her attack which was amplified multiple times pierces into the Minotaurs stomach where we had previously attacked, penetrating its body and transferring all her kinetic energy into its belly, causing its stomach to bulge up like a balloon. [YourPowerSeen. RewardItems..HoweverWeakest.. Yet to see.Challenge Real fear Now on.] It seems that the attack earlier was the finishing blow as the Minotaur says its last words before turning into blue particles, leaving behind two items. First was the item Ive been hoping for, the Thread of Bonds which increases the party member limit. The second was the rare item unique to the minotaur, the Scarlet Horn. Weve gotten extremely lucky ever since coming to Greenwood. First was the Starfish Larvae, second was the minotaur and now its the rare item drops. After the Minotaur completely disappeared, Selene knelt on her knees as she had an astonished look on her face. [I.. won? I actually survived.] (Selene) [Yeah. You got of to a slow start but it was a magnificent ending.] (Youya) This experience will serve well to give Selene courage in the future. Next time it wont be so easy for her to be overwhelmed by fear, helping her grow significantly. [I see.. Im glad. I was scared.. And couldnt move my legs. Everything went white. The moment I heard uncle Youyas voice.. I thought that I had to do it.] (Selene) Selene jumped into my chest as I hugged her and pat her back. [Even so. You did it. You became stronger. This time, you are genuinely stronger.] (Youya) At the start, Selene couldnt help but panic as she faced death. However she still managed to pull it together and recover from her trauma. That was proof in of itself. [Now then, lets return home. There should be a vortex somewhere at the back. Well continue the training once we are back but there will be a bonus for defeating the boss.] (Youya) After hearing the word bonus, Luna and Til ran over. [Bonus!] (Luna) [Tonight is going to be another feast!] (Til) The two girls began chanting and danced as if they were performing a ritual. I wonder where did they get this idea from. [Uncle Youya.. I have a request.] (Selene) [What is it?] (Youya) [I dont have any strength left in my legs.. Could you carry me.] (Selene) Selene said her request with a bright red face. I smiled bitterly at her request. Till the bitter end, she still hasnt changed a bit. I guess that cant be helped. [Kyaaa. This is embarrassing.] (Selene) [Today is a special day.] (Youya) Instead of the usual piggyback, I carried her with a princess carry as a reward for working her hardest today. [Youya~, Lunas legs cant move too.] (Luna) [Me too!] (Til) The two girls who seemed to have completed their rituals had envious looks as they sat on the ground. [Give me a break. I cant carry three people at once. Maybe another time.] (Youya) [Roger that!] (Luna) [Its a promise okay!] (Til) The two people who claimed to be exhausted suddenly jumped up in excitement. Seriously? These girls.. Well I have to admit that this is kinda fun. Now then, its time for us to return. Lets not forget the reward for breaking through the trial for today. We seem to be celebrating a lot recently, however today was definitely a good day for a celebration. Above all, its been extremely fun. Volume 2 epilogue Volume 2 epilogue Epilogue: The old man thinks about a new stage We managed to defeat the boss in Greenwood, the Minotaur. It was unprecedented that Selene was traumatized by the battle, however the result was even better than I expected. It is difficult for someone to gain the courage and experience to overcome a life-threatening fear. It wouldnt be likely for her to encounter another situation quite like this and make it out unscathed. We also managed to obtain the item that is necessary for us to add Phil into our party, the Thread of Bond. It is an item that can only be obtained from the common boss item table, making it extremely lucky for us to obtain it in a single try. The other item we obtained was the Minotaurs unique drop, the Scarlet Horn. With this horn, it is possible for us to forge a magical sword with the flame attribute and a decent attack power. Unlike normal materials, materials obtained from bosses can be used to make powerful equipment regardless of the users level. In the next city, the City of Forges, Flaregard there are first-class blacksmiths who are capable of turning this bad boy into a sword. Lets hurry up and finish our leveling so that we can head over as soon as possible. [Bo-nu-s~ Bo-nu-s~] (Luna) [Luna, I wonder what kind of bonus we are going to get~.] (Til) The two girls were energetic as we headed towards the next room. At the back of the room, there was a small room hidden at the side which can be seen once you walk past the throne. In that room, there is a treasure box in the center while the vortex can be seen at the back of the room. [Luna, could you open the box?] (Youya) [Leave it to me!] (Luna) It was Lunas job with Lockpick to open the treasure box as any traps present would not activate thanks to her Level 5 Lockpicking skills. While her fox tail was shaking back and forth, Luna opened the treasure box. [Youya look! Its a Return Stone.] (Luna) [Thats a huge haul. Treasure chests are always present once you defeat a boss, making it easy for us to get rare items from the box.] (Youya) It takes a long time to defeat the boss, however once you do, there is a chance to obtain a rare item drop from the boss itself as well as the common boss loot table. Furthermore there are bonuses such as these as well. Although it is possible to be unfortunate enough to get common items such as Return Stones and Magic Bags (Large), there are also items that are only available from the treasure box. [Selene, this Return Stone belongs to you. Take it.] (Youya) [Again, I wonder if its okay to give me something this valuable.] (Selene) [Me, Luna and Til already have a Return Stone on us. With this all of us have a method of escaping without much risk. Its nice that we managed to obtain another stone this early.] (Youya) The stones that the three of us had were given to us by Phil, however there isnt enough for all four of us. Now we managed to get Selene a stone as well. [We managed to get good items for today, but sadly the feast has to be postponed for now.] (Youya) [We cant turn the rare items we got from the Minotaur into cash too cant we? Its a shame but looks like its the usual bar for us today.] (Selene) The two girls who were looking forward to dinner had a look of dejection as we didnt obtain any funding for a feast. However, that actually isnt a problem as we had plenty of Eel meat inside my Magic Bag. [Actually, the eel meat we obtained from the Numeri Anguilla sells for extra in the market here, plus we will have the reward fee for the handing in the eel meat (Average) for the quest. So frankly speaking, it is still possible to have a feast for tonight.] (Youya) The faces of the two girls lit up like a light bulb as they reinitiated their ritual. Thanks to Lunas Increase Drop Rate and the untouched Numeri Anguilla, we were able to obtain a large amount of eel meat. [Now then, shall we return home everyone?] (Youya) [Uhn. The feast is waiting.] (Luna) [Tonight I will get revenge on the cursed alcohol.] (Til) [Although itll be great if I could stand by the time we head over to the bar.] (Selene) And, we finally jumped into the magical vortex. The things we have to are to deliver the items to the guild, return to the inn before heading over to the bar. . . . We completed our report on the completion of the quest while trading away the surplus we obtained from the hunt. The receptionist completed the exchange with an astonished look as usual. As expected, the Eel meat (Average) was worth a large sum of money, nearly three times the price of Pork (Average) even at its normal market price. We obtained an even larger reward fee as we got an additional 50% of its value due to the quest. I wasnt surprised at the price as eel meat (Average) is a rare find and very delicious. I had also asked the receptionist to introduce me to a restaurant capable of making good use of them as we were planning to indulge ourselves in a delicious meal. Thus, it would be better for us to enjoy plenty of Eel meat in a store with higher quality than usual. . . . After changing into our casual clothes at the inn, we headed towards the bar. Todays destination had a private room for us as it was a somewhat luxurious store with food that was fitting to its price, allowing us to indulge ourselves with delicious food. I handed over the Eel meat (Average) and I agreed to the waiters suggestion of simmering the meat in wine. Luna and Til were scanning the interior of the store with glimmering eyes as if they had discovered something amazing. The furniture was well-decorated with a good sense. It was amazing and fun to just look at it. [I bet Selene is familiar with this kind of stores right?] (Youya) [Yeah. It feels nostalgic.] (Selene) Selenes true identity is Princess Lutra. Even though this was a luxurious store for adventurers, its standard was still somewhat inadequate for a princess to frequent. Next moment, the waiter arrived carrying three mugs of wine and one mug of ale. The two girls were fuming with vengence as they planned to fulfill their revenge against their dreaded alcohol, though I pray that they will be able to enjoy their drinks like adults. Ill have to remember to stop them if they go out of control. [A toast for our victory!] (Youya) [Cheers!!!] We bumped our cups as we took a sip and savoured the liquids in our cups. As the ale flowed down my throat, I felt my tired body being enveloped with a refreshing bitterness. Ale is definitely the best for me after all. The mug was emptied in one go and immediately asked the waiter for another cup. I wouldnt be able to enjoy myself without doing this [The wine really varies greatly depending on the store. The taste of grape in this stores wine is really strong.] (Selene) [Uhn. Completely different. It is delicious but Luna prefers the other store. Their wine was much sweeter.] (Luna) [I prefer this stores wine as the smell of fruits is much stronger.] (Til) The wine here may not be a first-grade product, however it was still very well made. The mixtures added were most likely minimal. When the store serves its wine in a mug rather than a glass, it can be taken that the store isnt meant for the upper class of citizens in the truest sense. It is most likely a luxurious store for ordinary people and adventurers with good income. [Selene, could I have a taste?] (Youya) [Sure, I dont mind.] (Selene) Im not planning on ordering a cup but I definitely would like a taste. I lifted Selenes mug as I took a sip. It had a taste similar to a proper wine. [Thank you Selene.] (Youya) [Uh, yeah your welcome.] (Selene) Selene face went completely red as she watched me drink from her cup. She is definitely still a pure maiden princess to be embarrassed from an indirect kiss. As an adventurer who has been in dungeons for multiple nights in a single adventure, this kind of thing is rare to see. Itll be good if I could help train her resistance to this sort of thing slowly. [Youya, the dishes are small but each of them taste delicious!] (Luna) [Their designs are so beautiful that I cant help but get right into it!] (Til) The store didnt serve their dishes like a typical store and instead served their dishes as if it was a course meal. Small but numerous dishes were being carried over one dish at a time as each dish was annihilated by Luna and Til the moment it touches the table. After finishing each dish, they continued to look at the door with shining eyes filled with expectations. The food here tasted great befitting of their high price. Its a nice shop for us to relax on special occasions. Then, todays main dish came as the waiter entered the room, filling the entire room with a delicious fragrance. [Its my first time smelling something like this.] (Selene) [Is this your first time having eel meat Selene?] (Youya) [Yes. Since its uncle Youyas favourite dish l look forward to eating it.] (Selene) The eel meat was placed on a large platter directly in front of us covered in wine. Boiled eel with wine was my favourite dish, and back when I was still travelling together with Phil, she learnt to make it extremely well. It was for this reason that I decided not to sell all of the meat we had on us back in the guild. The sweetness of the vegetables and the saltiness of the butter spreading together with the smell of the eel spread throughout the room. I took a knife and began cutting the eel into equal parts. Whenever I felt the knife come in contact with the eel meat, I felt the elasticity of the meat pushing back against the knife. After finishing the portioning, I placed a piece of meat into my mouth as I savoured the texture of the me and the taste of the eel fat spreading throughout my mouth. By mixing red wine with tomatoes, the oily taste of the eel is neutralized, leaving only the delicious umami in the meat. As soon as the first piece is swallowed, you cant help but reach out for another piece. I quickly gulped down a cup of ale before the umami dissipates from my tongue. Its the best taste in the world as I felt the impact right through my brain. [Ive been longing to eat this.] (Youya) Since eel meat is an expensive and rare dish, it is rarely circulated to a common store. Thus it was a luxury that can only be eaten by obtaining the ingredient by yourself. I am glad that we managed to encounter the Numeri Anguilla in this town. [Youya, this is delicious! Even though its a fish, it isnt pazapaza at all!] (Luna) (Note: I have no idea what she means.) [I have never had such a delicious fish. I didnt even know this kind of thing existed. This didnt exist back in the elf village.] (Til) [Im surprised as well. The taste that feels like it has incredible vitality, its as if Im feeling energized just by eating it. Its been one surprise after another since I met uncle Youya.] (Selene) The eel meat simmered with wine was even more popular as it was already disappearing from the platter. We continued to drink alcohol as the meal went on. In the blink of an eye, Luna and Til had already ordered and finished their second cup of wine. However, for their third cup, Luna had ordered milk while Til ordered a cup of grape juice instead. They were still capable of thinking rationally although they both had a small body, causing the alcohol to take effect quicker than usual. The amount they had drank was probably the right amount for each of them to drink. Next came the main dessert. It was a cake filled with cream as the girls jumped in joy. As expected girls are in love with sweet things. After we finished the cake, we continued to enjoy a cup of tea as everyone thoroughly enjoyed the dishes in this store. Thinking it was an appropriate time, I said. [Everyone please listen to me. Its about what we will be doing from now on.] (Youya) Today was a celebration, however I chose this store with a private room as I wanted to talk about our plans for the future. The girls eyes all converged onto me. [We have become much stronger as compared to the start. And we even managed to defeat the boss. At this pace, it wont be long before we become stronger and reach level 30. By the time we hit level 30, the experience points we gain in Greenwood will become exponentially lesser.] (Youya) Bosses were monsters that gave a tremendous amount of experience points different from a standard monster. Although it is said to be difficult to raise our levels in the 20s, the Minotaur had given us enough experience points to raise everyones level. As a result, I am level 27 while Luna and Til were both level 26 and Selene is level 28 [Untill the Minotaur respawns eight days from now, we will continue to raise our level like this around the hidden room an immediately defeat the Minotaur once it respawns. Then, after these eight days, we will continue to hunt as many monsters as possible in the labyrinth until we leave Greenwood.] (Youya) After it spawns, the Minotaur will most likely increase our level by one again. If we followed this plan, we could even level up to 30 right after the eight days, and even if we arent able to hit level 30, we will definitely be able to reach level 29 at least. For dungeons with a recommended level of 28, the experience gain will become exponentially worse as our levels increase beyond the recommended level. Monsters below our level will have the appropriate decrease in experience points, making it difficult to increase our levels just by hunting weaker monsters. [Understood! Looking forward to the next city already!] (Luna) [Suddenly the monsters in this town is already insufficient for us. Lets hurry up to the next town to become stronger!] (Til) The two children became noisy while Selene remained silent. It looks like she understood what I meant to say. [The next town we are heading for is in the far east, Flaregard. Unlike Greenwood, it isnt a distance that we can easily transverse to return to Selenes home. Plus the duration for our stay is going to be at least a month. Although we had initially planned to return in time for Selenes inheritance ceremony, if we head over to Flaregard we might be unable to make it back in time.] (Youya) Even though Selene was set up by her siblings, it was still possible for her to return to the Laluzulu Kingdom. However, if we head over to Flaregard it will truly become impossible for us to return to the kingdom in time for the ceremony. It was her last chance to return to the kingdom. [I told you before. Until the ceremony starts, I am Selene, not Lutra. I dont plan on going back on my word. Lets go to Flaregard.] (Selene) Without hesitation, Selene asserts her stance on the matter. It seems that it was an unnecessary worry as Selene was already resolvedd from the start. [I understand your feelings now. Then, before we leave in 10 days, lets try harder than we have ever did before. Everyone, be sure to reach level 30 by then.] (Youya) [Luna will do her best!] (Luna) [Uhn uhn. Itll be depressing if our departure was delayed because we didnt level fast enough. Plus itll be bad if we dont hatch the egg soon.] (Til [Itll be a shame to leave the rare items we have as it is. Ill like to quickly make a gauntlet using the item we got from the Terrafish Larvae.] (Selene) Everyone began to talk about their expectations when heading towards Flaregard. Looking at how Luna and the girls are enjoying themselves, I felt myself enjoying life even more. The city of flames and blacksmiths, as well as the city of hot springs. Flaregard. The flame which was born the same time as the world, capable of melting everything without extinguishing even once.,The Sacred Flame and the best blacksmiths in the world who are capable of using it to create powerful equipments. Using their hot springs which draws out a persons magic power and cleanses the persons soul, we are able to hatch the Magic Egg to give us a new fighting force. A volcano that contains the hidden item necessary to increase the number of party members by one. The special item that must be obtained from the boss in Flaregard and a skill that cant be obtained anywhere else. There are countless reasons for us to go towards Flaregard, plenty more reasons as compared to Greenwood. Originally, it isnt a town where a 2 month old party should be heading to. However we will be fine. Because my party is the strongest party there is. The thief who is overflowing with talent and battle sense fighting at the middle guard as well as possessing exploration skills. The spirit archer who has mastered the art of the bow and magic, capable of utilizing them both to their maximum potential. The crusader who has inherited the battle style and skills of the battle princess Renoir, becoming the strongest tank in the world. Then, Phil will finally be joining our party at last. I havent mentioned anything about it to the girls yet, but a letter came from Phil the other day that the matters of the guild has already been resolved. With this unstoppable party, there are no obstacles that we cant overcome. With delicious sake and hearty laughs, it was the best night I have ever had in awhile. We will only continue to grow from here, and continue moving forward. These were all the pleasures that I couldnt experience in decades. 10 days from now, we will head to our new stage, Flaregard. Volume 3 Chapter 0 prologue The most difficult dungeon in Greenwood was the Wailing Forest. Within the forest, there was a waterfall called the Lamenting Falls which hid a hidden room. We were currently in that hidden room battling the boss monster, Minotaur. Although this was our second time battling the monster, tension could still be felt in the air as a single mistake could risk our entire annihilation. However, that was about to end as the end of the battle is in sight. Slowly but surely, the Minotaurs stamina was being whittled down at a pace far faster than our previous attempt. That was the proof that Luna and the girls were growing. Not just in terms of levels, but their heart and skills were improving day by day. In the first battle, Selene who was mentally traumatized initially was properly performing her role as the tank right from the beginning in this battle. Finally, the battle ended as the Minotaurs skill Tyrant Slash was stopped by Selene and Luna rushed towards the Minotaur who got its balanced disrupted from the recoil, releasing a high-speed thrust. [Assassinate!] (Luna) Along with Lunas battle cry, a shrilling sound was resonating throughout the room, indicating that her attack had landed onto a vital point on the Minotaurs body, magnifying tremendously the amount of force her attack originally had. In games, critical hits were mostly activated based on your luck, however in this world it is possible to ensure a 100% critical rate in a single battle. With that hit, the battle came to an end. [YourPowerSeen. RewardItems..HoweverWeakest.. Yet to see.Challenge Real fear Now on.] The Minotaur muttered its usual phrase before turning into blue particles. If you listened closely, his phrase was actually a foreshadowing for the future. A large impact could be heard as the Minotaurs axe and an ore dropped onto the ground. [As expected, Itll be too much to get two rare drops in a row.] (Youya) [Although an axe looks like better than a horn.] (Selene) The unique drop item we got this time was the Minotaurs axe. Although it was an impressive grade of equipment, it is still only in the realm of strong equipment. It is a weapon that a person could easily obtain just by paying extra for it. It was a piece of redundant equipment though, since I am unable to wield an axe, nor do we have an axe-wielder in our party. Well be turning the axe into materials since it looks like it would make good materials. [Looks like the common boss item we got is an Orichalcum ore, which is pretty nice.] (Youya) It is a top-class metal among all the different magical metals that exist in this world. Although it is an essential part of forging the highest possible class of equipment, the methods of obtaining the material is limited. It is such a rare item that you would expect it to drop from a monster that was at or close to level 50 to obtain it, and even then it has an extremely low chance. Together with the Scarlet Horn we got the last time, we should be able to make awesome weapons with this. [Now, lets get the treasure chest at the back and head home. Even if its our second time, this was still tiring.] (Youya) [Uhn. Battling the boss right after arriving is exhausting.] (Luna) [Uhn uhn. Im super tired. Although it feels a little lonely when you realise its our last time coming here.] (Til) [I agree. The battles against the Minotaur has been a great learning experience.] (Selene) Selene was right, there arent many monsters that were capable of attacking with such high speeds and power. Since its attacks were both easily telegraphed and frankly linear, it becomes a good training spot for a Crusader. From our battles against the Minotaur, the one who benefitted the most was Selene. [Since we finished earlier as compared to the last time, we can do various things once we return. We will be leaving the town the day after tomorrow. Whether its clothing or anything else, make sure to finish your shopping by then.] (Youya) [Luna wants to eat all of the delicious food in Greenwood!] (Luna) [I will be sure to stock plenty of fruit rice cakes in my magic bag.] (Til) Luna and Til seem to have their priorities on food whereas Selene plans to look around the weapon and armour shops in the area. We opened the treasure chest and retrieved the immediate mana recovery potion within before returning to the city. Normal mana potions had the effect of raising our natural recovery rate however this was a special potion which immediately fills our mana gauge making it very valuable and effective. As expected of a boss item drop, it isnt available by any means. I passed the mana potion to Til who had the highest mana consumption in our party. We will be leaving Greenwood in two days. We had only stayed in Greenwood for about a month, however many things have happened in that month which made us wish that we could stay here. In order to become stronger, we have to leave. . . . When I returned to the city, I proceeded to report to the receptionist as usual. When I broke the news about our departure in two days, she seriously started to cry as we had raised the average quest completion rate and wanted us to stay here. Just like what I had did in the past, she had suggested for me to be an exclusive adventurer for Greenwood. It was a tempting offer, however I shook my head in response. I had the promise to fulfill against Leonard, and I have to become stronger by then. Furthermore Selene had to become stronger as well to defeat her siblings in the inheritance ceremony. After realizing her guilt trip failed to work, the receptionist scowled at me grudgingly as I returned to the inn to find a letter directed towards us from Phil. [Looks like Phil is also ready for departure.] (Youya) Phil had chosen to continue traveling with me rather than continue to be a receptionist. However, because of the situation with the guildmasters betrayal in Rumberg, the situation in Rumberg rapidly deteriorated and the towns foundation would crumble if Phil hadnt stayed behind. After deciding to stay back and improve the towns situation, Phil declared that she would stay behind and catch up with us after a month. The other day, she had already sent a letter saying that the situation had improved and she was able to leave anytime. This was her follow-up letter saying that the situation was better and she had officially retired as a receptionist with her successor being sent from another city. In reality, there were many more letters that were directed to me by Phils colleagues who were trying to persuade me to get Phil to remain in Rumberg. Just as one would expect, she was heavily relied on by her colleagues, however I had zero intention in deterring Phil from her decision. Especially since I am looking forward to travelling with Phil. Plus if Phil had determined that the guild was in a stable state and retired, then I would trust her and they would be fine. Although I didnt know how hard it actually is since I dont know the details. I continued to read through the rest of the letter. [ Lets be sure to inform Luna and Til about this afterwards.] (Youya) Previously when I had showed Phils letter to Luna and Til, the two of them said that they wanted to write the reply to Phil and I ended up letting the two of them do so. However, they had written something outrageous. [What does it mean to work hard for our children together with Til and Luna-chan? Ill be sure to have you tell me the details when we meet each other!] (Phil) I guessed that Luna and Til had wrote about the task of warming the egg as baby-making in their letters. If it was just Luna who made that misunderstanding, Phil probably would had just shrugged it off, however when Til had followed suit, it caused a misunderstanding with Phil. Im sure that Phil doesnt believe that I would do such a thing, however she could just be worried about them. Afterwards she wrote about her daily life without wasting any time, ending the letter with the words I wish to meet you soon. [I wish to meet you too Phil.] (Youya) I put down the letter and wrote a reply. I wrote about departing from Rumberg in four days, the misunderstanding about baby-making with Luna and Till and about heading to the next destination, Flaregard. After I had finished writing the letter, I sent it to the delivery store immediately. With their express mail delivery service, this letter should arrive at Rumberg by tomorrow. . . . The next day, our adventure had continued smoothly as usual. We continued to travel to the labyrinth and hunted as many demons as we could by taking the most long-winded route as possible. Since the monsters had already spawned, the monsters in the labyrinth had already been replenished. Thanks to that, Luna and Til who were two levels lower than Selene managed to reach level 30. Now that we are all level 30 we will be able to do better in Flaregard. After reaching level 30, the amount of experience required to level increased dramatically, both me an Selene still remained at level 30. After returning to the inn, we conducted a strategy meeting more stringent than usual, since it will be the first time our party will be acting on two different actions at a given time. [Just as I mentioned yesterday. Tomorrow, Luna,Til and Selene will be taking the caravan towards Flaregard. I have already gotten the tickets for the caravan. Then, Ill be riding separately on Raptor to pick Phil up from Rumberg before heading over to Flaregard.] (Youya) [Luna should go with Youya.] (Luna) Luna puffed up her cheeks as in complaint as I continued to stroke her head. [Raptor can only carry two people maximum. If we miss the caravan tomorrow, the next caravan will only leave in a months time. Based on the speed of the caravan, it will take about 6 days to arrive at Flaregard. However, if Raptor is able to pick up Phil in Rumberg by tomorrow. After completing our errands we should be able to reach Flaregard in 8 days. If everyone goes to Rumberg together and head towards Flaregard afterwards, itll take two months no matter how much we try to skimp on time. 8 days or 2 months, which would you prefer?] (Youya) There arent many caravans that pass by Greenwood. I had considered having Phil come over to Greenwood, however if we were to wait for a caravan from Rumberg, we would miss the caravan to Flaregard the day after. [Luna. You cant be so selfish you know. Just have a bit of patience for 8 days.] (Til) [Luna is sad to separate for 8 days.] (Luna) Luna starting clinging to my body. This girl is definitely being spoilt. [When we reunite at Flaregard, Ill play with you so please be patient and buy souvenirs for me.] (Youya) [Luna will endure. Youya, hurry up and come back.] (Luna) Luna looked up at me with wet eyes. If she continues like this Ill have to try hard to stop my heart from crumbling. [Selene, Im counting on you to take care of the two of them.] (Youya) [Yes. Since I am older, Ill be sure to take care of them.] (Selene) Initially she was quite difficult to handle in public, however recently Selene has become much more mature and it has become much easier to trust her. [Once you arrive at the town, head to the guild and report to the receptionist at the guild. Have her take care of the arrangements such as the inn and other essentials. Be sure not to go to the dungeon until I arrive. Dungeons level 30 and above have many traps and monsters that are capable of annihilating adventurers. Many adventurers who have gotten past their mid-career crisis have lost their life like this being unprepared.] (Youya) I am currently asking them to utilise the city navigation system from the guild in Flaregard. It is expensive however utilizing the guilds navigation service will ensure that there is no mistake. (Note: Raws say the guild in greenwood however I am assuming it meant flaregard.) [Uhn. I promise.] (Selene) [Wahwahwah. Why would you think that we would enter the dungeon without you. We would have never become this strong without you you know.] (Til) Til said a joke. I firmly grasped her shoulder and stared straight at her eyes. [I am serious. Stop that. Death is nothing to joke about. The difficulty of dungeons jump up at level 30. I dont want to lose you guys. Okay? There arent many adventurers who are above level 30 for one simple reason. Because most adventurers who do reach that point die. If Im not around, I am afraid of that happening to you.] (Youya) [Uwah. I understand, so dont make that face please. I promise.] (Til) Til diverted her head with a red face. Its good that she understands it. Although Luna,Til and Selene were talented, it is still possible for them to be killed in a high-level dungeon just by overlooking a small detail or dying without understanding the characteristics of a monster. [Ill depart at dawn tomorrow morning, so if any of you have something youll like to talk about then be sure to tell me before then.] (Youya) Everyone nodded as we began our normal conversations. After awhile, Luna raised her hand. [Whats wrong?] (Youya) [Since Youya wont be around for 8 days, Luna wants to sleep with Youya for tonight.] (Luna) That was a request that I have been refusing except for the matter with the Magic Egg. Initially I was going to refuse her request, however watching her teary eyes grow wetter and her fox ears slowing falling made me change my mind. As expected I cant be cruel enough to make her more depressed than this. [. I understand, since this is a special occasion.] (Youya) [Luna loves Youya!] (Luna) Luna jumped into my chest while shaking her fluffy fox tail. [As expected from Youya, you have a huge heart. You will be sleeping in our bed tonight.] (Til) [Wait a minute. How did you come to that conclusion.] (Youya) [I want to sleep with Youya too, and the sofa is so small. Wait, could it be that you planned to drive me out of the bed to the sofa? Or maybe you are going to make Luna sleep with you on the sofa?] (Til) There isntt any getting away from this. As expected, Tils slyness came through. Selene had an envious back in the back as she looked at the situation. However she didnt say anything as it would be embarrassing. It is really regretful but I cant ask her for help. Disregarding the two girls, there are many problems with sleeping with Selene. [Youya, lets head to bed early.] (Luna) [Fuu,fuu,fuu. Be sure to love us plenty tonight okay.] (Til) The two girls grabbed my hands and we headed towards the bed. On the bed, Luna and Til slept on my sides and cuddled against me tightly. It felt bad in many ways but whenever I looked at their peaceful faces, I felt secure as my anxiety disappeared. This must be what it feels like to be a father. Seriously, such hopeless children. Its time for me to sleep as well. Once Ive gotten comfortable to the current situation I should be able to have a good nights sleep. . . . As soon as the sun appeared on the horizon, I departed from Greenwood. [Youya, catch up with us as soon as possible!] (Luna) [If its possible, then be sure to overtake us!] (Til) [Well be waiting for you in Flaregard!] (Selene) Currently, I was riding on the two legged reptile, Raptor and am on the way to pick up Phil from Rumberg. I could feel Raptors body throbbing from excitement as we were finally able to go on a trip again. [Lets push ourselves to the limit and bring Phil with us to Flaregard.] (Youya) I hadnt consulted everyone about this, but I am planning on informing Phil about my secrets. About the level reset. Then, we are going to reset her level and head to Flaregard after obtaining a job for her at Rumberg. Having Phil at level 50 would be a reliable force for us, however if we are thinking about the future, itll be better for her to have a level reset. In order to clear the Tower of Trials, having just level 50 isnt enough. I firmly grabbed Raptors reins as I instructed him to go faster. [We can finally go on an adventure together.] (Youya) My dream of going on an adventurer with Phil will finally come true. Its lonely having to separate from the girls however, I am looking forward to reuniting with Phil again. Volume 3 Chapter 1 Raptor was running towards Rumberg where Phil awaited. I felt the pleasant wind breeze past my cheeks. Among the monsters, Raptor is much faster than a horse and had much more vitality. Although raptors were extremely ill-tempered monsters, Raptor has been taking good care of my cargo whenever we had to carry supplies. Raptor continued to run while I was regularly drinking a physical recovery potion. By doing this, we should be able to travel several times the distance a caravan would travel in a day. This was too costly a method for us to do when travelling in a party however it is possible if there were only two of us. [Whenever Im riding with you, I always remember the olden days.] (Youya) [KUEEE] I purchased Raptor back when I had just left the party with Leonard and the rest. Since I had based myself in a small village, I had to make trips out of the village to purchase various things, requiring me to obtain a means of transport. At the time, I bought Raptor who was only capable of carrying two people at once since I had never considered entering another party. Initially, he was only a mode of transport however after accompanying for all these years, he got attached to me and so did I to him. He could had been the reason why I was able to bear the solitude all this time. [Now then, lets go.] (Youya) Raptor began to speed up after hearing my voice. If possible, itll be nice if I could arrive by noon tomorrow. . . . Right as the sun began to set, trouble came. I began chanting as I turned behind me, watching the monster who has been chasing us rush directly towards us. It was a large wolf called a Wild Wolf. Its level was about 20 midway to 30 and had excellent dexterity. Although Raptors legs were capable of shaking off most demons, it wasnt capable of escaping from them. Unlike a caravan, travelling privately required us to defend ourselves. When I was heading to Rumberg with Luna, I decided to travel with a caravan instead of using Raptor directly because at the time we had low levels, making it extremely dangerous. However, this time its different. I am currently level 30, I could easily repel a monster of this level. While looking behind my shoulder, I set my aim on the wolf. Since Raptor has joints and muscles more flexible than a horse, it shakes less than a horse. However since we were running it was still shaky to an extent. It could be dangerous if I were to miss without aiming carefully. After completing the chant, a bullet of lightning began to form in the palm of my hand. Superconductive Bullet. It is a customized version of the intermediate level magic, Lightning Storm, condensing its rain of lightning into a single bullet and delaying its cast time to improve its range and power. The moment Raptors shaking stopped, my aim was completed and I released the bullet. [GYAAAAAA] The bullet flew at lightning speed, immediately penetrating the Wild Wolf and burning a black hole through its body. However, it didnt just stop at its body and continued to penetrate the subsequent monsters behind it. Two monsters were killed instantly as the Wild Wolf turned into blue particles, dropping the blue fur which is its unique drop item. The remaining group of Wild Wolf kept a distance, being wary of the previous blow and stares directly at us. I hoped to pick up the dropped fur however, I wouldnt risk jumping into the group of monsters. It is unlikely that I would lose the battle here, however there is the possibility that Raptor may get attacked during the battle. Looking at the situation, we have no choice but to run away. Raptor began sprinting away as the Wild Wolves stood still, showing no intention of chasing us. Looking at them, they were a clever species, knowing that it would be safer to give up hunting a dangerous prey and search for another easier prey. The next moment, the group of Wild Wolves became invisible. [You did great.] (Youya) [KUEE] I threw Raptors favourite fruit, an apple into its mouth and it happily chewed on the fruit as it continued to run. Meanwhile, I drank another physical recovery potion. At this pace, we should be able to reach Rumberg by noon tomorrow. . . . We finally arrived in Rumberg at noon the next day. Although our travelling pace was good, there were many monster ambushes on the way here. As a result, our arrival time was delayed by quite a bit. I went to the stables to rent a room for Raptor and fed him plenty of apples before heading towards Phils apartment. On the way to Phils apartment, I dropped by the weapon store where I purchased the black sword and left both my swords there for maintenance. I paid an extra fee in order to get the repairs done by that night since my departure time was going to be tomorrow morning. Following my memories, I walked towards Phils apartment when I felt someones eyes on me [Youya, you are here earlier than planned.] (Phil) Looking in the direction of the voice, I saw Phil sticking out her window waving her hand towards me. [I wanted to see Phil so bad that I rushed over here as fast as I could. Isnt that the same reason why that Phil was looking out her window?] (Youya) [Was I caught? Hurry up and enter. Ive been lonely forever here!] (Phil) Phil looks happy even when saying something that embarrassing. It was finally our reunion. We were only separated for a month but Im not able to endure it any longer. Lets hurry up and enter her room soon. . . . I arrived at Phils front door as Phil opened her door. [Welcome back, Youya. Ive missed you.] (Phil) [Me too.] (Youya) Phil looked at me with intense eyes as she didnt replied me with silence. In response, I leaned towards her and kissed her lips. Tasting her lips after such a long time, it felt sweeter than usual. After releasing our lips, Phil had a regretful look. [Phil, is everything fine with your work?] (Youya) [Yes. There were some troubles but things managed to calm down. The rest depends on how everyone does from now on.] (Phil) [Well, to be capable of settling the problems in such a short amount of time, as expected of Phil.] (Youya) [Even if you sang me praises, nothing will be given out you know.] (Phil) I laughed at Phil as she guided me into the room and served tea. [Its a delicious tea.] (Youya) [I still have plenty more stored for visitors, however I will have to vacate the room today. If possible we should make use of them as much, even a magic bag with large capacity has a limit.] (Phil) As Phil mentioned, her room looked empty as most of her things were cleared up. Phils magic bag, much like mine was capable of accommodating up to 200 kilograms of items. However once furniture was placed inside, the capacity would very quickly be used up. It was necessary to get rid of some stuff. Suddenly, the air around Phil changed as I drank a cup of her tea. Although she looked like she was smiling, her eyes were terrifying. [Now then. Youya. Do you mind telling me about this baby-making with Til and Luna-chan? Explain it in a way that I understand. Leaving Til aside, Luna wouldnt lie.] (Phil) Phil was suddenly placing an immense pressure onto me. However that is weird, I should have sent a letter to her previously. Was the delivery interrupted due to trouble? I guess even birds can encounter trouble in the wild every now and then. However, since it was an expected question I wasnt surprised. I said the answer that I had prepared beforehand. [We managed to get the Magic Egg in Greenwood. And right now, in order to hatch the eggs we are taking turns to warm the egg every night. Since I had also taken a turn in hatching the egg, the girls call the Magic Pet that is supposed to come out our child. There is no way in hell I would lay a hand on those children. They are still children you know.] (Youya) Phil stared directly at me with laser eyes as if she was staring into my soul. And heaved a sigh of relief. [Im glad. I thought that Youya was indulging himself with Luna-chan and Til in a place I couldnt see.] (Phil) [Im not a lolicon. Im your boyfriend arent I? Its fine to trust me you know.] (Youya) [Ive loved you ever since I was the same age as those girls you know. I didnt say it back then, but if those girls were capable of speaking it out loud, they might even pressure you to answer back. Then, since its Youya, you might even give in and accept them.] (Phil) Phil turned away with a sad face as she said those words and I flicked her forehead. [Ouch, what are you doing?] (Phil) Phil was rubbing her forehead while staring at me begrudgingly. [Trust your boyfriend a little more. I wont do anything that would make my lover sad.] (Youya) [Sorry for doubting you.. Although Ive already heard about it, is there really nothing between you and Princess Lutra? Ever since back then, hasnt she always been clinging onto you. Plus she has always been glaring at me. It isnt wrong of me to think that she has been trying something when Im not around.] (Phil) [There isnt anything happening between us. Right now she is my disciple. In the first place the other party is a princess, there is absolutely no way I would lay a hand on her.] (Youya) Phil finally muttered a word of relief [Now I can finally relax on our journey. Youya, you must be hungry right? Ill introduce you to the delicious stores here.] (Phil) [That sounds delicious. However more than that, I want to eat Phils cooking. To me that is the most delicious dish in the world.] (Youya) [Mou.. Even though I went to the trouble of storing them, Ill have to bring them out again. Ill have to go and get ingredients now too, since Youya is so selfish.] (Phil) Contrary to her words, Phil appeared happy to cook, and watching her delighted face makes me happy too. [For ingredients we could use some of my things too, I have some basic seasoning for camping out and eel meat.] (Youya) Although having seasoning takes up space in the Magic Bag, its better to carry some with you wherever you go since food can always be secured by killing monsters. However it will be bad if there wasnt any seasoning since no one would be happy with bland and tasteless meals when you are in a dungeon for multiple days. [Eel meat you say?! Uwah, its been a while since Ive eaten it. Im looking forward to eating it. Ill finish it quickly.] (Phil) Phil received the ingredients from me and heads to the kitchen. The figure of Phil cooking in an apron gave me a sudden urge.. However, Ill resist the urge to attack her from behind since I wont be able to eat her cooking if I disrupted her preparations. . . . I enjoyed Phils home cooked eel dish. After chopping it into pieces and boiled, it was sauteed with lots of special sauce. I have always been a sucker for sweet and salty foods. On the other hand, Phil kept chuckling in embarrassment whenever she saw me enjoying her cooking. Then, we ended the meal with idle talk. Just by being together I feel happy with her. Ill like to indulge in this atmosphere a little longer but there are some things we have to talk about. [There is something I wish to apologize for. Ive been lying to you this entire time.] (Youya) [A lie..? Could it be that this entire time about loving me..?] (Phil) [Im not so trashy to lie about a thing like that.] (Youya) By nature, Phil has always been a pessimist thinking negatively about herself. As an adventurer, although she is capable of surviving on her own for a long time, she is still extremely vulnerable to trivial things in her daily life. [The lie is about my level reset. I mentioned previously that my level was reset due to encountering a monster with Level Drain. However, truth is that there is a dungeon with a hidden room that can only be opened by a max-levelled adventurer. In that room it is possible to reset your level to level 1 and have an additional 20 skill points and 10 bonus points to all stats.] (Youya) Phil recoiled in shock as she was a first-rate adventurer. She knew how amazing having those bonuses would be as an adventurer. [Isnt that a huge cheat? Wouldnt every adventurer gather for that room?] (Phil) [It isnt just that. One of the dungeons in Rumberg has a hidden room which fixes your status gain every level to the maximum. Using those two rooms, I managed to reset my level back to 1 and increase my status by the maximum values every level.] (Youya) [Indeed, I thought that Youya was always too strong for your level. So that was that case. It was gods reward for Youya who has always been suffering, a reward for all your hard work.] (Phil) Phil was holding her chin in her hand and digesting the information I just told her. She must be thinking of things. [Sorry for keeping silent about this.] (Youya) [Dont be. That is how important this information is. This isnt something you can talk about unless it is someone that you have travelled for awhile. And? Why are you suddenly talking about this now.] (Phil) [I want Phil to reset your level as well. Although itll erase all the levels you have obtained up until now, but if we are aiming to become the strongest then I think you should do it. However it is your decision and Ill leave the final decision to you.] (Youya) [Ill do it.] (Phil) It was an immediate reply. I always knew that if it was the strong Phil who always looked forward, that she would choose so. [Tomorrow, we will head to the hidden dungeon.] (Youya) Actually, the dungeon is somewhere between Rumberg and the village that I used to stay in. If we are to leave early in the morning, we should be able to arrive before sunset. [I understand. Ill have to do several preparations for the journey as I have not put on my adventurer equipment in a long time.] (Phil) Phil took out her adventurer equipment from her magic bag. They were all top-class items as Phil hadnt sold any of them. [As expected today is too early, well leave tomorrow morning.] (Youya) [I agree, I dont feel very energetic now.] (Phil) Although Raptor was capable of travelling at night, I wouldnt be awake to control him. Aside from the dangers, Raptor has already been running for two days and itll be better to let him rest. Above all, is my situation. [Well, there is time before morning comes. Youll have to vacate this room by today right? If its fine with you, lets head over to a good inn for the night. Ive been hungry for Phils cooking, but I am still hungry for something else.] (Youya) Listening to my words, Phils ears became red as far as the tip of her elven ears. With a completely red face, she nodded. Afterwards, we cleaned Phils apartment, returned her key and received the swords I sent for maintenance before heading to the inn and made love to each other. Its been a while and it was extremely passionate. After we had loved each other plenty, we discussed about the future. [Youya.] (Phil) Phil who was sleeping naked next to me called out my name. I stroke that Phils head. If Phil were to reset her level tomorrow, then temporarily she becomes extremely weaker than me. Then she wouldnt be able to protect herself, and only I would be able to protect her. I have to work hard in the future so as to not lose this warmth I feel in my hand. Volume 3 Chapter 2 When dawn arrived, me and Phil departed from Rumberg towards the cave where the hidden room with a level reset function was. Its location was at the middle point between Rumberg and the small village I lived in. At Raptors full speed it should take us at least half a day to arrive. [Its been awhile since Ive worn these clothes. Youya, does it look weird? I didnt mind it back then, but wearing something like this at my age feels shameful.] (Phil) Phil had asked me a question while feeling embarrassed. Her current outfit was the adventurers standard battle outfit. It was a first-class set as it provided protections against the wind with beautiful green and white patterns that looked stylish and at the same time revealing. Phils current age was around her late twenties, however due to the unique characteristics of elves she only looked around her late teens, meaning there isnt anything that looked out of place with her outfit. On the contrary, it looked great on Phil who had beautiful slim limbs, making her look like a fairy. [I think it looks cute on you. Its not as bad as you think especially when we were walking in the city. Everyone especially guys who we walked past in the town turned their heads to look at you. As your lover I felt proud, although there were some who went a little further than admiration and it felt nauseating.] (Youya) While releasing Raptor from the stables on the way out of the town, there were many people who were turning around staring at Phil with a disturbing face. Phil was pretty enough to warrant that sort of response from other men. [Im happy that you feel that way. Ive already passed my prime age and it still makes me anxious to wear this outfit in public, but if Youya says that its cute then Ill wear it.] (Phil) [Phil, lets hurry up and depart.] (Youya) [Okay. Hello Raptor-san, please take good care of us today.] (Phil) [KUEE] Raptor energetically replies to Phil. I straddled onto Raptor and pulled Phil onto his back. Phil placed her arms onto my waist from the back and grabbed me tightly. I could smell her scent from the front and it was as nice as ever. It wasnt the scent of her perfume, but her natural smell that gives off the impression of a tranquil forest. While enjoying the scent of warmth of Phil, I signalled Raptor to depart. . . . After taking a break in the morning, we arrived at our destination a little over noon. [I was surprised to find out that Raptor-san also has an accessory which provides protection against strong winds.] (Phil) [Yeah he does, want to give it a test?] (Youya) [KUEE] Raptor proudly showed off the necklace on his neck. That necklace was a rare accessory which Phil had in her possession from a dungeon and has a special effect of raising the users movement speed by 30%. Phil had fastened the necklace onto Raptors neck and the blessing was successfully placed onto Raptor. Raptor began running at a speed much faster than he had ran before. With this, we should be able to arrive at Flaregard by a day or two ahead of schedule. This was a pleasant miscalculation. [Phil. This cave is the dungeon with the hidden room.] (Youya) [Just as it looks, its just an ordinary Wild Dungeon and its a cave-type dungeon. Any adventurer wouldnt even consider entering this dungeon.] (Phil) A wild underground dungeon with limited visibility and difficulties to secure a safe light source. Add that in with a large number of traps and you have the number one most dangerous, unwanted dungeon to enter. [It is precisely that which allowed this room to go by undetected for so long. Now then, shall we enter?] (Youya) [Yes, lets do our best. Ill have to hone my instincts back into shape as well.] (Phil) Together with Phil, the two of us entered the cave-type dungeon. I use the Light Crystal to illuminate the surroundings while Phil activated the unique characteristic of her Jade Eyes, the eyes which only manifests itself in the elven race with the blood of their ancestors. Also, Phil and Tils family were one of the most distinguished elven families due to the their stronger ties with their ancestors. Speaking of which, back when we were still travelling together, Phil regularly got complaints from her family asking her to quickly marry and bear a child to prevent their bloodline from dying out. Actually, could that had been the reason Phil and I met? Ever since Phils village was rescued by adventurers, she had always wish to become a adventurer. However her family was strongly against that idea, and as a result she ran away from home. After running away, she lost her way and in the end she was picked up by me. Thus having such an incident happen, she cut her ties with her elven roots. Several years later, the large incident where her elven village was assaulted was known and our party took part in the rescue mission. At that time, Phil must have managed to reconcile with her parents. Afterwards, she continued to send letters back to her family and even occasionally returned to the village to visit them. And it was because of her, that Til also wished to become an adventurer and eventually ran away from home as well. [Looks like the enemies appeared right off the bat.] (Phil) Phil went into her combat stance while holding her bow. It was a wooden bow brimming with immense magical power, the Bow of the World Tree, made with the wood from the World Tree, the oldest and strongest tree in the world, and Spirit Thread from the worlds strongest Spirit Tree. The bow has excellent offensive-power attributes, magic power attributes and a special effect allowing it to grow. By absorbing the users mana and the spirit of the defeated monster, the bow will continue to grow. Since the bow has been Phils main weapon for the longest time, it has grown to have an outrageous performance as a weapon. Most likely, even if Phil resets her level back to 1, with her accessories and equipment that synergises with Arrow Generation and the Bow of the World Tree, she could most likely enhanced her attack power to a level similar to a mid-level adventurer. [I dont see any monsters until the turn ahead, should we be on the lookout for any monsters at the bend?] (Youya) The path that we were walking on had no monsters that could be seen. If there were any monsters hiding, they would be at the bend on the path. Otherwise, any monsters that are hidden cant be detected without Presence Detection. [Yes. Based on the flow of the wind, that should be the case.] (Phil) However, that did not mean that Presence Detection was the only way of detecting them. For Phil, it was possible for her to detect them by looking at the path of the wind, allowing her to detect even things that cant be seen using our eyes. If we had to wait until we were crossing the bend to discover a monster in hiding, it would have been a disadvantageous fight from the start. Normally, it would be recommended to wait for the monster to appear rather than directly engage it in combat. However, it is possible for Phil to take aim and fire at the monster even in this situation. Phil took out an arrow and cut out a part of the arrows feathers before firing the arrow. The arrow changed direction mid flight as feathers were typically used to keep the arrow flying straight. By removing a portion of the feather, it is possible to alter the arrows trajectory and bend it. In the next moment, a monsters screech could be heard from the otherside of the bend. [Now then, lets hurry. Otherwise well be homeless tonight.] (Phil) Although her sister Til was a master at the bow, Phil was the godfather of the bow. Not only is she able to obtain information such as the flow of the wind, just as she had demonstrated she was capable of showcasing many different skills at the bow. Taking shots which she isnt able to directly see the target. Now that Phil is going to join our party, there will be many things for Til to observe and grow from now on. Although I have been able to train Luna and Selene who both were part of the front-lines, I have always been troubled on how I could assist Til in her training. However that trouble is now gone with Phil joining the party being able to train her younger sister. [Looks like your skills havent deteriorated one bit.] (Youya) [Truth is occasionally Ive entered the dungeons to relieve stress. Whenever I am working as a receptionist, there are many times when Ive wished I could just let loose and fire arrows. Its refreshing to be able to fire off a shot or two whenever Im working.] (Phil) [Its a pretty flashy way to relieve your stress. I guess being a receptionist is hard work.] (Youya) [Eh. Its seriously tough. Ive had to handle so many selfish adventurers, sexual and normal harassment from my senior receptionists, harsh assignments, harassment from the higher-ups, aggressive solicitations for dates, stalkers.. Its just a whole bunch of trouble in work. Of course, there are great things too.] (Phil) I smiled bitterly to Phil as I slashed the monsters head in front of me without looking. Us adventurers have been relying on the receptionists without considering their feelings since we have always had a working relationship. Ill try to be more considerate from now on. . . . Although we were in an underground dungeon with limited visibility, so long Phil is around we will be able to proceed more quickly by a large margin. Plus since we are both familiar with each others movements, it is naturally simple for us to cooperate. It was a pace that is incomparable to my pace when I was alone. Although we did have a Light Crystal unlike the first time, in a blink of an eye we have already arrived at the entrance of the hidden room. I pushed the stone statue, exposing an emblem carved into a seal on the wall. [Wow there was a hidden door behind the stone statue? I would have never notice it.] (Phil) [Behind the door is the room where you will be able to reset your level. However, only adventurers who have reached their maximum level are able to open the door. Phil, try placing your hand on the seal.] (Youya) Phil nodded and placed her hand on the seal. Next, the seal was unlocked and a clunking sound could be heard, opening the door. Phil swallowed her saliva and looked at me. I nodded back and the two of us continued into the path behind the door. . . . We arrived at the hidden room. I nonchalantly turned my head to the crystal where I found Luna. [It looks safe.] (Youya) There was nothing left inside the crystal. Wait, the blue crystal was beginning to crumble. I took a piece of the crystal in my hand and felt strong magical power flowing from it. It is most likely a magic tool, however I dont know what is its actual function. Back when I first met Luna, I was so anxious that I hadnt noticed the name of the crystal. Apparently it has a name, Blue Crystal. It could be responsible for Lunas lost memories, lets be sure to show it to her. [Phil, as I mentioned earlier, take a light crystal from the wall and place it in the necklace of goddess statue. Afterwards, a voice will appear in your head and if you nod in response, your level will be reset along with the benefits.] (Youya) [Its finally time. Im starting to get nervous.] (Phil) Phil grabbed a crystal from the wall with trembling hands and placed it in the statue. Then, she began staring at the statue with a look of awe. She was most likely listening to the voice of the goddess. Then, Phils body began to envelop in light as her level became visible to me. She was currently level 1. Other peoples levels could only be seen if their level was much lower than your own. [Youya, Im done. My level really returned back to 1. Its back to level 1 now. It feels a little depressing that I am starting over but its exciting to know that Ill be much stronger than before.] (Phil) [Thats the spirit. We managed to finish this in time and thanks to Phils Necklace of Swiftness, our round-trip will finish even earlier than expected. If possible, Ill like to return and have you visit the hidden room in Rumberg to fix your status gain by today. Itll be a really harsh schedule, do you think you can do it?] (Youya) [Of course I do. Even back then, we were travelling around without sleeping for two days, isnt it expected?] (Youya) [Well youre right. It was even more unreasonable back then.] (Youya) To become a first-rate adventurer, depending on the situation this degree of unreasonableness is expected. If its Phil then she can definitely do it easily. [Now then, lets hurry back. Now that you are level 1, take more care of yourself as a single blow is already life-threatening.] (Youya) [That is the case. Well in the first place my equipment places emphasis on my mobility and attack power. There isnt a single area of my equipment where Ive compensated for my low defense.] (Phil) Phil had noticed my intentions even though I hadnt mention anything about it. [Dont leave my side.] (Youya) She may have the one of the best possible equipment, but her level was currently level 1. I have to be the one to protect her. [Dont leave my side. Then Im going to take advantage of that and always stick to you.] (Phil) Phil grabbed my arm and began laughing. [Its not bad to spoil you but maybe nows not the time. Its bad that I wont be able to move properly.] (Youya) [I know that. But this room is safe isnt it? Im going to do this until we leave.] (Phil) If thats the case then it cant be helped. I continued to walk while tightly holding Phil by my side. Lets return to Rumberg as quickly as humanly possible. If possible, lets complete the class assignment and status gain by today, then well be able to reach Flaregard at least a day early. Itll be nice for us to hurry and join up with everyone to form the strongest party ever. Happy new year everybody! Volume 3 Chapter 3 We had successfully reset Phils level and were on our way back to Rumberg. While straddling Raptor, we were returning at our maximum speed while at the same time being more cautious than before. We had taken another path which was safer in consideration for Phil who was level 1. She may have increased attack power thanks to her powerful equipment, but her lightweight armour had also placed emphasis on her speed rather than defense, making her extremely vulnerable to attacks that are able to connect. It may even be possible for her to be killed in one hit by monsters with a high enough level. [Youya, Ive given you a lot more trouble on the way back now that Im this weak right?] (Phil) [Phil youve always had the bad habit of blaming yourself for various things. Dont worry about it. Rather than worry about that, be on the lookout for the monsters attack. Keep your mouth closed and grit your teeth!] (Youya) [Yes sir!] (Phil) A flock of wild Raptors had appeared. Although my Raptor has been trained and domesticated by humans, it was originally a vicious omnivorous monster. With powerful leg strength and strong jaws, they are a pain for travelers to encounter on the road. [KU. KUEE] [KUEE, KUEE] [KUEKUEKUKUU] .One of the bipedal reptiles in front of us menacingly threatened us with its glowing fangs. I am an avid lover of Raptors but Im not kind enough to let Raptors who tries to devour me off. I will quickly wrap this entire situation up.. Is what I thought. [I didnt think that we would be able to escape from the fight this easily.] (Phil) [KUUU. KUUUUEEE] My Raptor who had the Necklace of Swiftness moved so quickly that his speed completely overwhelmed the wild Raptors. He cried out proudly as we quickly lost sight of the wild Raptors behind us even though me and Phil were on his back. The wild Raptors quickly gave up the chase and cried towards us before turning away. Raptors often determine their leaders based on their speed. They probably admired my Raptors rank and paid their respects to him. [Amazing! Even though we were both riding on him, Raptor-san still made quick work of them.] (Phil) [KUEE!!] Raptor was in a better mood than usual since it wasnt just me, but Phil who was singing his praises. From the beginning, Raptor was already in a good mood since he was able to run faster than he was usually capable of. Originally, monsters were unable to catch us due to his sudden accelerations. However, his speed was now on a whole new level and now we are able to shake away most if not all monsters on the chase. [Raptor, head towards the town as fast as you can. Ill shake off any monsters whenever we get attacked.] (Youya) [Kue!] Reliable as usual. I had thought that we would encounter lots of trouble on the way back since we had to protect Phil, but somehow it looks like the trip back is going to be more enjoyable. . . . In my surprise, we managed to arrive at Rumberg in the evening. Leaving early in the morning, I was prepared to return at midnight, however this is a pleasant miscalculation. We immediately left Raptor at the stables and started moving. [Now then, Youya. Lets head over to the guild soon. Ive already prepared the procedure to enter the class selection room. What class should I choose? If its to make use of my skills then itll be a Spirit Archer, but Til is also in our party. The roles and balance in our party would be bad, especially if we encounter a monster that has high Wind (Lightning) resistance and defense power. I may have to choose a different class to prevent that from happening.] (Phil) [I know.] (Youya) Spirit archers who are capable of using their bow and casting magic simultaneously were powerful but had their own weak point, which was only being able to cast the Wind (Lightning) attribute. There were many monsters who were capable of rendering physical attacks ineffective, and were also usually resistant to one or more attributes of magic if they were at a higher level. Monsters with resistances to fire were weak to Wind (Lightning) Monsters with resistances towards Wind (Lightning) were weak to Water (Ice) Monsters with resistances to Water (Ice) were vulnerable to Fire. Due to this, it is better for a party to specialize in two or more elements. Since it is impossible to distribute a persons skill points to master all three elements, Magic Casters often distribute their points within two attributes instead. However, it is only possible for Spirit Archers to use Wind (Lightning) [Is Magic Caster the best class now?] (Phil) [Wouldnt it be stupid to throw away your skill with the bow to become a wizard?] (Youya) [Then what about being a Ranger to specialize purely in the bow? Unlike Spirit Archers, Ill be able to take higher-level skills for the bow and my physical range attacks, plus Ill be able to learn exploration skills as well.] (Phil) [No, I think its still best for you to be a Spirit Archer. After all, if we arent able to use both Fire and Water magic, the merit of taking a hunter is still negligible. Although there are bow skills that hunters can take which surpasses the Spirit Archer, in terms of firepower it is still inferior to a Spirit Archer. Plus we already Luna who is a Thief who has already learnt several exploration skills.] (Youya) In the end, the one who is most suited to becoming a Spirit Archer is Phil. [As expected in the end thats the conclusion. Well just have to find a way to deal with monsters that are resistant to both physical and Win (Lightning) attacks. There isnt a party capable of dealing with monsters of all attributes anyway.] (Phil) Just as Phil said, no matter how much we plan ahead, there will always be a weak point. It isnt necessary for us to defeat every single monster, especially monsters that are difficult for us to beat. We should only try to defeat monsters that we can beat. Although there is a boss that well have to defeat by all means which has complete resistance towards Wind (Lightning) and physical attacks. That boss drops a powerful rare item which is nice to have but its a waste to have Phil become a Magic Caster just for that battle. Well think of a different way to defeat that monster. . . . Thanks to Phils preparations beforehand, we managed to enter the room with the class selection statue. Phil began praying to the statue as the ceremony to obtain her classes begin. A list of selectable classes should begin flowing into Phils brain. Meanwhile, Phil opened her eyes wide in surprise. Since its her second time performing this ceremony, its hard to imagine Phil being surprised by anything. [Nee, Youya. Try not to be surprised but a class that I havent heard of came up as an option.] (Phil) Could it be another unique class? But Phil who was capable of being a Spirit Archer from the beginning already had an exclusive class. Just what could this class be. The fact that the new class is only appearing as an option now meant that the condition for unlocking the class has been met after resetting her level. In my case, there werent any new classes that showed up when choosing a different class. In that case, it should be a class that can only be unlocked by elves or by a Spirit Archer who has performed a level reset. Regardless, its an extremely difficult condition which meant that the new class should be an extremely powerful one. (Note: Im wondering if the author forgot that the benefits for Magic Knights was customizing their own magic spells lol) [Are you sure you didnt have the class the first time?] (Youya) [Yes. There is no mistake. Its highly possible that resetting your level was one of the conditions to unlock the class.] (Phil) I swallowed my saliva as my expectations grew. [What is the name of the class?] (Youya) [Uhm. Druid.. Its a name that I have only heard of in a fairy tale.] (Phil) [I have heard of that name too. Its the name of the class that the elven ancestors.. The High Elves used to have.] (Youya) Druids were people who lived in harmony with spirits and nature.They were similar with Spirit Archers in that they both use bows, however unlike Spirit Archers who were capable of communicate with spirits of the Wind (Lightning) Attribute, druids were capable of communicating with spirits of all natural mana. Even during the game era, there was never a character who had the class of a Druid, although that name occasionally appeared in the stories of traditions of the High Elves My curiosity was piqued as I wanted to know what kind of class was the druid. It is a class that you wouldnt know about unless you chose it. However, if the class turns out to be a dud, then we would get to know about the class. Itll be safer to choose a Spirit Archer which is definitely going to be a strong class, I know that. However. [Phil, If possible I want you to be adventurous now. Its a class that was used by the High Elves. Based on the stories, its a class that uses a bow and every single magical attribute. If that is correct, we will be able to rectify our partys crucial weakness and even take advantage of your skill. However, the gamble we are taking is with your life. We can reset your level again once you reach level 50, but that isnt easy to do.] (Youya) Your level can be reset any number of times, however the bonuses will only come once. Each subsequent reset will not come with any benefits. They merely throw away the effort placed in up until that point. [Youya, dont make such a miserable face. Im the same as you. There are times when you have to be adventurous no matter what. And this is one of those times. In fact, I had already made up my mind. When the class Druid appeared in my mind, I could already feel the power hidden behind the class. My body, is telling me to choose it.] (Phil) Phil replied me and smiled. The next moment, Phils body was enveloped in light. Shortly after, the light dissipated. Somehow, the atmosphere around Phil changed as she checked her status and possible skills before nodding her head. [I think I understand it now. Druid is a good class. My own individual firepower has decreased quite a bit, however it is a good class especially for Youyas party, the best actually. Just as you said, Im able to cast both fire and water magic. However, that isnt all.] (Phil) [What kind of class is a Druid? Could you explain clearly?] (Youya) [Its faster for me to show you what I can do. Lets hurry up and head to the hidden room to maximise my status gain! If thats the case, then Ill be able to showcase them to you on the way.] (Phil) Phil approaches me and gently pulls my hand. [Wait a moment. I cant enter the beginner dungeons.] (Youya) Adventurers who have levels over 10 are unable to enter the beginner dungeons meant for novice adventurers. It wasnt just a system in place, there were also guards place to prevent forced entry. If someone were to fake their level and enter the dungeon, the guild would use their power to place wanted posters all around the world and start a witch hunt. [Dont worry about it. Ive done the necessary paperwork. Ive accepted a quest for us. Ja-jaan! A patrol quest for the beginner dungeons! The monsters that appear in the dungeons can change on rare occasions, thus quests are given out regularly to confirm whether there are any new monsters in the dungeons, allowing newcomers to explore the dungeons comfortably. Ive already accept the quest.] (Phil) [If there was such a thing then say that earlier. Youre really a good receptionist.] (Youya) As expected of Phil. The quest wasnt stolen by anyone else. The path to the hidden room is already dangerous as it is, itll be difficult for a level 1 adventurer to arrive at the room intact without Presence Detection. [Itll be a waste not use a useful connection right? Even though its a beginner dungeon its still scary to go around alone at level 1. Youya, please escort me properly~.] (Phil) [Leave it to me, princess.] (Youya) I grabbed Phils hand and headed towards the entrance of the dungeon. Phil always had a nonchalant look in the guild, however she was always the object of all male adventurers desire as the receptionist idol. However this time, all the mens sight were glued onto her cute battle uniform rather than the usual receptionist uniform. Even the other female adventurers were staring at phil with longing eyes. Not just that, there were people who were looking at my arm which was being hugged tightly by Phil without caring about her surroundings. It looked as if someone had lit everyones clothes on fire. Well experiencing this sort of things is nice once in a while, Phil is in a good mood and I get to show off my superiority to the people in the guild. [Phil, be sure to show me the amazing power of a Druid.] (Youya) [Yes! Especially since I have plenty of skill points from the bonuses, Ill be sure to learn as many amazing skills as possible. Look forward to it.] (Phil) Lets take a look at the power of the Druids. Im looking forward to see the power that Phil considers to be the strongest for my party. Just what could it be?12 Volume 3 Chapter 4 Phil obtained a new class that even I hadnt a clue about. The classs name was Druid and it was a class that is only spoken of in stories. A class whose potential is unknown and is only unlocked by resetting your level. Since there is such a strict condition to unlocking the class, it is highly likely that the class has some sort of powerful skill. I wanted to know more about the class. However, Phil refuses to tell me about the class and only told me to look forward to her demonstration. With Phil in a good mood, we entered the dungeons exclusive for beginners. The dungeon we entered was the dungeon with the Rock Golems. There was a hidden room that fixes your status gain every level in this dungeon, the same dungeon that I had entered with Luna. Similarly, the two of us continued to climb the rocky mountain. [Lets pick up the pace. Its about to be night soon.] (Phil) [I agree. It doesnt affect Phil since you have your jade eyes but itll be rough for me.] (Youya) Just walking at night becomes extremely difficult due to the limited visibility. Since many of the monsters in this dungeon rely on their sense of smell and hearing, they are able to move about at night without troubles, making exploration much more difficult. I pulled out my blade and observed the surroundings. Ideally we should arrive at the hidden room without encountering a single monster, however its a difficult task especially when we didnt have Presence Detection. If we encountered any monster, then Ill be the one to deal with them. Currently, since Phil isnt in my party, experience points wont be distributed between us. She had went to the trouble to arrange a patrol quest for me so that I would be allowed entry into the beginner dungeons. Looking at Phils actual combat ability, it is possible for her to safely reach the hidden room at level 1, however it is still highly impossible for her to defeat any of the monsters in the dungeon alone. [Fufu. Doing this reminds me of my childhood when I was constantly relying on Youya for help.] (Phil) [Yeah. You were always afraid and hiding behind my back.] (Youya) Although she was currently a super-first-class adventurer, when we had just formed a party together she was completely frightened and unaware of everything. It was a difficult task to teach her as I had to teach everything from scratch. [Even now it is still a nice memory. Youya, behind you.] (Phil) [Got it. Be right back.] (Youya) I ran towards the enemy which Phil saw. Lets hurry up and wrap up our business here. . . . After several battles, we finally arrived at the cliff where the hidden room is located. I waited in front of the cliff while Phil heade downwards to the hidden room. Since there wouldnt be any monsters ahead, there isnt any reason for me to escort her all the way down. It is actually better for me to stay behind as there is the possibility of other adventurers coming here and noticing the rope, deciding to remove the rope on a whim. In the end, I took a break while waiting for Phil at the top of the cliff. While waiting, I was thinking of the plan on how to raise Phils level. In this world, experience distributed in a party remains the same regardless of the level difference between the members. In other words, if a low-level adventurer enters a high-level party, their levels would increase tremendously in one setting. However this poses a danger. If we brought Phil who had a low level into a high-levelled dungeon, the risk of Phil getting annihilated and losing her life in the dungeon was high. Considering Phils safety, at best I would like to bring her to a dungeon at least 10 levels above her current level, that way she would be able to survive attacks and traps with her excellent equipment and bonuses from her level reset. Between instant death and able to handle one attack, was a world of difference. [It is impossible for me to stay in Rumberg just to raise her level. Its a little tight but is it possible to slightly raise her level by hunting several Rock Golems?] (Youya) Thanks to the weekly respawns, the dungeon should be filled with golems as it was impossible for beginner adventurers to defeat a Rock Golem. In that case, we should go ahead and hunt for them. The experience provided by Rock Golems were very high for a low leveled monster. Who knows, it may even be possible for Phil to reach level 10 by the end of the morning. From there, we can raise her level by defeating all the monsters we encounter on the way to Flaregard. If we were to do this, she would most likely be around level 12-14 by the time we arrive at Flaregard. With her current equipment, it should be possible for her to endure at least one attack from a monster in the dungeons there. This sounds reasonable, lets go with this. When I took a look at the cliff, I saw the figure of Phil climbing up the cliff, about to arrive at the top. Then, Phil arrived at my location with a light jump. [Welcome back, Phil.] (Youya) [Im back Youya. Im safe and I have fixed my status gain at the hidden room. Im looking forward to raising my level from now on.] (Phil) Phil said that with sparkling eyes. As expected, first-rate adventurers know first hand how amazing having the maximum status gain every level is. It is completely different from occasionally having the maximum based on luck. Even I got extremely excited when I exited the room, with the urge to quickly raise my level even one second earlier. Although in my case, I was even more excited due to the massive difference between my original status and my current one. [In that case, lets hurry up and go hunt monsters. It may be slightly dangerous but lets go hunting for Rock golems now. Its efficient for us and impossible for beginners to hunt so we dont have to feel bad hunting them. Although it would be bad if we were to defeat any monster other than the Rock Golem on the way.] (Youya) Im not worried about hunting monsters besides Rock Golem due to efficiency issues, but for the fact that a higher level adventurer like me is hunting monsters meant for lower leveled adventurers. Even if they will respawn on a weekly basis, monsters were still a finite resource within the week. I do not want to disrupt any adventurers who are hoping to become strong. [As expected of Youya, that is very Youya-esque. As much as possible, lets avoid other monsters while climbing the mountain.] (Phil) [If anyone knows me best its you Phil.] (Youya) Just as when she was a receptionist, Phil still has compassion for other adventurers. [Phil, send a party request to me. Ill accept it.] (Youya) Phil smiled brightly as she heard my words. [I am finally in the same party as Youya again. Fufufu. Im so happy. Im glad to be in the same party as you again. I am the druid Phil.] (Phil) Phil actually gave another formal greeting as we officially joined party. It was so out of place that I couldnt help but laugh. [Likewise, nice to meet you and please take care of me from now on. Im the Magic Knight Youya. Together, lets aim for the strongest.] (Youya) We shook hands as our eyes caught each others gaze. Our faces turned red as we both let go of our hand. Then, together the two of us headed towards the top of the mountain aiming for the golems that reside there. Having Phil in my party again, gave me a feeling of nostalgia and a strong sense of security. . . . As the time approached the late hours, neither the stars nor the moon had appeared in the sky, and my entire vision was covered in darkness. Similar to the underground cave dungeon, I took out the light crystal to give myself even the slightest bit of visibility. [Our luck is good, we havent encountered a single monster on the way here.] (Phil) [I dont actually know if we have been lucky up until now. Actually Ignore that. We are definitely lucky, our target has just appeared in front of us.] (Youya) I heard the sound of heavy footsteps although I was unable to see the figure of the enemy. The source of these footsteps are definitely Rock Golems. [Its going to be the first prey of our new party. Lets defeat it in one go. Youya, I have a request. Please challenge the golem without any magic or skills. Ill show you the power of the Druids in this battle.] (Phil) Phil said something unreasonable as Rock Golems had the highest class of physical nullification while having extremely high defensive stats. Even with my level difference, it isnt a monster that I can defeat using my physical attacks alone. [I understand. Ill believe in you and cut it with all my might.] (Youya) Phil said that she would use the Druid skills to win the battle. Considering her manner of speech, it doesnt seem like shell be firing off a magic attack to defeat the Rock Golem. While I was thinking about what kind of skill shell be showcasing, I ran towards the source of the footsteps. Shortly after, the gigantic figure of the Rock Golem was illuminated by the Light Crystal. Rock Golems didnt spot adventurers by their sight, but rather their heat signatures, thus even in this darkness there wasnt any hesitation in their movements. It swung its thick arms down onto me, making it easy for me to deflect the attack, however I took the other option. [Its heavy, however it is still possible for the current me to take it.] (Youya) I wanted to test the amount of physical strength I had currently possessed now that it was possible. That is why I dare to receive the Rock Golems blow head on. Although fighting a battle using power based on the status is the direct opposite to my fighting style, it is still important for me to test out and increase the number of strategies I am capable of using. I turned around to look at Phil, confirming to her that the situation was under control. [Youya, please attack it with all your strength.] (Phil) [Alright.] (Youya) If I were to try and cut the Rock Golem which had the highest level of physical nullification and defense, itll merely serve to damage your sword and wrist. However, Phil told me to do it , thus Ill do it. Thats all the reason that I need. I jumped onto the golems arm, pulled out my sword and swung my blade from the top down with all my strength. At that moment, I felt Phils magical power. [Magic Enchantment: Water.] (Phil) Phils spell activates and magic power in the form of ice appeared around my blade. This was Phils magic power. I see now, this was the nature of the druid class. My sword swung down onto the Rock golem, smoothly slashing through its entire body as if it was butter. The trick was simple to understand. The Druid skill Magic Enchantment: Water changed the attribute of my attack from physical to water. Rock Golems had near absolute defense against the physical attribute, however it was weak to the Water (Ice) attribute. Thus my attack had easily passed through and the damage dealt was doubled. [Phil, thats a powerful skill. It doesnt just change the attacks attribute, it also increases the targets attack power.] (Youya) [That is the power of my class, Druid. It is similar to Spirit Archers where I am able to cast spells while simultaneously firing my bow, however the spells that I can cast arent attack magics but rather enchantment magic and recover magic, allowing me to change someones attribute and increasing their attack power.] (Phil) That was a powerful skill, more powerful than it actually looks. It allows us to change the attributes of our physical attacks at any time to Fire, Water (Ice), Wind (Lightning) attribute. It is a powerful skill best used by adventurers who were experienced and knowledgeable about the nature of monsters. If you are able to identify the enemys weakness and change to the appropriate attribute, the amount of damage inflicted can be increased tremendously at once and the additional bonus 1.2times damage is also great. Furthermore, its been one minute and the icy aura around my blade hasnt dissipated. The effective time of the spell was also quite long. After watching my sword closely, it looks like the effects last for about 90 seconds. There is no way that a skill which increases your attack power and changes its attribute could be considered weak. Although upon further consideration, it also has a important weak point. If we were to use it without identifying the weakness of the enemy, and accidentally changing it to an element the opponent has a resistance to, itll reduce our damage output significantly, possibility killing ourselves unless you were skilled enough to survive. [It is a skill that is perfect for Phil. Being a super-first-class adventurer and having a ton of experience as a receptionist. With all your experience, you should pretty much know the weakness of all monsters by now. Did you learn the enchantment for all three elements?] (Youya) [No I didnt. Ive only learnt the Fire and Ice enchantment since the skill has to be raised to the max to obtain the attack power increase. For Wind (Lightning), Til is capable of casting spells in that element, that is more than enough for monsters who are weak to that element.] (Phil) [That sounds great. However Phil, did you make sure to leave some skill points in the event that you encounter another good skill?] (Youya) The explanation Phil gave me wasnt wrong, since we wouldnt be using the lightning enchantment due to the lack of need. There should be other skills that she have learnt that could be showcased right now. [Ehh, for spells besides the enchantment magic, I wont be showing them today so look forward to them! Even if I want to show them to you, I wont be able to show them yet. Ive already exhausted most of the skill points by learning the enchantment magics and recovery magics.] (Phil) Phil stuck out her tongue as I gave a small chuckle. [With just that skill, it has become much easier for us to defeat the Rock Golem. From now lets defeat all the Rock Golems in the area!] (Youya) [Yes! Lets give it our all!] (Phil) I had expected it to take a little longer for us to defeat the Rock Golems but looks like well be able to finish the hunt much sooner than expected thanks to the magic of the Druid class. In that case, looks like well be able to get some sleep even after hunting the Rock Golems. [Youya, Ive found our second Rock Golem.] (Phil) [Then lets hurry!] (Youya) As expected, I enjoy hunting with Phil the most. While thinking of such things, I started swinging my sword while running. Lets defeat the Rock Golems instantly and head back to the inn to love and rest our bodies. Then, well leave for Flaregard first thing in the morning. Volume 3 Chapter 5 After the hunt for Rock Golems was completed, we returned to the inn and rested our bodies. During the hunt, Phil explained while demonstrating the effects of her new class, the Druid abilities. Status-wise, her physical endurance and defensive parameters were reduced, however her speed, magic power and attack power were all increased. The skills she were capable of casting were equivalent to the Intermediate skills for Rangers and the recovery spells of Monks. Furthermore they had another special tree of spells, Magical Enchantment spells. Their skills were naturally inferior the the bow skills available to Rangers and the recovery magic by Monks, plus they didnt have any access to exploration skills unlike Rangers. However, there was an appealing characteristic for Druids which compensated that weak point, which was their Magical Enchantment spells. Magical Enchantment spells were powerful as they are capable of changing the physical attribute of a persons attack to the desired element, plus the skill provided a 20% bonus to the persons attack power. Furthermore, if the element was changed according to the opponents weak point, the damage inflicted would be increase even further. We had even tested it using my Customized Magic: Gods Strength and the increased power even included the augmented bonuses of the enchantment, making it an even better combination than expected. When battling bigger and stronger monsters, having spells with synergistic effects rather than separate powerful spells were better as the temporarily increase power would be much beneficial. I got off the bed and opened the curtains on the window. In the blink of an eye, the night had already passed. In order to arrive at Flaregard even a second earlier, we cant afford to oversleep. It was already about time for us to get up and prepare for departure. The light of the morning sun entered the room as the bed begins to move. Being woken up by the morning sun, Phil got up from the bed. She was currently walking around naked as we had spent plenty of time together yesterday. No matter how many times I see it, Elven skin always looks smooth and beautiful. Although her breasts werent very big, I have always thought that they looked perfect on her body and her beautiful limbs. [Good morning Youya.] (Phil) [Morning. Its about time to prepare for our departure.] (Youya) [Im still a little tired.] (Phil) Phil began rubbing her eyes. It cant be helped that she was suffering from a lack of sleep since we had continued to hunt late into the night, plus we continued to make love even after returning to the inn. As a result the amount of time we spent sleeping was reduced significantly. Phil who escaped from the bed came over and gave me a light kiss. Then, she grabbed her clothes which she hung near the window last night. [You idiot Youya, it didnt dry up after all!] (Phil) [Uh..Thats my bad. I really wanted to do that no matter what.] (Youya) Phils revealing green battle clothes were still wet from last night. It had been a while since Ive seen Phil in her battle clothes, I couldnt help it and asked her to keep it on. As a result, it got dirty and we had to wash it before heading to bed. Now, it cant be helped that Phil would have to equip her spare equipment which had a poor performance as compared to her main equipment until it dried up. However, I dont regret it in the slightest as having her wear the outfit made it even better than I thought. [ Well.. I guess its fine. Ill use my spare set instead. Even with this set, I shouldnt be in any danger on the first hit.] (Phil) Phil took out a choker with a red jewel imbedded from her Magic Bag and equipped it. [Im surprised you didnt sell it when you retired from being an adventurer. If you did you would had gotten a fortune. Did you think youll need it working as a receptionist?] (Youya) [I kept all the rare items I had from my adventuring days. Somehow I had wished that I could continue adventuring together with you.] (Phil) Phil let out a bright smile as she looked towards me. She really is cute. The choker she had put on was the Battle Angels Protection, giving the user an increase in defense and magic defense, however its true effect was its automatic resuscitation. At the time of death, the user will be revived and a weak recovery spell will be cast. Being a one-time use item, once the item charge is consumed, the jewel will shatter and it becomes a normal choker. It is one of the most sought after accessory among every magic item available in the dungeon. In the dungeon, making a single mistake is instant death. Furthermore, humans werent capable of casting revival magic, meaning that death would be the end. For that reason, even if its only usable once, it is an amazing item that allows the user to avoid death at least once, hence it was an accessory which everyone wants to have. Although, Phil wasnt very educated back when we were adventurers. Accessories which provided a larger boost in status was much more useful in a hunt as compared to an accessory which only showed its effect on the verge of death. The Battle Angels Protection was only popular in this world due to the low average level of humans as well as the high risk of living. [If you have that, then we can rest assured on the way to Flaregard.] (Youya) Initially I was planning on avoiding large groups of monsters. However, with that choker we can afford to attempt dangerous battles. [Yeah. Without worrying about me, lets take the shortest route.] (Phil) [Lets do that. Also, Phil. Theres something I want to ask you. In Flaregard, well most likely be staying the night in the dungeon. Do you still have any magical tents with you?] (Youya) [Of course. However, I dont think there will be enough space for the five of us. Do you still have your tent?] (Phil) [Ah. You saved us by leaving it behind rather than selling it, since its meant for the two people.] (Youya) [Having five people in one tent would definitely be too cramped..] (Phil) Without a magic tent, the difficulty of setting up camp in a dungeon will increase dramatically. Or rather, camping inside a dungeon where monsters are present without a magic tent would be suicidal. [If you had sold your tent, then we would had to cramp the five of us in one tent. Although even if it was cramped, those girls would still be able to sleep in it.] (Youya) [Nothing is more important than our safety.] (Phil) Magic tents were convenient but it was one of the more difficult and expensive item to obtain. In a medium sized party, you would only need two tents to safely accommodate all four people however it would take the entire fortune of an average person to obtain a tent. Rather, that was the go-to method to obtaining the tent for a party. [Youya, youve been sneaking glances at me for awhile now, youre acting weird.] (Phil) Hoo, she actually mentioned it. Then, Ill let her know about what Im thinking. [Phil, when you said that you were going to put on a different set of clothes, I wasnt expecting just a choker and a pair of socks. Arent you a bit of a maniac?] (Youya) [KYAA. If you noticed it then tell me about it earlier!] (Phil) Since Phil was sensitive to the cold, she had put on a pair of knee-high socks before going to bed after our little session last night. Then, since she wanted to show me the Battle Angels Protection she had, it turned out more amusing. Although it was also quite erotic since she was naked, forgetting the fact that she wasnt dressed right after waking up. Phil began picking up several pieces of clothing from her Magic Bag as I continued to put on my armour. While enjoying the sight of Phil putting on her clothes, I started to equip my armour. . . . After replenishing our consumable items from the early morning, we begun our departure from Rumberg. As usual, Raptor was in a good mood due to the bonus speed from the Necklace of Swiftness he received from Phil. [Phil, do you remember what we said when we left Flaregard back then?] (Youya) [Of course I do. The hot springs felt great when we were there. I cant wait to go there again.] (Phil) [Well that is true. Im looking forward to that but I meant something else. Phil, Im sure you know what I mean. Its time for our revenge.] (Youya) [Yeah. I dont plan on losing again.] (Phil) Previously, our party had travelled to Flaregard with the goal of defeating the boss monster present there. Since the hidden path to the bosss room was discovered, there would be a battle for the right to challenge the boss. We had lost the battle to challenge the boss and another party had defeated the boss. Although we were well-known back then, there was a reason why we lost the right to challenge the boss. In order to monopolize the boss room, the parties had banded together forming a clan in a cooperative effort. The clan would decide which party was going to challenge the boss while the rest would obstruct other parties from the room. I have been trying to collect information about the clan, but it seems like they were still continuing the monopolization with different members. Itll be difficult for us to overcome them and beat the boss from them, however it is absolutely unforgivable for us to just yield the boss to them. No matter what, we have to obtain the item we want from the Flaregards boss. [Youya, do you have a plan?] (Phil) [Of course I do. This old man doesnt pick a fight that he cant win.] (Youya) With my current knowledge and reliable party members, it is possible even for us to defeat that clan. [I look forward to it. Lets do it. One by one, lets accomplish everything that our party couldnt back then.] (Youya) [Yeah, thats right. If its us, then well definitely accomplish everything we couldnt.] (Youya) I felt the tightness on my arms increase from Phils embrace as I let out a small chuckle and pulled Raptors reins. . . . For several days, we continued to travel continuously while camping out for nights on the road. Its been a while since I had used a magical tent however the tent worked out fine. Phils portion was also okay. With this, Im not worried about passing the night in the dungeon anymore since weve gotten a significant amount of experience for Phil by repelling ambushes and attacks from monsters on the road. Before I even noticed, Phil had already become level 13. With the bonuses from the level reset, the maximum status gain and her excellent equipment, it is likely possible for her to endure a single blow from the monsters in Flaregard. With the Battle Angels Protection, she is able of taking another blow, making it somewhat safe for us to bring her to a level 30 dungeon. [We should see Flaregard anytime now.] (Phil) [Ah. We got there much earlier than expected.] (Youya) Suddenly, the scenery around us had changed. The greenery was replaced with volcanoes and mines which were characteristic of the scenery around Flaregard. As the usual road was under maintenance, we took an off-road path and were about to arrive at Flaregard. As we were approaching the city, there was a large formation of horse-drawn carriages in front of us. Just as I was wondering if that group was the same group, the answer came out at once. [Its Youyas smell! Ah, Youya!!. Over here!!] (Luna) The window of a carriage opened as the energetic voice of a pretty girl with fox ears appeared, with the girl sticking her body out of the window and shaking her hands wildly. I signalled Raptor to accelerate and to keep pace with the carriage as we ran up beside the carriage. [Is that Luna? Looks like we managed to catch up.] (Youya) Based on the original schedule, they would have to wait for several days in Flaregard before I arrived, however thanks to the necklace Phil gave Raptor, we managed to catch up with them even after spending a full day heading to the level reset room, status gain increase and a night of hunting. [Youya, its been lonely. I always wanted to see you.] (Luna) Luna screamed with a happy voice while having tearful eyes. Til followed suit and stuck her body out unexpectedly, looking at Phil before saying. [Youya Im glad that you managed to bring my elder sister here safely. However Luna.. Luna has been crying Youya Youya every night until the morning you know.] (Til) [Til, what about your promise!] (Luna) Luna turned her face away as she turned red and looked embarrassed. [Sorry. To make up for it Ill play with you more when we arrive at Flaregard.] (Youya) [Hmm. 50 points! Youll have to embrace Luna now or else. Thats why.. Youya, be sure to catch her!] (Til) Til grabbed Lunas collar as I started to realise what she planned to do. The two girls began whispering as Lunas eyes started to glimmer with expectation and her tail began shaking with excitement. I had a bad premonition about what is going to happen. [If its Raptor then it should be manageable even with Luna. Now then, see you later Luna~] (Til) [Uhn. Til, Luna will be back. Thank you.] (Luna) Til threw Luna out of the carriage from the window as her small figure soared through the air. This is crazy, what are they doing!? I quickly grabbed Luna out of the air and placed her at the base of Raptors neck. Raptor was surprised by the initial shock, however he immediately collected himself and continued running. Normally, raptors should only be capable of managing two adults. However, as Phil and Luna were much lighter as compared to an adult male, it was possible for Raptor to continue with the three of us. Looking at the carriage, Til had a devilish grin as Selene smiled bitterly behind her. [Youya, Youya, Youyaa.] (Luna) Luna began clinging on to me, rubbing her cheeks on my chest. Ahh this is hopeless. I planned on being angry at their reckless actions but if its like this I wont be even be able to reprimand them. [Seriously, youre a hopeless child. Anyhow, Im back Luna.] (Youya) [Youya, welcome back!.] (Luna) Anyway, lets spoil her until we arrive at Flaregard, then I am going to lecture Til about this. I did miss them, and I am willing to spoil Luna, but this and that are two seperate things. As the adult, Ive to be sure to educate the two children properly. I did not know what they were truly thinking as Luna kept burying her face into my chest and her tail shaking with vigor. Volume 3 Chapter 6 We managed to catch up to Luna and the girls how had departed to Flaregard ahead of us. I had planned to rendezvous with them once we arrived at the city however thanks to Tils reckless actions, I was unexpectedly reunited with Luna. [Youya, we finally met.] (Luna) That Luna was extremely elated after reuniting with me. Her fluffy tail were shaking around energetically, causing Raptor to feel ticklish as her tail continuously brushed his neck. [Why did you decide to jump over from the carriage? Dont you know that its dangerous?] (Youya) [Its okay because Youya would definitely catch Luna.] (Luna) Sigh. Shes a hopeless child. [Luna-chan, long time no see.] (Phil) [Uhn. Phil. Long time no see.] (Luna) Luna is a shy girl who is quite vicious towards strangers, however she had already eaten several meals together with Phil. Furthermore Phil who worked as a receptionist had experience in handling new adventurers. Luna right now was completely familiar with Phil. [Its about time for you to let go of me. Its starting to get difficult to control Raptor.] (Youya) [Then it cant be helped.] (Luna) Luna who had been clinging onto me like a koala finally relented and properly sat on Raptors neck, facing forward and leaning back onto me. [Was there any trouble on the trip this time?] (Youya) [A little.] (Luna) [Then Im relieved. So could you tell me what the trouble was?] (Youya) [There were several men who tried to bully us, so Luna chased them off! Luna did her best.] (Luna) [That isnt a little problem at all.] (Youya) Although this small girl looks like quiet and gentle, her personality was extremely curious, impulsive and fast. I sympathize with those adventurers who dared to lay a hand on them. The girls were basically level 30 and talented. They were also capable of working together, it wasnt an equal match at all. [Its okay! Just as planned, when Luna couldnt see their levels she ran away and asked for help.] (Luna) Before I departed, I had made sure to tell them to confirm their opponents levels before engaging, since they would have higher levels if the level couldnt be seen. Especially at this level, there are very few cases of adventurers who only had high levels relying on their status. Afterall, those adventurers wouldnt survive very long, making it better for us to expect that everyone is adequately trained. Thus, the moment someones level was higher than them, it would be possible for them to escape if it was just to run as the caravans guards would cooperate in their protection. [Its difficult being pretty.] (Youya) I began patting Lunas head. For the cute girl with fox ears, the beautiful elf and the elegant Selene which gave off the atmosphere of a noble, they were all extremely sweet on a persons eyes. I have never felt awkward being with them, but it does entice a lot of trouble. [Luna is troublesome. So Youya has to always be with Luna. If Youya is around then everything is fine.] (Luna) Luna began placing more weight onto her back. This girl is truly too pampered, however it doesnt feel like a bad thing for now. Lets be sure not to seperate from her as much as possible. . . . We finally arrived at Flaregard. There were many wooden buildings in Greenwood, however the only buildings here are those made of bricks and stones. Wood is difficult to obtain in Flaregard plus itll be safer with materials that doesnt catch fire easily. Since there were many mines here capable of obtaining rare ores and a sacred flame capable of melting all metals, there are many workshops line up in the city and many stores selling equipment. However, it wasnt just that. There were many people consisting of those working in the mines, blacksmiths and customers who wished to look at their items. So long as there are many stores around, naturally many people will crowd in the area. Furthermore many of the customers here were adventurers whose purpose was to obtain excellent weapons and enter the dungeons. My first move was to deposit Raptor into a stable, then the three of us headed to the open plaza near the entrance of the city to wait for Til and Selene to arrive. [Youya, Luna is hungry. Lets eat while waiting for Til and Selene to arrive.] (Luna) [Ah thats a good idea. Since its troublesome to look for a store lets head over to the inn that I arranged from the guild. The food there is definitely going to be good.] (Youya) [Looking forward~] (Luna) It was the perfect timing as I was beginning to get hungry as well. Above all, I had a craving for meat. During my journey with Phil, we had eaten all the eel meat I had and continued to eat preserved meals for the rest of the trip, however they werent that delicious. [I support that thought. Luna-chan, the food in Flaregard is delicious, but truth is their alcohol is more famous than their cooking you know.] (Phil) [Phil, dont recommend Flaregards alcohol to Luna. Luna was already drunk with 5 cups of wine, itll be too difficult.] (Youya) [Ahh. Then it would be better not to do that then.] (Phil) Luna began scratching her neck. Dwarfs were natural drunkards, thus it was natural that the alcohol concentration in their drinks would be extremely high. With an alcohol content of 80%, it is too early for the girls to drink it. [Ah. Youya, Luna, Big sis! We finally found you.] (Til) Til and Selene finally arrived as they started walking towards us. [Its your long-awaited reunion with the cute Til-chan!] (Til) Til quickly jumped into my chest and looked at Phils face before grinning. Then, she let go. [Youya youre having it tough ehh. If you have a jealous girlfriend such as my big sis.] (Til) [Hey Til, what is that supposed to mean.] (Phil) [Exactly as it sounds like. Getting all jealous with this small bit of skinship.] (Til) As expected of the sisters. Til was completely dominating and teasing Phil, who although was more experienced was unable to escape and beginning to panic. [Its been a long time, Uncle Youya. Ive missed you too.] (Selene) [Selene, I heard that you worked hard while I was away.] (Youya) [Of course. In our evening training Ill show you by landing a point.] (Selene) As expected, Selene was much more mature and didnt jump in like Luna and Til did. She was much more calm as compared to the other two. [Phil, Til. Lets stop playing around and head towards the inn.] (Youya) [Ah just hold on for a moment. Im in the middle of punishing her] (Phil) [Oneechan. I give I give. It hurtss. Its so embarrassing to do this in the middle of town.] (Til) As easily as she was caught, Til was tossed aside as she held onto her buttocks. [Til, you should be glad that I didnt make you take off your skirt and panties.] (Phil) Looks like even now she had been letting Til off. It wouldnt had been funny if she had stripped her in public. [Could it be. Since Luna has been monopolising Youya, youve started to become even more jealous?] (Til) Since I was intrigued by what Til said, I looked at Phil as she turns away. Her elven ears were starting to turn red. [Just a little. Only a little bit. Its not like I planned to do anything about it.] (Phil) It was my first time seeing Phil behave like this as Til saw an opening and fled, hiding behind me. [Since everyone is here, lets start heading to the inn. Ill like to formally introduce myself before joining the party anyway.] (Phil) [Ah thats right. Lets hurry then.] (Youya) Then, the five of us began heading towards the guild as they informed us about the reservation we did using the guilds connections. . . . As we arrived at the inn, we placed our belongings in the room and headed towards the bar in the first floor, ordering their recommended dish. Flaregards signature ingredient was beef as they not only had multiple cattle farms, but there are many monsters in the dungeons which dropped Beef (Average) as well. There is even the possible of obtaining Beef (Excellent) as the level of the monsters here were high, however since the price of the meat is so high, it is unaffordable by the common people. Thus, if we managed to come across the meat, I plan to eat it with everyone rather than sell it. While waiting for our food to arrive, Phil began introducing herself, beginning her introduction as my girlfriend. Then, Til jokingly replied Ah, Oneechan. Remember to be careful of Selene. While the atmosphere went on as such, the food arrived. [Youya, Youya! Its an incredible amount of meat!] (Luna) [Its been a while since weve had steak.] (Youya) Although it was just Average, the beef was still delicious. It was on a different level as compared to the cattle grown in farms. I picked up a knife and cut the meat, however the meat split apart without much effort, showing its high quality. When biting into the chunk of meat, the meat juices just flowed out from the inside. Although it was just lightly seasoned with rock salt, it brought out the deliciousness of the meat. [Its delicious]. (Youya) [Yes, its really delicious.] (Phil) [This is so good! The standard is completely different! Seconds please!] (Til) [I would like a second helping as well please.] (Selene) If the meats quality was this good at Average, I wonder just how delicious it would be at Excellent. I am definitely looking forward to trying it. With Lunas Increased Drop Rate, it is possible for us to increase our chances of obtaining beef (Excellent). Other meat dishes such as stews and stir-fried items were also brought to our table one by one. We continued to enjoy the various dishes as much as we could. . . . Luna and Til had their stomachs inflated like a balloon after the meal. [My stomach is soo full. Luna cant eat anymore] (Luna) [Right!? I cant eat a single bite anymore.] (Til) Even I ate too much, I got too engrossed in the food after the first bite and continued to eat. [I had thought about it earlier, but Til and Phil have very similar voices.] (Selene) [We are sisters after all.] (Phil) [People say that quite often, dont they.] (Til) [Whenever I hear one of you call my name, I usually get lost figuring out who to respond to.] (Youya) The two of them had similar voices and even similar names. [Its not a huge problem in our everyday life but, it may cause some trouble when we are in a battle.] (Selene) Selene opened her mouth with a serious face, looks like she planned to bring that up from the beginning. [Then, how about I call Youya Oniichan instead? Since youre going to get married to my sister after all.] (Til) [Til. That, suddenly bringing in marriage, its too fast.] (Phil) Although she sounded against it, Phil was smiling while trying to shake the idea of marriage out of her head. I could even see her glancing over at me in that moment. [Eh? Does that mean you dont plan to? My sister being taken advantage of.. Thats so tragic.] (Til) [Ha?Eh? Eh eh? What?] (Phil) Til began toying with Phil while keeping her head down. It looks like she could be feeling lonely knowing that Ill be taking her sister away from her. [Well I plan on getting married with her, then youll be able to call me your older brother.] (Youya) [Got~~~ it. That means that my older brother has a weakness to younger sisters. Ill continue to call you niisan. In exchange, as your younger sister, please continue to pamper me from now on! Although having sibling relations is a bad hobby, so doing that kind of stuff is a no go.] (Til) [Til, just what are you trying to say?] (Youya) I let out a one-liner while Phil was getting tired from being too embarrassed. This sort of atmosphere isnt too bad, however its about time to move on to serious matters. For our first five-men party, the destination has been decided. [Remember to prepare your luggages for tomorrow. Our destination tomorrow will be the desert dungeon, the Sand Canal.] (Youya) Flaregards dungeons had various themes, differing between mines, volcanoes and desert dungeons. Sand Canal is a dungeon set in a desert world with an all you can see, sand landscape. Its recommended level was 31 and is considered to be Flaregards most difficult dungeon due to the topography of the desert. [Youya, what is a desert?] (Luna) [Hmm. Its basically a large sandpit. With sand as far as you can see.] (Youya) [But doesnt that make moving difficult, and with the hot weather it makes hunting even less efficient. Why are we still heading there?] (Luna) That was a good question. Originally, we would avoid the desert dungeon just for the fact that it was a troublesome dungeon to hunt in. Given the viability and ease of hunts in other dungeons, it would be much more efficient to head to the other dungeons. [There is a treasure hidden within the deepest part of the desert. By using that item together with the item we got from the boss, well be able to increase our party limit to five.] (Youya) That is the reason why we had to challenge the desert no matter what. Our main problem would be if the treasure was already taken by another party. However, the timing was great as the weekly respawn would take place today. Plus, the treasure was held in a somewhat hidden room in that difficult dungeon. It should be fine for us to leave tomorrow and still get the item. [Uhn. Well have to go then. It looks difficult but Luna is excited to go to the desert for the first time.] (Luna) [Its probably much more difficult than what Luna is making it out to be, however there is another reason why this adventure will be much harder than before.] (Youya) Phil began turning her gaze towards me. It will be the girls first experience in the desert. [The Sand Canal is a extremely expansive and harsh dungeon. We would never make it to our destination within the day. Itll be our first overnight hunt in a dungeon, so be sure to keep your mind sharper than usual.] (Youya) I revealed the fact that we would be spending the night inside the dungeon. It is an extremely dangerous experience as our fatigue will continue to build up over time. As the difficult of the dungeons become harder, the number of times our hunt will be concluded in the same day will become lesser and lesser. This is a hurdle that the girls had to overcome no matter what. [Luna will do her best!] (Luna) [Elves are the hunters of the forest. We often camp out in the forest overnights. Dont underestimate me!] (Til) [Im getting nervous, however itll definitely be a good experience.] (Selene) Looking at everyones enthusiasm gave me a peace of mind. With this, we can prepare confidently and challenge the Sand Canal. To prepare for the future, I had the intention to have the girls experience the bitterness of setting up camp without using the convenient Magic Tent however doing that in a harsh environment such as the desert could cause everyone to feel defeated. Hence, I decided to leave that to the next opportunity. Overhearing the two young girls excitement about their first camp, I wonder what kind of reactions they would give after the actual thing. Volume 3 Chapter 7 After arriving at Flaregard yesterday, we prepared our equipment and inventory for our adventure in the desert. In order to survive the desert, several preparations had to be prepared. In the morning, I showed my face at the guild and searched for any quests available. In the end, we were lucky to accept a quest set in the Sand Canal. It was a quest requesting for Spirit Herbs, an expensive herb used for medicines which can only be collected in the Sand Canal. The reward was high too. . . . We finally arrived at the Sand Canal with sand as far as the eye can see. The wind was strong as dust was being blown everywhere. [Ughh. Theres sand in my ears. The sand is everywhere.] (Luna) Luna eyes began tearing up as she tried desperately to hold down her fox ears. Her large cute fox ears were in pain as the dust was being blown everywhere in the desert. [Phil, use that to cover Lunas ears.] (Youya) [Okay, Youya.] (Phil) Phil took out a hood from her magic bag and handed it over to Luna, snugly covering her eyes with a hood made for a fox-girl. As one would expected, such a hood wasnt commercially available in stores so I asked Phil if she could make one yesterday for Luna. [Aaa. Luna, that looks cute.] (Til) [Uhn. I like it. Now I can hear properly. Thank you Phil.] (Luna) [Its more important that you like it.] (Phil) Phil had a pretty high wife-power level as she was an expert at sewing, washing, and cooking. [Everyone, put on the hood that I passed to you yesterday. Youll be done in pretty quickly if you expose yourself to the heat. The longer you are exposed to the sunlight, the faster youll dry up.] (Youya) Even though it was extremely warm, youll come to regret wearing thin clothes and risk exposing your skin towards the searing sun rays as the possibility of sunburn is extremely high. Therefore, itll be much more important to wear clothes that cover your body as much as possible. [Ahh, this cloak feels so refreshing.] (Til) [Uhn. Its cooling.] (Luna) [This.. Is a magic tool isnt it. Even though were walking in the desert it feels refreshingly cold.] (Selene) The cloaks that everyone had was a mantle which had the magical engraving, Cooling into it made by dwarfs. Dwarven magic tools were necessary for certain dungeons despite their high prices. For example, it would be considered suicidal to challenge the Sand Canal without this mantle. [Seems like our compass is working properly.] (Youya) I took out a magic compass from my magic bag as we continued to transverse the desert. In the desert, there was another element that made the dungeon even more difficult than the heat, your sense of direction. There isnt a single landmark present in the desert and above all, sand was constantly being blown by the wind, causing the visibility even in the day to become worse. If you were to continue travelling blindly in this dungeon, eventually youll lose your sense of direction and be unable to progress nor return to the entrance. Furthermore, normal compasses werent functioning within the dungeon as the dungeon wasnt a natural occurrence, but a magical one. The dungeon existed within a different world, causing the normal compasses to become dysfunctional as their principles werent functional in this different world. However, truth is that wasnt the reason why the mortality rate in this dungeon was so high. So long as one kept a levelled mind, it would be possible to survive the dungeon. Thus, the number one reason was distress. Some adventurers could had entered without a compass whereas some could had accidentally destroyed their compass during a battle. As the case with magical items, a magic compass is expensive and very few parties actually have a spare compass in reserve. Thus the moment it is destroyed, adventurers would fall into despair and panic, causing their entire party to be annihilated. I myself didnt have a spare compass, however we were safe as Phil had her own magic compass. [Now then, everyone, be sure to secure your Return Stone.] (Youya) The girls nodded in response. In these sorts of situation where chaos is equivalent to death, we can truly be thankful for the Return Stones we have in possession. We had also filled our magic bags with as much water as possible due to the tremendous amount of hydration we could lose in the desert. Normally, a person would need about 2 litres of water a day to survive, however, in the desert that amount could easily be doubled. For our adventure this time, it should take about three days to reach our destination. Per person, that would amount to 12 litres for three days, and 60 litres for the entire party. Furthermore, we had to account for a buffer time of 2 days due to any unforeseen circumstances, making it necessary for us to carry 100 litres of water. Thus, the bare minimum required to survive the desert would be to have a mantle with a cooling effect, a magic compass, a large amount of water plus a magic bag to hold that amount of water and a Return Stone should things become dangerous. Any adventurers attempting to challenge the desert without any of those 5 requirements should be prepared for the possibility of death. This strict condition was the main reason why I had requested the girls not to challenge the dungeons without reuniting with me. There are many dungeons similar to this once we were level 30 and above, with the high possibility of losing your life even after making preparations in advance. I was one of those frequent offenders who entered dungeons without making any preparations in advance. In a sense, this was a way of baptism for adventurers who think that they could survive anything just by being able to defeat monsters and neglecting any other preparations other than their own ability. [Now then, were all ready to depart. Lets form into 2 separate parties since we have five people. Accounting for the worst-case scenarios, lets divide ourselves.] (Youya) Although we could just act together as a single party, the benefits gained by forming an official part was too good to pass up. In the case of a battle, the adventurer who landed the deciding blow would be granted the total experience value, however in a party that experience value would be divided among the members. Furthermore, each time the number of members in the party increases by one, the experience is multiplied by 1.1 times. A party of two would get a total of 1.1 times the original experience, and a party of three would get 1.21, so on and so forth. Aside from that, we were able to roughly sense the location of each party member plus the effective range of the partys spells and recovery magic. Hence we were going though the trouble to obtain the items required to increase our party limit to five, even if it was extremely difficult. [Itll be better for me and Selene to separate, as well as Phil and Til who are in the backguard.] (Youya) This was the best outcome. [The low-levelled Phil is currently inferior to everyone else in combat effectiveness, making it important for Luna to protect Phil. Thus, Til and I will be in one party while Selene, Luna and Phil will be in another. Ill also leave the command of the 2nd party to Phil.] (Youya) Well be safe even if our parties somehow managed to get separated from each other since Phil had years of experience as well as a magic compass in her possession. Everyone nodded to my decision with no opposition. Frankly it was a little surprising. [Honestly, I thought that Luna would had voiced out against the idea.] (Youya) [Muu. Luna wants to be with Youya, but everyones life is at risk. Luna cant be so selfish.] (Luna) [I see. Good girl.] (Youya) Luna narrowed her eyes as I gently stroked her head. It seems that she has begun to mature even without me knowing it. [Youya-niisan, shall we go? Its time for you protect your cute little sister.] (Til) (Note: I have been translating Youya-ojiisan as Uncle Youya for Selene, however I am completely unsure on how to translate Youya-niisan since there isnt a term that fits the meaning.. I may be changing entirely on how their names are said in the future for clarity.) [Im a little uneasy about having Til in the two-man party..] (Phil) [Ahh. Thats mean! Ill cry you know!] (Til) Lets stop the jokes here and be serious. Just by standing here, our strength will be robbed by the heat. . . . About two hours has passed since we started walking from the entrance. Despite the time, we hadnt gained that much distance as our feet were becoming heavier and getting caught in the sand. Although we were wearing a magic cloak, it was still painful to walk under the merciless sun rays. [Youya-niisan, Im tired.. Piggyback mee.] (Til) [Ill think about it. Maybe when you collapse Ill do it.] (Youya) Although Til seems to have built up a lot of physical strength and stamina from hunting in the forest, it seems that transversing the desert is difficult as it was completely different from the forest. Although Luna wasnt complaining as much, her eyes looked completely dead while Selene was dead quiet, silently enduring the elements. Phil on the other hand was on a completely different level as she appeared somewhat normal in the hot weather. [Youya, there arent any adventurers here at all.] (Luna) [That isnt surprising since its such a harsh dungeon. If you had a choice you would avoid it at all cost.] (Youya) That included me as I would never had come to this dungeon except for the fact that we needed that item. Lunas ears which were covered by the hood began twitching quickly, it looks like she has found enemies nearby. [Enemies extremely close. In front of us. Although its strange, since it doesnt look that close.] (Luna) Luna strained her eyes as if she was trying desperately to locate the enemies. However, no matter how far we looked there werent any monsters in sight. I wonder what that monster could be. [Ill head to the front. Even if we cant see the enemy, the tank must be at the front.] (Selene) Selene tried to save time and get in position as the vanguard. [Wait Selene!] (Youya) As I was also being affected by the heat, I was slow in paying attention to Selenes actions. [Uncle Youya, whats wrong?] (Selene) My warning was too late as Selenes legs were being swallowed by the ground, following the sand as she was completely eaten by the large hold. The hole reminded me of a huge Antlion den. In the center of the hole, there was a large caterpillar-like demon with a huge circular mouth and fangs coating the sides capable of swallowing Selene in one huge gulp. It opened its mouth, waiting for its prey to fall into its mouth. It is a Sand Worm, a monster which preys on adventurers by preparing traps in the desert. Selene desperately tried to stop herself from being swallowed but the flowing sand was too heavy for her to resist. She attempted to use the spikes in Renoirs shield to stabilize however the spike is unable to pierce anything substantial in the sand. It is one of the hardship of battling in the desert as anchoring itself doesnt work here. [Til, Phil. Ill save Selene, fire as many arrows as you can!] (Youya) [Im already doing that!] (Til) [Leave it to me!] (Phil) Til and Phil began firing their arrows one after another. Til fired her beginner class magic Thunder Arrow while Phil converts hers and Tils attacks into the Water (Ice) attribute using Magic Enchantment: Water. I approached the large hole which Selene fell in and threw a rope. She grabs onto the rope however I was unable to catch my footing and was about to fall into the hole. [Youya, Luna will help as well.] (Luna) [Thanks you for the save!] (Youya) Luna hugged me from behind and began pulling from the back, saving me and keeping me from falling into the hole. The rope began to tighten as Selenes fall came to a stop. The Sand Worm tried to close its mouth right below Selenes foot, making a large clicking sound. Selenes face turned blue as she would had most likely been eaten if we were even seconds slower in saving her. Falling right past Selene were Tils and Phils arrows as arrows began raining all over the monster. [ KYOOOOOOOO] The Sand Worm screams in pain as it receives a series of arrows and Thunder Arrows which had their attributes changed to Water (Ice), increasing the amount of damage it received by two times. It quickly turned into blue particles as its fangs appeared as item drops which served as good materials. Unfortunately, Til told us to stop as the experience values were distributed to me and Til. I had hoped to pass as much experience points to Phil as possible but this is the best we could do right now. I wish that we could get our party of five as soon as possible. [That was dangerous, Selene.] (Youya) [Yeah. I felt my lifespan shortening from that.] (Selene) Monsters which dwelled in deserts were troublesome to deal with. For adventurers, sand was just an annoying part of the environment, however several monsters were capable of utilizing it to their benefit and used it to hunt adventurers. [Selene, could you pick up the item dropped in the center of the hole. Be sure to hold onto the rope securely and well pull you up.] (Youya) [Okay, sorry for the trouble.] (Selene) [Dont worry about it.] (Youya) The adventure in the Sand Canal has just begun. Looking at the girls stamina.. I cant help but feel a little uneasy. . . . Its been three hours since our encounter with the Sand Worm and we have already encountered several ambushes from several monsters. Usually itll be a pleasure for us to encounter monsters, however all the monsters we have encountered so far were cunning monsters who made use of all sorts of troublesome tactics utilizing the deserts landscape, making it not only physically draining but it also sapped the three girls spirits as well. Aside from Phil, the other girls had been much more exhausted than I had expected. Ive been letting them consume more water than we had prepared, however it still appeared to be too difficult for them. They were already about to consume more amount than we prepared for today. Looks like they were reaching their limits, especially Til and Selene. It wouldnt be funny for them to suffer from sunstroke in this situation. Lunas nose began twitching as she sniffed the air. Then, her tail suddenly rose up with vigor. [The smell of water! I smell water up ahead and theres a refreshing sound a little further away.] (Luna) Til and Selene raised their eyes upon hearing Water and cool as they were on the verge of collapsing. Could it be? [Its an oasis. The oasis changes location every week in the Sand Canal and is wide enough to swim in. Its a beautiful lake with drinking water and it is usually kept at a nice temperature. There are also fruits and item only available there.] (Youya) Everyones faces gleamed after listening to my words. It is said that the oasis is the conscience of the dungeon as it completely depended on your luck whether you get to encounter it or not. It can be said that we are extremely lucky. After walking for ten minutes, the sight of greenery and a blue lake could be seen in the desert landscape. The oasis had appeared in front of our eyes. [Youya-niisan. I can see it! Its the Oasis! The water, the fruits. Uwahhh!] (Til) Til jumps out as I grab her nape, causing her to fall onto the sand. Im glad that I managed to stop her in time this time around. [Guhee. Youya-niisan. What are you trying to do!] (Til) [If you were to jump out like this, the oasis will disappear.] (Youya) There was also a trap placed on the oasis which is widely considered as the conscience of the desert. [Youya, something is weird. The smell of the water changed directions. It shifted to our right.] (Luna) [Luna, lead me to the smell.] (Youya) [Uhn. Okay.] (Luna) We ignored the oasis which was visible right in front of us, following Lunas nose instead and changed locations. [Actually, there are traps set in the oasis as well. The first oasis you will see is a mirage, and the moment you touch that mirage, the real oasis will disappear.] (Youya) There is a famous story where an adventurer who was lost wandering around the desert, managed to come across the oasis as he was on the verge of death. Deciding to muster the last of his strength, he runs into the oasis just to realise that it was a mirage and collapsed on the spot. [Take a look. At this distance, if you look closely does the outline of the oasis seems slightly distorted? If you are able to realise that the oasis you are looking at is a mirage, then youll be able to look for the real thing by looking for the oasis with a clear outline. This time, we could rely on Lunas nose so we got a handicap.] (Youya) [Uhn. Luna did her best.] (Luna) I began to stroke Lunas head. [Just what is this. It has such a bad taste! If you were to see such a thing in a desert like this, anyone wouldnt hesitate to jump out!] (Til) [Ill agree that the trap leaves a bad taste in your mouth.] (Youya) It is only in a dungeon where you can find this sort of things. I am sure that the person who designed all the dungeons has a great personality. Finally, we arrived at the actual oasis. [Todays adventurer ends here. Lets camp here for the night.] (Youya) After I said so, the two children began cheering with a bright smile before taking off their cloaks and running to the lake. Then, Selenes expression began to soften. It seems that our luck was great, encountering the oasis in such a timing. Lets be sure to enjoy the oasis. Volume 3 Chapter 8 While exploring the desert dungeon Sand Canal, we came across an oasis. Since the oasiss location changed randomly every week, it was a rare occurrence and it can be said that we are extremely lucky. [Luna, its water! Water you know.] (Til) [Uhn. It looks refreshing.] (Luna) In the center of the oasis, two lovely girls, the elven girl Til and fox-eared Luna had taken off their clothes and began swimming in their underwear. [It feels soo gooodd.] (Til) [So cold~. Feels great.] (Luna) The sight of Til and Luna playing with water in their underwear looked like itll make a good painting. [I feel like bathing in the lake as well, however it feels embarrassing to take off my clothes in front of you.] (Selene) The former princess, Selene seemed to be less wild than Til and Luna as she was controlling herself from diving into the lake despite struggling against the desert heat. However, from the back, someone was covering my eyes with her hands. [Youya, you arent allowed to look.] (Phil) The person in question was Phil as her voice was filled with jealousy. Phil had always been conscious of the fact that her chest was smaller than her younger sister, Although it could also be her worrying that I may have a younger sister complex from seeing her younger sister in her underwear. Although this side of her was cute as well. Ive never really felt concerned about the size of her breasts, or rather I felt that it was perfect for the beautiful Phil right now. [Uhm. Its that you know. Im about to head over there to prepare dinner and the tent. So Phil and Selene should just go over and enjoy your bath in the lake. Dont worry since I wont peek. You can rest assured about that.] (Youya) Phil and Selene should also rejuvenate their spirits by bathing in the lake. Since they were concerned about me, then I should move away to let them enjoy themselves. [Youya, lets bath together!] (Luna) [Youya-niisan should be feeling hot too right?] (Til) Without any reservations, the two girls who came over unexpectedly grabbed my hands, dragging me into the lake. [Puha, what are the two of you doing so suddenly.] (Youya) [Youya should come and play together with us.] (Luna) [Uhn uhn. Just kick back and enjoy yourself. Dont worry about the people who are too embarrassed to enjoy themselves.] (Til) It feels bad to neglect Phil and Selene but the lake certainly feels refreshing. My body which felt burning hot was beginning to cool down. While I was in the lake, Luna and Til both entered the water. As a guardian, I am starting to feel worried about their lack of shame. [Mou. I cant take it anymore, Im entering as well.] (Selene) Selene began to move as she took off her clothes and armour, jumping into the lake in her underwear. I felt my eyes being stolen by her attractive body tempered by the training she has done her entire life. [This really feels great. Its embarrassing but you cant replicate this rejuvenating feeling anywhere.] (Selene) [Selene, arent you a princess? Wont this cause any problems?] (Youya) [There may or may not be some problems, but it should be fine if its uncle Youya.] (Selene) Selene smiled despite her embarrassment, invoking a sexual appeal that wasnt present in the two girls. [Uwahh. As expected of my sisters rival. Onee-chan, if you stay there then Youya-niisan is going to be snatched away you know.] (Til) Just one sentence from Til was enough to make Phils elven ears tremble as Phil prepared to enter the lake, taking off her clothes in a hurry. [Mou, if thats the case then itll be bad. Im entering as well!] (Phil) Then, she jumped into the lake in her underwear. Although Ive seen Phils naked figure several times, watching her figure under the bright sun was a refreshing sight. [Un~~. Its feels good. Its been a long time since Ive bathed in a lake.] (Phil) Phil started to laugh. [Just for future reference, everyone please be sure to control yourselves if there is another man besides myself in the party. Other men arent as gentle as I am and could even assault you if you lower your guard.] (Youya) Most men who are adventurers are always hungry for a women. If such beautiful girls such as themselves were to expose their skin, it is likely that they would immediately pounce given the chance. It is also like men to easily misunderstand your intentions if you even just a little bit kind to them. [Its ouhh-kayyy. Luna and Youya will always be together.] (Luna) [Uhn uhn. Other than Youya, I would never go adventuring with another guy.] (Til) [I have to agree with their sentiments. I only decided to join the party since its uncle Youyas party.] (Selene) [Youya is loved by everyone here. Im the same. It is because of you that I decided to be an adventurer again.] (Phil) Listening to their words made me happy as I knew that they were a bunch of good girls. I wished that I could continue to be an adventurer together with them forever. However, that also makes me uneasy. What would happen, if I happened to be gone? I wont be able to stay with them and continue to protect them forever. [Thanks ladies. Also, since were already swimming in the lake, lets catch some ingredients for our dinner. Since were here, lets catch something that cant be eaten anywhere else!] (Youya) Everyone responded enthusiastically to my proposal. At this rate, itll probably be noisier the moment dinner begins. . . . After our play session at the lake, we began preparing to set up camp. It was our first time spending the night in the dungeon with this party as I began to set up both mine and Phils magic tent onto the ground. Magic tents were extremely convenient to use in a dungeon as they were stored in a small capsule. After pressing the button and throwing the capsule onto the ground, a tent capable of fitting two people would appear and the button could be pressed again to return the tent to the capsule. Not only does it make it easier to set up camp, it doesnt take up a significant amount of space in the magic bag. Furthermore it has two unique features. First, when there is a monster detected within 50 metres of the tent, an alarm will be triggered, alerting the people inside the tent. Second is the characteristic that allows the tent to withstand up to three attacks, regardless of how powerful it is. After three attacks, the tent reverts to a normal tent. However, three attacks is more than enough time for us to get up and intercept the demon. Just by having this item, it makes our time in the dungeon much safer. [Youya, I scooped up the water!] (Luna) [I gather a lot of fruits Youya-niisan!] (Til) Luna and TIl who were in charge of procuring food were about to return. For the oasis-exclusive dish, we were using the fruits which could be gathered around the lake. There are two main fruits present around the oasis, bananas and coconuts. We peeled the bananas, cutting it into equal pieces and seasoned them with salt before coating it in plenty of cheese and baking them. It is a sweet and delicious fruit which can be eaten as it is, however doing this turns it into a delicious side dish with plenty of nutritional value. For the coconut, we broke the shell open and poured the juice within into a cup. Then, we peeled the white flesh inside the shell and sliced it. Eating it like this was delicious as well. By eating the slices of flesh with fish sauce, we can enjoy the texture of squid meat without the strong fishy taste with a slight sweetness and saltiness. [Everyone, dinner is ready.] (Youya) Baked bananas with coconut sashimi and a dried fish with vegetable soup. Fresh bananas and coconuts were fruits that we couldnt enjoy without coming to an oasis. [Youya, it tastes delicious!] (Luna) [Sweet and it has a nice smell.] (Til) The two girls started to drool as they stared at the dishes. [Lets start dinner immediately. Since oases are hard to come by, lets enjoy ourselves as much as possible for discovering the oasis!] (Youya) Everyone began nodding as we started to have dinner. [I like the coconut sashimi. It tastes delicious with a well-balanced sweetness and rich flavor.] (Selene) [The baked bananas are delicious too. It doesnt feel like the taste of the cheese and fruit is overwhelming the other. The dishes have a feeling as if they wouldnt lose to any ordinary store. Youya has always been good at cooking dishes like these for survival.] (Phil) Selene and Phil began to praise my dishes. [Im glad that you girls like it. I wasnt very familiar with the ingredients so I did the best I could with them. Although I am still pretty confident in handling ingredients.] (Youya) Magic bags were items that only adventurers with thick wallets could afford. Since I wasnt always a successful adventurer, back when I was just a normal adventurer I had carried an ordinary backpack with me and was unable to carry a large amount of supplies with me. This was how my cooking skills along with ingredient procurement improved over the years being an adventurer. Ordinary adventurers often sold any rare or higher value items as soon as they obtained them for money, that was how we made our living. Even I fell into that category once upon a time. Selling every item that was worth selling: Magic Bags, Return Stones, Magical Compasses. I knew that they were convenient items but I wasnt able to prepare my own equipment and supplies without the money for it, leaving me no choice but to sell them. It is the privilege of a successful adventurer to be capable of keeping and using expensive items for their own convenience. [Youya, the coconut juice is delicious!] (Luna) [I want to keep it in my bottle instead of water!] (Til) The two girls began going crazy for the coconut juice. [If you like it that much, then you can go ahead and collect some after the meal. Only then are you allowed to pack them in your magic bag instead of water.] (Youya) The moment they heard my words, the two girls began glimmering with excitement. Looking at them, they were definitely going to go coconut-hunting after the meal. Coconut juice was effective for us as a nutrition supplement while providing some water at the same time. Looking at our pace, itll definitely come in handy for the rest of our journey in the dungeon. The meal continued to pass pleasantly as the large amounts of baked bananas and coconut dishes disappeared, entering into everyones stomachs. [Luna, come over here for a bit.] (Youya) [Okay.] (Luna) Luna walked over and began sitting on my lap even though I didnt mean for her to do so. Smiling bitterly, I opened my Magic Bag and retrieved a necklace with a blue jewel, putting it onto Lunas neck. [Its pretty. Youya, whats this?] (Luna) Lunas eyes began sparkling as she awaited my answer. [I got the jewel from the hidden room where I first met you. Its a piece of the crystal which you were trapped in. I thought that it was something you would like to have and decided to prepare an accessory for you.] (Youya) The crystal was a Blue Crystal, a crystal with a deep ocean blue colour containing magical power within. [Nostalgic looking at it feels very calming. Thank you Youya.] (Luna) Luna kissed my cheek and Til began screaming *kya kya* while Phil puffed her cheeks. [Im relieved that you like it. Im hoping that itll help you to restore some of your lost memories.] (Youya) [Uhn. Then, if Luna remembers anything, she will talk to Youya.] (Luna) Luna hugged me, rubbing her cheeks onto my chest as her tail shook energetically. After snapping out of the atmosphere, I continued with another instruction. [Now that dinner is over, its everyones free time. However, be sure to head to bed early since we didnt progress as much as I expected initially. So well be making up for our lost progress tomorrow. Expect a difficult journey tomorrow!.] (Youya) Everyone nodded their head in response. Im glad that everyone recovered from their sorry states earlier today. Well definitely be able to travel further than we did today. . . . In the middle of night, we were attacked by several monsters however we were successfully able to repel all of their attacks. After all, having a magical tent which was capable of alerting us whenever a monster was within a distance of 50 metres is convenient. Im not trying to say that its nice to be defeated in direct combat, however it is definitely much shittier for us to be killed in our sleep. Furthermore there was a much more pressing matter at hand, which was the number of tents we had. I had suggested for me and Phil to have our own tent while the other three girls were to sleep in their own tent, however Luna was strongly against it. The allocation of tent wasnt influenced by our partys balance since we would be able to get in formation whenever a monster approached us, so there wasnt any issue about that. However, I wanted to spend the night alone with Phil so that we could indulge ourselves. Reading the atmosphere, Til and Selene agreed to the allocation however Luna continued to oppose it, saying that we should be sleeping together. Eventually she relented, however I hadnt expected her to enter the tent in the night while we were in the middle of the act. It was extremely difficult for us to resolve the situation without needlessly explaining anything. [Now then, before we leave, lets secure all the treasures of the oasis!] (Youya) I raised my voice early in the morning. Although we had stripped the oasis of most of its fruits and collected the water, there was still a hidden treasure hidden at the bottom of the lake. If someone were to go swimming in the lake, it would be easy to notice something unusual happening at the bottom of the lake. Even though it was a lake with its own current, there was a point where water was continuously being sucked in. Following the flow of water, you would arrive at the hidden chest. However for some reason, this only occurs in the early morning and we were about to collect it. [Youya, Luna will go!] (Luna) Luna whom we decided was the best swimmer yesterday during our bathing session was raising her hand. Since there wasnt any monsters in the lake, itll be safe for a single person to dive down. [In that case, can I leave it to you?] (Youya) [Uhn! Luna is leaving now!] (Luna) Luna immediately jumped into the lake who was somehow already in her swimsuit. I had told everyone about the abnormal water current beforehand as the three of us continued to gaze at the surface of the water. After several moments, Luna appeared. [Look Youya! Its a treasure!] (Luna) Luna was holding a vial with a special medicine within. [Splendid work Luna. That is a pretty good item.] (Youya) The name of the item was Terrier. It had the effect of curing the user of all status abnormalities. Even with human technology, it was only possible to make potions capable of recovering a single abnormally. However, potions capable of curing every abnormally was still only obtainable from the dungeon. Furthermore, it was also capable of curing special status abnormalities that has not been discovered, making it extremely valuable. [Also, there was a strange voice in my head.] (Luna) [A strange voice?] (Youya) I didnt know anything about the voice as I didnt recall any special events besides the treasure chest. [Uhm.. The voice at the bottom said Child blessed by the moon, gather the three prayers and at the place where the light shines onto blue tears, a new door will be opened.] (Luna) Despite hearing the words of the voice, nothing had particularly come to my mind. I hadnt heard of such a line. Looking at the jewel shining on Lunas neck, there was a new crest engraved into the transparent blue gem. [Luna, is there anything weird going on with the necklace?] (Youya) [Uhm there is just a funny crest on it now. Is something wrong?] (Luna) It looks like the event was triggered thanks to Luna, who I thought of as a special existence in herself along with the necklace in her possession.The three prayers.. Was what the voice said. It looks interesting. Ill be sure to pay attention to the voice as we continue our journey. I pulled up Luna from the lake and she began wiping her body before changing her clothes. [Lets go, lets do our best today too!] (Luna) Two more days left in the dungeon, from now on there will also be several gimmicks present along with the deserts natural environment. Lets keep our sense sharp for the rest of the journey. Itll be tough however if its the current us, well definitely be able to clear it. Volume 3 Chapter 9 We continued to progress through the dungeon at a pace superior to yesterday as the girls have managed to become comfortable walking on sand. This showed once again their talent as they had a good sense when it came to their own bodies. A persons status was important, however having a strong understanding of your own body also important. This was something I am painfully familiar with as I was able to become a middle-class adventurer despite having a bottom tier status. [Youya, Youya, yesterday the egg started to move!] (Luna) [I see. If the egg is starting to move then it means it is about to hatch. Next is to place it inside the hot spring and our pet will be born.] (Youya) [Looking forward to it!] (Luna) Lunas tail began to swing as she started humming. The egg in question was the Magic Egg that we had obtained back when we were in Greenwood. By maintaining skin contact aka warming the egg, the egg sucks the surrounding mana and the mana of the person in contact with it, feasting on the mana to grow. However, that wasnt enough to hatch the egg. In order to hatch the egg, well need to soak the egg in waters with high spiritual powers. In other words, we needed to submerge it in the hot springs at Flaregard which were one of their specialties. It was one of the reason why we had came to Flaregard. (Note: I know that I translated the hatcing process differently in the past but I wont be editing the previous chapters as I dont have the exact chapters which I had mistranslated. I may get to it in the future but as of right now, I wont. Speaking of mistranslations, I may have also mistranslated Youyas name but Im sure no one noticed that I hope) [Its exciting isnt it Luna.] (Til) [Uhn. Its our child, it will definitely be cute.] (Luna) Luna and Til looked excited while Selene was smiling at the back, completing embracing her elder-sister role. Initially, Selene was merely following along with Til and Lunas lively spirits however recently she began to become much more comfortable and begun acting out as their elder-sister. Also, Im relieved that Luna hadnt mentioned anything about last night when she entered my tent as she managed to sneak in while me and Phil were performing our deed. We had deceived our way out of the situation but we were worried about leaving the situation as it was. [I was worried about the encounter yesterday. Youya. Why didnt you tell the girls in advance about the monsters and traps waiting for them in the desert? Are there any circumstances to do so?] (Phil) It looks like nothing gets by Phil as she noticed even this small detail in less than a day. [I was also worried about that. Youya-ojisama has an amazing wealth of experience of knowledge. Thinking about the situation yesterday, normally you would had been able to teach us all the dangerous aspects of a dungeon before we entered. This way you could minimize the risks involved in our adventure.] (Selene) I vaguely smiled as Selenes analysis was spot-on. Dungeons with special aspects to it such as unique monsters and traps were extremely dangerous. However, if you possessed information about them beforehand then the risk involved would decrease dramatically. [It was to prepare you girls for the future and your ability to sense the impending crisis. Just as you said, having information about the dungeon before actually attempting it would be much safer as you would be prepared to act accordingly. However, this would hinder your growth rather than assist your growth. Even I wouldnt have information about every single dungeon and monster in the world. If you do not possess the conscious of mind to keep calm even after getting caught in a trap, then somewhere down the line you would lose your life in unknown territory.] (Youya) This was the reason why I had minimized the information given to the girls before entering the dungeon. A person is unable to become number one with just knowledge alone. By experiencing the viciousness and danger of monsters with your body and paying with your own blood, it becomes a better learning experience as compared to learning through words. By being overprotective, I would merely be impeding the girls growth. However there are still exceptions to certain situations. I will still be relaying information about important monsters and traps in advance so long as it is beneficial. For example: the Minotaurs sure-kill attack. Without advising precaution against its high speed charge, then they could had very well be dead on the spot. [Im surprised. Youya may actually be an excellent teacher.] (Phil) [Im just used to it. Just how many adventurers do you think Ive taught till this point.] (Youya) At this point ive taught and helped honed countless adventurers. Even after meeting Phil and Leonard, Ive been tutoring young adventurers when I was still an exclusive adventurer. [Im feeling extremely blessed right now to have Youya-ojisama as my teacher. Ill definitely get stronger no matter what.] (Selene) Selene clenched her fist. The battle for her kingdoms succession isnt too far away from now. Even I wished to impart as much of my experience and knowledge to Selene as possible. [Its good to be motivated however let me tell you whats your main flaw at the moment. Selene, you become too absorbed in a single thing and as a result, you neglect everything else that is happening around you.] (Youya) I grabbed Selenes shoulder, preventing her from moving as a large pitfall opened in the sand several steps ahead of us. It was a trap set to target adventurers whose attention is completely preoccupied with the heat, their consciousness becoming hazy due to the intense weather. A simple yet effective trap in such a large and painful desert. [Remain alert about your surroundings even during a conversation.] (Youya) [Yes. Ill be careful from now on.] (Selene) Selene nodded back to me in response. Our destination is still a distance away, lets continue on with our new-found motivation. . . . We placed our backs together, trusting each other and removing any blind spots. [Youya, our attacks wont land if they continue diving into the sand!] (Luna) [Its too difficult to land an arrow or a spell like this. Ughh they are irritating.] (Til) We were currently being surrounded by a group of 4 Desert Serpents. They were also commonly known as Sandfish Dragons due to their smooth skin with a similar colour to sand, with a body similar to fishes and claws which let them move about as if they were swimming in the sand. Unfortunately for us, their skin allows them to camouflage into the surrounding, making it difficult to even spot them. [Do not lose your focus. Even if we cant land any damage on them while they are underground, they are in the same boat. They cant land a critical blow so long as they are underground! Theyre waiting for us to give an opening!] (Youya) Desert Serpents were intelligent and cautious for a normal monster. By swimming around in groups and circling us, they are trying to open a gap in our defenses through intimidation and attacking only when an gap is opened. I began listening carefully as a large sound would be made whenever they jumped out of the sand. The next moment, one of the monsters jumped into the air in my direction. It looks like its target was me. By stepping forward with a slight crouch, I dodged the monsters charge as I drove my sword into its body. Together with its charge and my movement, the blade was slicing through its body with twice the speed. The sharpness of the black Magic Sword was also shown as the monster passed my body, with its body being sliced into two equal parts. However to my surprise, the monster continued to move even though its body was sliced into two, displaying tremendous vitality. [This is the method to defeat Desert Serpents. You counter their rush with your own attack, if timed right, they can be easily beaten.] (Youya) Attempting to chase the serpents when submerged in the sand only served to waste your own energy. The optimal strategy would be to counterattack the moment they attack. [Uhn. Luna will try it out.] (Luna) [Fufu. its stressful having to wait for the enemies to attack you know~.] (Til) Ill be sure to reprimand Til for her complaint later. As a result of the first attempt, the monsters attack pattern started to change. The Desert Serpents who were circling us dived deeply into the sand. [One coming towards us! From below!] (Luna) Luna with Presence Detection cried out detecting movement below us. If they are below us, then Selene should be the one to act. [Selene, you do it. Luna, tell Selene the exact location of the monster. Remember to signal her a moment before they surface from the ground.] (Youya) [I understand now.] (Selene) [Ill be sure to signal properly.] (Luna) Luna and Selene nodded in response. The Desert Serpents aim was visible. By surfacing directly below us, they are minimising the amount of time spent in the air after surfacing. It was an excellent idea however it was unfortunate for them as we had Luna who possessed Presence Detection. Selene adjusted her stance and readied her shield. [Fortress] (Selene) A thin blue barrier emanated from her shield. It was her skill which temporarily increased her defensive stats several times. Activating that skill seemed out of place, however she had a clear objective in activating her skill. Lunas fox ears continued to twitch seemingly quicker as her body continued to tremble. [3 2 1.. Now!] (Luna) Luna cried out, signalling Selene. [Shield Bash!] (Selene) Selene activated her class, the Crusaders unique skill, Shield bash. A skill which converts the users defense power into attack power, allowing her to release a powerful attack. It was for this reason that she activated Fortress. Selene swung her shield, the shield of Renoir downward into the ground, just as she threw her arm down, a thick iron pile jumps out of her shield with a screech. Immediately afterwards, the ground was gouged out as if an explosion occurred, bits and pieces of a Desert Serpent flew through the air among the sand that was thrown about. [As usual, that is some ridiculous power.] (Youya) Selene was an amazing tank, but secretly she possessed an extremely high-firepower skill in her back pocket. Number of remaining Desert Serpents: Two. Surprisingly, I had expected the remaining serpents to escape after witnessing this sight, however the two still had the intention to fight. The remaining two serpents jumped out towards us in two direct opposite directions, sandwiching us inbetween. The two of them had jumped from a distance away with their mouths wide open. The two serpents jumped into the air from a distance away, managing to jump to an amazing altitude, buying themselves enough time to safely release a breath attack. Their breath attack would be fatal to us if they managed to attack us without preparing our defenses. [Its finally time for my turn to shine.] (Til) [Such a huge target, I could hit it with my eyes closed.] (Phil) Arrows coated in ice began flying towards the two serpents who were widely exposed in the air. Phil had activated her Magical Enchantment: Ice onto herself and Til, firing towards the back and front respectively. Unable to release their breath attacks, the two Desert Serpents were pierced by a barrage of arrows and merely died in the air. [Eh? Onee-chan. How were you able to fire an arrow into each of its eyes at the same time at this distance!? And just how many arrows did you plan to fire before its body hit the ground? Somehow, you managed to fire three arrows while it was in the air. How were you even able to do that!!?] (Til) [Its the difference in experience.] (Phil) Disregarding Til, it was amazing for Phil who had a lower level to be able to take down the Desert Serpent in such a short span of time. Phil was someone who had the bonus stats from her level reset and maximum status gain, a bow which had its performance increased tremendously over the years, powerful arrows produced from Arrow Generation with her attribute enchantment which increased the damage of her attacks significantly having the most effective attribute. However, these wasnt enough for her to defeat the Desert Serpent. Rather, she had mercilessly fired multiple arrows into the weak points of the Desert Serpent, landing critical hits which raised her damage even further. She managed to fire two arrows into each eye, another arrow into its throat, causing the Serpent to suffer the brunt of its own breath attack, and continued to fire arrows into the monsters body as it fell down in an irregular fashion due to the explosion of its breath attack. It is a seemingly inhuman skill. [Its frustrating!!! I wont lose to anyone with a bow!] (Til) Til who was usually a happy-go-lucky person seemed seriously irritated and disappointed as she had taken tremendous pride in her archery skills. [Dont worry about it Til. You have more talent than me and youve been practicing a lot as well. You will definitely surpass me someday.] (Phil) [Uhn! I will definitely surpass you! So tell me about that triple shot!] (Til) [Its a skill that Im using right now to compensate for my low status. Since about 80% of my attack power is coming from my bow and arrow, I dont have that much bonuses to my physical strength. However if its your current physical strength, there isnt any difference from firing a single arrow at a time. Even if you were to use it, itll merely be for show.] (Phil) [Even so it is fine! It looks cool after all! I want to learn how to fire three arrows at once! No matter what I want to do it!] (Til) [Alright. Ill teach you.] (Phil) [Yay! I love you oneechan!] (Til) Til began hugging Phil displaying an affectionate sisterly love. With this, the battle against the Desert Serpents were over. We proceeded to collect the dropped items. Then, I became speechless. Among the dropped items, there was an Eel meat (Average). In this world the items which were dropped are rather appropriate for the species. For example, boars and orcs both dropped Pork (average). However I didnt expect the serpents to drop Eel meat as well. [Youya, tonight dinner is going to be a feast!] (Luna) [We did it! Eel meat is delicious!] (Til) The two girls were getting excited as they werent aware of my conflicted emotions. [Phil, can I rely on you for tonights dinner?] (Youya) [Sure, Ill make Youyas favourite dish.] (Phil) After pondering on it, it seemed likely for this to happen. For now, lets just enjoy the fact that we can enjoy delicious cooking for tonight. . . . After the battle, we continued to travel deeper into the desert and it was almost time for the sun to set. After checking the amount of water we had in stock, we were still in the green as we were lucky enough to come across the oasis, allowing us to drink beyond the amount I had planned initially. Our goal today was to reach of foot of *That* as I continued to check the magic compass to confirm our direction. Although it should be about time to see that [Over there, I see something weird over there. It looks shiny like a triangle.] (Til) It looks like Til who had the best eyesight among the party was the first to spot *that*. Thinking that we had finally arrived, I placed more strength into my legs as I sped up my pace and we continued towards it, until everyone was able to see it. It was a gigantic pyramidal structure shining with an intimidating golden colour. To put it in one word, its a pyramid. [Yosh, well stop here for today. That is the final destination of our adventure in this dungeon, the Golden Pyramid. We came for the treasure hiding within that structure, plus that building is an amazing place. In the deepest part of that structure, aside from our goal, there are also several amazing treasure boxes which will appear.] (Youya) Within the golden pyramid, are hidden treasures. And among those hidden treasures, there is something we need to increase our partys limit. When Luna and Til heard that we were done for today, the two of them began their strange food ritual seemingly far more energetic than before. Ill leave them to it for now. Tomorrow, Ill begin to explain the characteristics of the desert tomorrow. Despite how valuable the items available in the pyramid are, there is a reason why there wouldnt be any competition for the treasures. There are going to be many troublesome traps and troublesome monsters awaiting for us in the Golden Pyramid. Volume 3 Chapter 10 After spending the night camping outside the pyramid, we entered the pyramid the next day. In the pyramid, the pathways were illuminated by torches hung on the world, meaning that our visibility were firmly secure. [Youya, the torches look weird. How are they continuing to burn?] (Luna) Luna tilted her neck. [Now that you mentioned it, it does seem strange. Since it looks convenient lets take some home with us.] (Youya) It was natural for torches to be present in the game, so the thought about them being able to burn forever was pushed to the back of my mind. However, a torch which was capable of such a feat is a precious and convenient item. I tried to remove the torch from the wall however, I couldnt pull it out despite how much I tried. I thought that it would had been a valuable item if I could bring it back however it seems to be stuck to the wall. [The air feels stagnant.. Its the smell of dead bodies.] (Til) Til began to frown. [The monsters present here are completely different from the monsters in the desert. Undead monsters have the smell of death following them around. Besides undead monsters, other bug-type monsters, poisonous monsters and golems will appear.] (Youya) The three girls faces turned blue with disgust after mentioning the bug-type and undead monsters. I understand what they are feeling since they hated insects and undead were hated with a strong prejudice. We continued walking on the stone pavement, with our goal being the top of the pyramids. This pyramid consists of 4 upper floors and the monsters here were annoying to deal with, however the most dangerous part about this place was the traps. In this world as well, pyramids were erected as the tomb for rulers and countless traps were set up to repel grave robbers. The Golden Pyramid wasnt an exception to this. [Everyone, as usual be aware of any traps that may be around.] (Youya) Everyone nodded as I sharpened my senses and relied on my experience to locate any traps present. We arent planning to just stop at intermediate dungeons, we are going to conquer the most difficult dungeons in the world. Together with Luna, the two of us continued to walk at the front. I would praise her whenever she located a trap and would teach her how to locate the trap if she were to neglect any. [Difficult, however Luna has already memorised it. Youya, this type is also ouh~~kay!] (Luna) It is extremely fun to tutor Luna as her growth rate is ridiculously fast, already becoming an excellent Thief. Just as I was planning on taking a break, Lunas fox ear began to twitch. [The ceiling! A demon is crawling!] (Luna) Right off the bat weve encountered the unique monster for the pyramid. Its an extremely dangerous monster which has placed many adventurers into their graves. [Phil, Til. Ill leave it to you.] (Youya) [Leave it to me.] (Phil) [That, isnt this dangerous!!?] (Til) The two of them released their arrows towards the ceiling, at the Silent-Death Scorpion which was crawling on the ceiling. It was a scorpion the size of Lunas head. It wasnt a powerful monster, however it was as troublesome as its name implies. It doesnt produce a single sound. It silently crawls on the ceiling, approaching oblivious adventurers. For parties which didnt possess Presence Detection, they would be unable to notice its approach, and by the time they do, they would be injected with an extremely potent paralysis poison by the scorpion, taking away their consciousness. Many adventurers who survived their encounter often suffered traumas from it. [Its pointless! There are too many of them! We arent even doing anything to them. What! Why does my lightning spells not work on them! My ranged magic cant work on them!] (Til) [Til, stop focusing on your mouth and move your hands.] (Phil) Silent Death Scorpions had another troublesome feature. They often moved about in swarms. Furthermore, they were small and fast, making them difficult to hit. Til who was a genius in archery even had her accuracy reduced to 70%. Whereas normal adventurers would only be capable of landing about 30% of their shots. Phil on the other hand. Could only be described as a monster. She hadnt missed a single shot until now. Showcasing her ability to fire three arrows at one go, and landing each of them with absolute accuracy. Meanwhile, Til was struggling to land her shots among Phils rain of arrows. [Luna,Selene. Its about time for them to jump onto the ground. The moment they land, beat them with all of your strength.] (Youya) [Uhn. Luna will do her best.] (Luna) [It is difficult to deal with numerous small targets.] (Selene) Scorpions began falling from the ceiling, holding up their poisonous stingers above their heads one after another as I began to cut them. Individually, they have low vitality and it would be easy to kill them with a single blow. However, itll be bad to receive even a single hit from any of them as their poison is lethal to our hearts. [Stop moving!] (Selene) [Ugh.. Cant land a single hit.] (Luna) Similar to Til, Selene and Luna were beginning to struggle. Looks like its time to use that. [Both of you get behind me! Im activating my magic!] (Youya) I managed to gather enough hate and the enemies were attracted to me, entering my range. I began my chant as I swung my sword at the nearby enemies. This time, Im activating a customized version of the Intermediate Magic Ice Storm. I increased the spells range as well as area of effect by lengthening the cast time while dropping the power to near zero. After my long chant was completed, the spell was activated. [Permafrost] (Youya) With the low ceiling, cold air begins to fill the narrow passage. Due to the enclosed space, the scorpions had nowhere to run and became enveloped by frost, freezing in place. However, since the spell had almost zero damage, this isnt enough to defeat them. This spell has a different purpose though, as Ice magic possessed an additional effect despite its low power. It inflicts the abnormal status effect, Frozen. Even if the enemy managed to escape the brunt of the spell, their speed would still be decreased within the effective range. Thus, as a Magic Knight with inferior magical abilities, it is possible to raise the effectiveness of Ice magic by decreasing its firepower. I decreased its firepower, aiming to improve it as a magic capable of sealing the enemies movements over a larger range and area. Even if its firepower decreases, the effect of being frozen doesnt change. Permafrost was an incredibly useful magic. [Now we can easily defeat all of them! Lets defeat all of them in one go!] (Youya) This isnt even a battle anymore now that all the small insects werent capable of moving anymore. And even if they were, they werent able to move very quickly. Now then, lets hunt all of them in one go. . . . [Its finally over~~~~.] (Til) While picking up her arrows, Til voiced out her exhaustions. The reason she was collecting her used arrows was to replenish her stock of arrows. Especially for arrows created by someone with Phils status. [Youya, Youya! We leveled up!] (Luna) [Ah. Me too.] (Til [Now that you mentioned it, so did I.] (Selene) [Since my level was lower, my level increased by three.] (Phil) [Silent Death Scorpions are small and brittle, however each of them gave experience that was appropriate for their level. Since we managed to defeat all of them, our levels would definitely rise in one go. With this high of an efficiency, we may even come back once they respawn.] (Youya) Silent Death Scorpions were things nightmares are made of for normal adventurers, however it may even be the best option to raise our levels. Thanks to that one battle, Phils level rose to 15. However, the girls began giving me sharp looks after listening to my comment. It wasnt that I didnt understand their troubles, since it was difficult to transverse the desert and walking in the pyramid. [Be sure to pick up all the items dropped by them. The Death Scorpion Poison is an item we need for the quest.] (Youya) I picked up a vial containing purple liquid on the ground. It is an item that has a low drop rate, however thanks to Lunas Increased Drop Rate, we were able to secure several of them at once. [Youya-ojisan, wouldnt the poison be dangerous if it was spread around the city?] (Selene) [Of course it isnt meant for that sort of thing. Poisons and medicines come hand in hand. Poisons dropped by scorpions in dungeons can be turned into materials used for intermediate recovery potions and antidotes. Ive also heard that it can be used to make perfumes.] (Youya) [I see.. Then what would happen if you ingested the liquid just as it is?] (Selene) [Depending on the amount.. Itll cause instant death if you arent strong enough and most likely a severe poison status effect onto intermediate level adventurers.] (Youya) [Poisons from monsters are that dangerous.. Well have to be careful with the vials then.] (Selene) After our conversation, we continued to collect the items dropped by the monsters and arrows before continuing forward. . . . After wandering in the pyramid, we were about to arrive at the top layer of the structure, after breaking through three floors of the pyramid. Aside from me and Phil, the other girls looked tattered with empty eyes, their spirits seemingly broken by the immense number of monsters and traps we encountered within the Golden Pyramid. In the pyramid, the traps arent just targeted at adventurers, but were also utilized in combination with the monsters in the dungeon. Many of the traps were designed to kill adventurers and at the same time, they served as a signal for monsters to convene at the location in order to neutralize any intruders. Thanks to this, the three girls were completely worned out. It was important for them to hone their instincts and mind towards a sudden crisis, however when they were too focused on their surroundings, their physical strength and mental concentration would be exhausted as time passes. [Drink this and relax your mind.] (Youya) I handed everyone some coconut juice which we collected back at the oasis as their minds seemed to recover slightly with the sweet liquid. [Youya.. This place.. Never again.] (Luna) With her fox tail hanging low, Luna said with an unusually depressed tone. [I know what you are going through, but it served as a good learning experience.] (Youya) [Certainly] (Luna) Encountering another dungeon with a similar variety of traps is highly unlikely as we continue to travel in the future, making this experience an extremely valuable learning trip for Luna who chose to be a Thief. [But Youya-niisan, were finally at the goal now right! Just a little more and well be out of here right?] (Til) [Thats right. Although this isnt a normal dungeon. The closer you are to the goal, the more difficult the dungeon becomes.] (Youya) The two girls began hugging each other, trembling as they heard my response. Looks like they were having flashbacks to the undead trap we had encountered on the third floor earlier. [Anyway, lets continue forward. Its been difficult for us to arrive at this point. We wouldnt want to return here again do we.] (Selene) Selene was right. However her bad habit of tunneling her focus onto a single goal was kicked into gear, neglecting everything else happening around. Looking at the ground ahead of her, it looked like a trap was hidden in the ground. However that was a good trap to activate as it looked like itll serve as a good wake-up call for them. As Selenes foot took a step forward, a hard sound could be heard. [Ah. This Did I do that?] (Selene) [Yup. You did that.] (Youya) A dull sound could be heard from behind das a gigantic metal ball began rolling behind us. The fifth floor of the pyramid was a single sloped path with a turn a distance away. It looked as if once we are past the corner, well be safe from the metal ball. [Run!] (Luna) [Hurry up everyone!] (Til) Luna and Til raised their voices as I grabbed their collars. [Kyaa~] (Luna) [Youya-niisan. What are you doing! Were going to die at this rate!] (Til) [Luna, Til. There are numerous traps present in this small path up ahead. Are you able to identify each of them while escaping from the metal ball?] (Youya) The two of them looked down to the ground as they observed the ground ahead. As a matter of fact, the metal ball was just a decoy. It was just a trap to lull the intruders into a state of panic, hurriedly activating every trap present in the hallway. Adventurers who escape from the ball in a hurry would wind up getting caught in an even more vicious trap. [Selene. The ceiling here is quite high. Using your shield as a ramp, lets make the ball jump over us.] (Youya) [We can do that!?] (Selene) [If you dont want to, well just die here.] (Youya) The metal ball was rolling closer and closer as Selene made her resolve. Her eyes changed as she held the shield at an angle from the ground and activated her spikes, turning her body so that her shield was on her back to use her entire body as the support. If were lucky, the ball would bounce over our heads using the shield as a ramp. The ground began to rumble as the ball was quickly approaching us. [Fortress!] (Selene) Activating her skill, a blue wall permeated from the shield at a similar angle as the shield. The wall and the ball collided as Selene grit her teeth trying to endure the weight of the ball. Then, using the wall as a ramp, the metal ball flew over our heads, rolling further down the path and activating the traps in the corridor. The two children embraced each other with their face pale with fear. The ball was pierced by spears, shot with arrows, bathed in oil, burnt in fire, caught by undead protruding from the wall, shot with poisonous substances, struck by a gigantic hammer and stabbed by an electric fence before breaking down miserably after colliding against the corridor. [Isnt that funny? If you continued to run then you would had turned into that.] (Youya) It was had been too difficult to avoid every single trap, so I decided to let Selene activate that trap, having the trap be our dummy for any subsequent traps. [Youya. Luna definitely doesnt want to return to this dungeon again.] (Luna) [Just how vicious can this dungeon be! We would had been dead a hundred times over!] (Til) [As a reward for surviving, there is a chest for us. Lets go.] (Youya) I smiled bitterly as I put my hand out to Selene. [That was a good performance. Thanks to you we can rest easy.] (Youya) [Eehh.? I thought that we were seriously dead this time around.] (Selene) Selene had an awkward smile as she grabbed my hand and stood up. I wonder if she was seriously frightened by that, Ill have to remember to take care of her afterwards. . . . Thanks to the metal ball activating every trap in the pathway, we managed to arrive at our destination with ease. Although we had essentially destroyed every subsequent trap, Luna had already been able to experience the traps we encountered earlier. [Now. Its time for the last trial.] (Youya) A stone statue of a sphinx appeared at the end of the hallway. I heaved a sigh of relief as the sphinx wouldnt appear unless the treasures behind it was already taken. The fact that it is present means that no one has arrived here before we did. The eyes of the sphinx began to glow as a voice appeared in our heads. [Those who have courage and wisdom. Well done coming this far. Now is time for the final trial. Everyone come before me.] (Sphinx) An altar appeared in front of the sphinx. [Lets go. The trial wont start without all of us.] (Youya) [Hey, Youya-nissan. What happens if we fail?] (Til) [Well be thrown to the basement head first onto the first floor. Although you can rest assured that we wouldnt be in danger as there will be a layer of sand to cushion our fall. Although I had said so, Til looked even more worried than before. Rather than starting over form zero, well actually have to advance an additional floor. [Tell me, adventurers. The name of the emperor which rules over the Golden Pyramid. The name of the forgotten king.] (Sphinx) Luna,Til and Selene froze as they were unsure of the answer. [Senedo. This pyramid is the grave of the Sun King Senedo.] (Youya) [Magnificent. Well done on solving the mystery. This pyramid is the grave of the Sun King Seneo, built to signify his presence in the world. So long as there are people who recognise his name, the Sun King Senedo will never disappear. As our thanks, we give you our blessings and treasures.] (Sphinx) The Sphinx dissolved into sand as the treasure warehouse behind him was revealed. [Youya-ojisan, how did you know the answer?] (Selene) [Ive came here before. At that time, I failed the trial and was thrown into the basement. After I was thrown into the basement, there were countless traps and monsters, however the monsters were behaving strangely, and so were the placements of the trap. As if they were trying to dissuade me from something. After defeating all of the monsters and disabling the traps, there would be a mural on the wall about the Sun King Senedo ruling over an army of monsters.] (Youya) What troubled me about the trial was that there isnt a pathway to the basement from the first floor. However, once you are thrown to the basement after failing the trial of the Sphinx, the path will open up for you to exit the place. The hint to the mystery was the fact that the monsters were behaving in an obvious manner, as if they were protecting something from the intruders. It felt extremely cruel to have to defeat all of them to obtain the hint. I had even thought about returning to the basement to give them a proper burial. Hence, the only way to solve the mystery was to follow your instincts in that abnormal situation and force your way through the monsters. [The malice overflowing from the dungeon was so strong that I wouldnt had been able to solve the mystery.] (Selene) [Well. Thats why if you arent skirmishing with other adventurers for the monsters, this place would be quite a valuable location.] (Youya) We entered the hidden room containing a treasure box and a necklace. The treasure box was a chest that contained rare items, making it easier to obtain than usual. Then, in the necklace was emitting magical power while containing a hole large enough to fit a jewel. The necklace was my target as it was the item that allowed us to have a five-man party. [Everyone, its the treasure. There is also a Magical Vortex. Once we obtain the items, we can return to the town and enjoy their alcohol along with their food! Then, its to the hot springs!] (Youya) [Hooray!] (Luna) [I want to drink a cold cup of juice!] (Til) [I cant wait to wash myself up at the inn.] (Selene) [Im looking forward to entering the hot springs after such a long time.] (Phil) Now then, lets hurry up and return back to the inn. I cant wait to drink a nice cold mug of ale that will definitely taste like heaven tonight. Volume 3 Chapter 11 Somehow, we managed to conquer the Golden Pyramid. After solving the mystery of the pyramid, we entered the treasury which was being protected by the Sphinx. The first time I attempted to solve the mystery, I had answered incorrectly and got thrown down into the basement. [Youya, treasure~~] (Luna) [This. Is the most amazing treasure chest in the world isnt it?] (Til) Although they were completely exhausted with hollow eyes earlier, the two children, Til and Luna who were dragging their feet lifelessly had become energetic again. [Ah. Its a treasure chest with a higher ratio of rare items as compared to a normal chest. It will always be here in the Golden Pyramid and it respawns here every week. Well, more importantly, lets retrieve the necklace.] (Youya) The necklace was a necessity to increasing our partys limit to five. From the beginning, I had always hoped that we would be having a five-men party as the experience values gained from hunting monsters would always increase by 1.1times depending on how many additional party members there are. Furthermore there are also recovery spells and enchantment spells which only benefit the whole party. There is a variety of other benefits but essentially a five-men party would be much more efficient. Within Flaregard, there was also a boss monster which I would like to challenge and in order to defeat it, itll be easier to be familiar working as a five-men party. Regardless, well be the underdogs in the contest for the boss monster as we will have to get past the obstruction of other adventurers plus be the first to arrive at the boss room. I grabbed the necklace with a rusty chain and an impression large enough to fit a jewel. I took out the Thread of Bond from my bag which we obtained from the Minotaur and brought it close to the chain. The silver thread began glowing as it wrapped itself around the rusty chain, turning the chain silver with a beautiful silver shimmer. Then, the light concentrated itself into the impression as a blue jewel with a unique emblem appeared in the impression. After confirming the item was completed, I equipped the necklace. [Everyone, leave your current party at once.] (Youya) The girls nodded as our current 2 men and 3 men parties were cancelled. Then, I invited everyone to my party. [Uhn! Were finally a party with five people!] (Luna) [With this we have the best possible party members!] (Til) [It feels like we can do anything with this party.] (Selene) [Once again everyone, please take care of me from now on.] (Phil) [Speaking of which, I forgot something important. We have to think about our party name from now on. Itll be much more convenient for us to accept quests as well as for nominated quests to reach us if we had one.] (Youya) To a certain extent, nominated quests can only be issued once we have a party name. As for the clients of the quests, they would only arrange a nominated quest for urgent matters or quests with an extremely high difficulty for a trustworthy party rather than wait for a random adventurer to accept it. Nominated quests often had extremely high nomination costs and it was even more attractive as there arent any competition for the quest. The one quest I had accepted was a quest asking me to head over to Selenes kingdom, the Laluzulu Kingdom. Aside from these there are other convenient reasons to have a party name. [Youya-niisan. Were in trouble if you were to suddenly ask us that. We wont be able to decide that in this situation.] (Til) [Uhn! Its our precious party name. Its something we should decide properly.] (Luna) Luna and Til were unexpectedly giving mature responses. [About that. What was Youya-ojisama old party name?] (Selene) I hurriedly closed Selenes mouth with my hands [Muguu.muguu?] (Selene) With a red face, Selene continued to struggle. [Uh. About that, when we are deciding on our partys name, be sure not to come up with a strange name. Its better to avoid any strange impressions with our name.] (Youya) It was a mistake in my youth. Back when it was just Leonard and Phil, I came up with a strange name while we were drinking. It is a name that I absolutely do not want to tell the girls. [Waaaa. Uwahh. I understand so please release me Youya-ojisama.] (Selene) [If you understand then thats fine.] (Youya) Because of this, I recalled the name of my previous party. [Have you decided on a name for the Magic Pet? Once we enter the hot springs, the monster is ready to be born.] (Youya) [Uhn. Perfectly!] (Luna) [Everyone has thought about it properly!] (Til) [Yes. We have a nice name prepared. Its a cute name, and it is appropriate regardless of its gender.] (Selene) Looks like I was just worrying excessively. Once we return, well go ahead and enjoy the hot springs. [In that case, lets hurry up and return. Luna, its up to you.] (Youya) [Leave it to Luna.] (Luna) Luna began unlocking the treasure box. It was Lunas job to open any chest we come across as thieves had a special skill, Lockpicking which allows them to disable any traps that may activate after opening the chest. This was important as there is a slight possibility of having the contents of the box damaged from the trap. Furthermore, this wasnt just a normal treasure box, but a rare treasure box. Im excited to find out what is inside the box. Luna managed to unlock the chest safely as she opened the chest. [What is this?] (Luna) Luna held a cool-looking bell in her hand. [Hou. That is a pretty nice item. Its a Repel Bell. Once you shake the bell, it makes it difficult for monsters to approach us whenever we are exhausted, making it pretty useful.] (Youya) (Note: I dont know any appropriate names for the item so If anyone dislikes it then offer a suggestion to me! ħ) [Hurray! Treasure!] (Til) Its a convenient item and a well-sought after item by merchants who travel from town to town. Im going to place it in my bag, however I will definitely be selling it afterwards. For materials transaction, it would be better to pay a commission fee and leave the sales to the guild, however it would be better to sell this item directly as it was an extremely expensive item. Luna and Til have not experienced attending an auction yet, it may be a good experience to bring them to the auction. Even as a buyer, participating in an auction is an unique experience. [Now then, lets return to the city. Cold ale and hot springs are waiting for us there.] (Youya) [Uhn!] (Luna) [Cold drinks!] (Til) We obtained a bunch of rare items, however everyone is already exhausted. Lets return soon. . . . After exiting the dungeon using the magical vortex in the treasury, since they couldnt tolerate their dirty bodies more than their hunger, the girls decided to head for the hot springs rather than the inn. We headed towards the hot spring recommended by the guild as the natural hot springs in Flaregard were a huge success, becoming one of their main specialties. [Dear customers, females please head to the left while males head towards the right.] (Receptionist) WIth this, its farewell. There are other hot springs in the town that had mixed bathing, and I wished to enjoy the springs with the girls, however I couldnt tolerate the idea of exposing the girls skins to other guys, so I chose a normal public bathhouse. [No way. Luna wants to be with Youya.] (Luna) Luna inflated her cheeks as she clung to my arm. [Luna, dont place too much burden on the clerk lady. Have a little patience.] (Youya) [Thats right you know. If you were to follow Youya-niisan, youll be exposing yourself to other people.] (Til) [So long as its with Youya, then its fine.] (Luna) As usual, I didnt feel uncomfortable with this, however it is a little troubling. What should we do [Dear customers. If that is the case, then you could use our private bathhouse service for families with a seperate bath from the general bath. However, it will be much more expensive. Youll be able to enjoy it with your party members if you wish to, and if five people were to use it then there will be plenty of space. Since it is a private bath, you will also be able to relax much more freely.] (Receptionist) For a moment, the receptionists eyes scanned over our equipment, especially at me and Phil. She was probably seizing the opportunity to advertise their expensive private bath towards an adventurer who looked wealthy based on their equipment. She was quite experienced at doing business as Lunas eyes began shining. [Youya, now we can be together!] (Luna) [Aside from Luna and Phil, what about Til and Selene?] (Youya) In the oasis, we were in our underwear, however it does feel like going in the bath nude together is a little too far. Til and Selene were also in a bind. [Dear customers. We are also selling and renting swimsuits for adventurers! Since adventurers and other people often host parties using the hot springs, there is also a high demand for swimsuits here! We have prepared several swimsuits for our dear customers to try out!] (Receptionist) The receptionist took out several swimsuits of various designs and sizes and placed them on the table. I cant believe she was prepared to this extent. Although we will have the increased price for a private bath and the swimsuits, it was a tempting offer to be able to enjoy the hot springs together with everyone. Above all, it could be much safer for us to hide the fact that we were preparing to hatch our Magic Egg. [Youya-niisan, its no problem if we have a swimsuit on! Be sure not to be entranced by the cute me.] (Til) [Im okay with it too. Since its Youya-ojisama, then it should be fine.] (Selene) (Note: I dont know if its my mistake or the authors, but Selene sometimes interchanges between sama and san. Ill stick with sama from this point on since it feels more fitting.) [Itll be more enjoyable if we are all together.] (Phil) Everyone aside from Luna also agreed with the idea. [In that case, lets do it. Ill head over to the bath first. You girls take your time and choose a swimsuit. If you like any of their swimsuits then you can go ahead and buy them. Itll be convenient for us to have a set whenever we head to a water dungeon.] (Youya) Since Im not really interested in the men swimsuit, Ill just pick a comfortable pair of swimming trunks and head directly to the bath. Meanwhile, the girls were taken to a seperate location to choose their swimsuits. Im looking forward to seeing what swimsuits they pick. . . . The private bath for families were surprisingly spacious. Our bathtub was an outdoor bath surrounded by trees and is made of stones, capable of fitting up to 10 people. The bath also gave off a warm atmosphere which felt nice to relax in. Furthermore, it had a peculiar smell which was evidence of the natural ingredients present in the water. The spring is also warmed by the Sacred Flame, providing a magical effect to the water. [It feels selfish of me to enjoy the springs first, but Ill be entering now.] (Youya) At this rate I will catch a cold. I began washing myself with hot water before entering the bathtub, enjoying the hot water as it released the fatigue built up in my muscles. Every year as I grow older, I find myself enjoying hot springs much more than before. Then, the thing Ive been waiting for finally arrived. A tray flowed into the tub with a mug filled with fruit wine. A unique feature of this bathhouse was that we could enjoy cold drinks while relaxing in the hot spring. I stretched my body, loosening the muscles in my body. After returning from the desert, entering a hot spring with nice cool liquor is the best way to enjoy oneself. [Delicious!] (Youya) Just as I was wondering how long it would take the girls to catch up, I began hearing footsteps. [Sorry for the wait Youya!] (Luna) [How is it? Cute isnt it.] (Til) The first two people to appear were the two children. Luna who was wearing a childish swimsuit which wrapped around her whole body while Til was wearing a bikini inappropriate for her age. However it was quite easy to tell that she was much larger than Phil. Wait what am I thinking about a fourteen year-old girl. [Youya-ojisama.. Your eyes are all over Til. I wondered if I should had experimented more.] (Selene) [Please stop there. Comparing yourself with another person is a pitiful act.] (Phil) Selene and Phil finally arrived. The two of them were wearing a one piece swimsuit. Their chests werent very large, however their styles were good. Although Phil had went with a slightly adventurous outfit as her swimsuit had exposed a little in the middle of her body. [I think that everyone has their own charms. Ladies, hurry up and enter the hot spring, it feels great.] (Youya) [Youya, I saw your nose flaring up when you were looking at Til. As expected, guys prefer big breasts after all.] (Youya) Phils smile was a little terrifying. That was how men are. Everyone began entering the hot springs after lightly washing themselves with hot water. [Youya!] (Luna) Luna immediately swam towards me, slipping her small body between my legs and leaned backwards onto my body. Since she was wearing a swimsuit, the sensation of her skin was transmitted much more than usual. It was a cute gesture as I hugged her from behind. It felt comfortable to embrace Luna. Phil approached me too as she sat next to me, leaning onto my shoulder. Not just my body, but my mind felt relaxed as well. [Hot springs feel great~] (Luna) [This is a nice thing isnt it.] (Til) It looks like Luna and Til were both enjoying their first experience in a hot spring. Trays began flowing in one after another as the girls sent their orders and enjoyed their drinks. [Entering the bath and enjoying a nice cool cup of sake is something I would never be able to do in the castle.] (Selene) [Does it feel nice?] (Youya) [Yes. I like it very much.] (Selene) [Youya. Its about time for todays main event!] (Luna0 Luna exits the bathroom and headed towards the changing room. Then, she returned with a gigantic egg. One of the main goals of the hot springs was to relax, however it was also to hatch our Magic Egg. Magic Eggs hatched by absorbing magical power from their surroundings. Luna entered the hot springs while holding the egg. Then, everyone continued to observe the state of the egg. Once I felt my body begin to overheat, I exited the bath to enjoy the cool air before returning to the bath and continuing to look at the egg. Times like this I am extremely grateful to the bathhouse for preparing a chair to cool your body. Since it is hard to notice any sudden changes when it is in the bath, we had to attend to the egg while it is submerged in the egg. Otherwise, the monster born might immediately drown right after being born. [The egg has started to move!] (Phil) Phil voice echoed through the room as it was her turn to look after the egg. Everyone began heading towards the bath. The egg at the bottom of the bathtub began bouncing back and forth until the shell cracked. Phil carried the egg out of the bathtub and placed it on the ground. [Everyone, its about to be born.] (Youya) After saying so, I heard the sound of someone gasping as the egg broke. What came out was.. [Youya. Its cute.] (Luna) [Uwaa. Its so fluffy.] (Til) [Is this child a dragon?] (Selene) It was a small dragon with fluffy light blue hairs around its body. It flew around with its small blue wings and landed on the top of Lunas head. [KUII.KUI!] Then, it screamed out in joy. [Hou. Its a Faerie Dragon.. That is an excellent pet for us.] (Youya) Dragons were a powerful species of monsters. Faerie Dragons were small but they arent exempted from that fact. I was surprised that we managed to get a Faerie Dragon with a single try. It was probably because of the girls mana and hearts that we managed to get a Faerie Dragon. Lets be sure to have this guy play an active part in our next adventure. Having a Magic Pet increases the efficiency of our hunts. [This child is so fluffy`.] (Luna) [Its so cute right.] (Til) [Its friendly too. Its large red eyes are captivating as well.] (Selene) Luna, Til and Selene were pretty much in love with the Faerie Dragon. [Luna-chan, Til, Selene-chan. Everyone please call it with the name that you decided on.] (Phil) Following Phils instructions, the girls nodded and called out the name together. Then, the Faerie Dragon cried out happily as if it liked its name. Volume 3 Chapter 12 Our Magic Pet, a Faerie Dragon was safely born in a hot spring at Flaregard. It was a species of dragon wrapped in fluffy light blue furs and red eyes which could only grow to the size of a kitten at best. Although it was a small dragon, it wasnt specialized in direct combat, but rather in supportive abilities. [Look, Youya! Erik is enjoying the hot springs too!] (Luna) [Kyu!] (Erik) The name given to the Faerie Dragon was Erik. Apparently Selene suggest the name while Luna and Til had agreed to it as the name actually meant my child. More precisely, it was the name of the magician who travelled with a hero in a fairy tale who viewed the hero, Youya as his father. Since Selene is a princess, there was such a story in her culture. [Look at him Youya-nissan. Isnt Erik cute?] (Til) [Yeah. I could look at him all day.] (Selene) [Please let me feed him later.] (Phil) Everyone was going crazy about Erik. As expected, girls were the type of people who preferred cute things. [Everyone, be sure to look after him properly. Faerie Dragons are monsters valued at a ridiculously high price on the market. Itll likely be the target of other people in the future.] (Youya) [No way. Luna absolutely will not let him go.] (Luna) [Kyu!?] (Erik) Luna grabbed Erik and hugged it tightly on her chest. Magic Pets werent obedient to anyone besides its owner, thus it would never be useful in any way whenever it was robbed from the original owner. However, Faerie Dragons were known to be extremely beautiful and rumored to bring fortune wherever it goes, causing many nobles to pay ridiculously high prices just to obtain the legendary dragon. This was the reason why the Magic Egg is so highly sought after, the possibility of obtaining a Faerie Dragon. [Looking at how it behaves, it seems to be most familiar with Luna. Thus Luna will be taking care of it. It looks like it is familiar with Til as well so Til will be helping Luna with its care. How about it?] (Youya) [Lets do it! Luna will raise Erik well!] (Luna) [Leave it to me. Luna, lets turn this child into a splendid dragon!] (Til) Allowing them to have a small pet is excellent to cultivate the girls aesthetics perception so lets leave Erik to Luna and Til. Afterwards, we continued to spend our remaining time enjoying the hot springs and cold alcoholic drinks along with Erik. When our time had ended, we had completely taken in the blissful sensation of the hot springs. Now then, lets keep this atmosphere alive with a feast since we managed to complete a difficult quest earlier today. . . . After opening my eyes, I could spot the figure of Til and Luna sleeping soundly while tightly hugging Erik in their bed which felt extremely comforting. Without waking the two of them, I quickly changed my clothes and went out of the room with Selene. It was fine for the two of them to continue sleeping as we werent going to the dungeon today. Although most of our physical fatigue has healed from our trip to the hot springs, aside from Phil everyone had suffered extreme mental and emotional fatigue from our extended adventure. Even if we were to push ourselves and head to another dungeon, their concentration would be weak and itll just be needlessly exposing ourselves to danger. [I feel bad for Luna, since itll just be the two of us.] (Selene) [There isnt really a need to feel sorry about it. Its for the sake of the party.] (Youya) I was going out with Selene alone so as to search for a blacksmith capable of creating a suitable equipment for her. Selene had a unique fighting style which utilized Renoirs shield on her dominant hand while having a gauntlet on the other. Furthermore, powerful gauntlets usually had the special effect of raising the users magical power. Since Selene served both as our tank and our healer, having a gauntlet which raises her magical power was extremely important. Although such gauntlets werent available commercially and had to be specially crafted. For that purpose, we already had some of the most effective materials. The highest grade of magic metals, Orichalcum from the Minotaur and the Ruby Crystal from the Terrafish Larvae which will allow us to create an extremely high ranked equipment. However, making such a equipment required the necessary level of expertise and smithing equipment as well. In Flaregard, there is the flame which has never faded since the birth of the world and the craftsmen who learnt to harness that flame. This will definitely let us create the strongest equipment. [Selene, dont leave my side. There are many people in this city and the human traffic is high. WIth their complex roads and high number of people, itll be easy to get lost, making it difficult to find our way back.] (Youya) [Yes. Ill be careful.] (Selene) Selene was struggling to squeeze past the crowd as I saw her hand moving towards mine before stopping. [Lets hold hands. That way we wont be separated easily.] (Youya) [Okay. Ill take your word and indulge myself.] (Selene) Selene grabbed onto my hands in embarrassment. Unlike Lunas warm hands, Selene hands felt refreshingly cool. Due to her training with a sword, the skin on her hands were thick, however these were the kind of hands which I liked. Selene seemed embarrassed to hold hands as she hid her face and her ears went red. Just like this, we continued through the commercial district and headed to the outskirts which had lesser traffic. [Were here. Its a shop Im familiar with. The dragon leather armour that I use was also made by the old man here.] (Youya) We entered an extremely old-looking stone building. It was located in the outskirts with barely any people around. However, the old man that stayed in this building mentioned that it was more comfortable for him as he could concentrate on his work and was already capable of obtaining enough customers to get by. He was able to get business in such a remote area as many customers were recommended to his shop due to his reputation as a craftsmen. [Leave! Ill only make something when I feel like it!] (???) The moment we entered the store, we were suddenly subjected to verbal abuse. He hasnt changed a bit. [Old-man. Its been a long time. Why dont you show a face befitting of that loud voice of yours.] (Youya) After speaking out, the old man turned around, opening his eyes wide open. It was a small dwarf with muscles that contrasted with his size. However, his thick muscles fit him extremely well. [OUH! Its Youya!! Its been a while hasnt it!] (Old-man Dwarf) With a hearty smile, the old man replied. [Sorry that I havent shown my face in a while.] (Youya) [What about the armour that I made?] (Old-man Dwarf) [Its the best there is. I cant remember how many times it has saved my life.] (Youya) Having dragon leather as the main material for my armour was nice, however it became even better thanks to this mans confidence in his skills. The number of times I had survived ambushes and battles with my low status was due to this armour. If I had an ordinary armour, I would had long been in the ground. [So what do you want me to make this time? You arent the kind of person who would come without a goal in mind, Ill make any equipment if its you! Until now, you are still the best adventurer I have ever come across. Master of weapons. As deadly as you are, yet you choose the most appropriate weapon, utilizing everything to its maximum potential till even my weapons long for you. I sincerely hope that you are here for this hammer of mine.] (Old-man Dwarf) My ties with this person runs deep. We had a certain incident in the past, however it has long since past. [I didnt come here today for me, but to make my companion a piece of equipment.] (Youya) [Huh? If it isnt for you, then its for this girl? I dont recognise her face.] (Old-man Dwarf) [Her names Selene. Shes a member of my new party.] (Youya) I pushed Selene from the back towards the old man as he seems to be scanning every part of her body. However, it wasnt a look with any ill-intent. Rather, he was evaluating her. [Hmm.. Well she is definitely a warrior. No half-hearted person would be able to have this kind of body. However, this isnt enough for me to entrust her my work.] (Old-man Dwarf) [Then would my words suffice? She is my disciple. And I brought her here as I thought she was worthy of your work.] (Youya) I declared so as I knew the old man extremely well. I brought Selene here knowing fully well that he was someone who chose his customers. [I do not doubt you. However, I cant decide just based on my eyes. Youya, fight this girl. Ill judge based on the battle.] (Old-man Dwarf) [I understand. Thats the case, so will you accept the fight Selene?] (Youya) Selene who was suddenly dragged into the conversation nodded firmly despite her embarrassment. [I understand. Then Ill show you my skills. Then, you can make a decision based on that.] (Selene) For an instant, the corners of the old-mans lips rose. If she had declined the request, she would had immediately been disqualified. He was a man who valued a persons skill, but more than that, the persons heart more than anything. With this, she has passed the first test. . . . In the courtyard of the old-mans store, me and Selene were currently having a meeting. We were going to begin a simulated battle similar to the battle we had everyday. I did not plan to hold back from the start. In order for Selene to truly blossom, I cant do such a thing. Without doing so, I wouldnt be able to let her shine in the spotlight. As a warrior, the only time Selene can shine is in the heat of battle. [Selene, are you nervous? It looks like your movement is slower than usual.] (Youya) [I cant deny that. However Ill do my best!] (Selene) Selene had thrown a harsh attack, attempting to make an opening using her shield. She has grown ever since we had first met. If she hadnt grown, I would had ended the fight with my fifth attack. However, it wasnt enough. Selenes defense was slowly crumbling and eventually, her posture had slipped as I slid my sword past her shield. In response, Selene blocked the attack with her gauntlet, however she had focused too much on the blade. All things considered, it was an excellent choice. After neglecting her legs, It gave me the opening to land the next attack. I crouched while extending my feet, sweeping Selenes feet clean off the ground as she fell on her back. Then, my wooden sword was placed next to her neck. [As expected, I couldnt win the battle. However small, the battle has become closer.] (Selene) [Yeah. Youre growing day by day. Pretty soon youll get a win one day.] (Youya) I extended my hand to Selene. [Old-man. How is it? Is she worthy of using your equipment?] (Youya) [Hmm.. If you want my honest thoughts, she is still too young for my works. She is still several steps behind the people Ive committed my weapons to.] (Old-man Dwarf) [I see. It is still impossible then? One day Ill come back once Ive matured. At that time, could you reconsider?] (Selene) It is in this situation where Selenes character surfaces. She doesnt cry in her failures, but take pride in it. [Dont jump to conclusions. I never said that you arent worthy. You are still young, however, above all I pray for everyone to grow as they become accustomed to my works. If Youyas here, I am sure you will become fully capable of using something that I put my heart and soul into. Well I guess thats enough. Ill do it. However, my condition is that you grow into a warrior capable of wielding my equipments. If you can comply with that, Ill make the best weapon you will ever come across.] (Old-man Dwarf) Selene took a deep breath after listening to the old-mans conditions and clenches her fists, nodding with determined eyes. [I will definitely show you. With the best teacher and the best smith trusted by my master. If I cant meet your expectations then I will never forgive myself.] (Selene) That was a powerful declaration. The old-man and I couldnt help but laugh as our eyes met. (Youya) (Old-man Dwarf) Just by exchanging looks, we could briefly communicate our thoughts. [Youya, are there any materials you wish to use?] (Old-man Dwarf) [Ah there is. Its a Ruby Jewel and Orichalcum.] (Youya) [If thats the case then we can start right away. Itll probably be done by tomorrow evening. Ill push my other jobs aside to finish it asap.] (Old-man Dwarf) The old man disappeared into his store. [Great for you Selene. Youll be able to obtain the best weapon in the world.] (Youya) [Yes. Im elated. However Ill have to make sure that my oath will not be broken.] (Selene) Im looking forward to seeing the completed product. Until it respawns, there wont be a boss in the dungeon and well be busy raising our levels. Ill be sure to return by tomorrow evening. Itll definitely be completed by then. Volume 3 Chapter 13 Before departing, I plan to report the completion for the Death Scorpion Poison quest while accepting another quest at the same time. I asked the girls to wait at the in-built tavern in the guild while I headed towards the reception table. Flaregard had a recommended level of 30 for all of its dungeon which meant that all the adventurers who were presented are at least intermediate adventurers and carried themselves differently from those we have encountered so far. Thanks to this, there was a distinctive atmosphere flowing around the guild. I sat in front of the receptionist who guided us to our inn and reported the progress of the Death Scorpion Poison quest. [Youya-san. Welcome back. I was worried about you as I heard that you were heading to the Desert Canal.] (Receptionist) [Well somehow we managed to return and complete the quest safely. Heres the designated number of vials.] (Youya) I took out the vials of poison from my magic bag and passed it over to the receptionist. These vials were extremely sought after as one of the ingredients for producing medium tier and above potions, antidotes and perfumes. The receptionist checked the vials before proceeding with the procedure. [Nice job on collecting this many in such a short period of time. Speaking of which.. Well done on surviving. You wouldnt had been able to collect this many without coming across a swarm of Silent Death Scorpions. Many parties have fallen just to these scorpions alone.] (Receptionist) [Yeah. When we were clearing out several of them, the whole swarm had appeared behind them.] (Youya) [Im sure your party has a very capable Magic Caster who has mastered a powerful magic spell since you managed to survive your encounter.] (Receptionist) In the end, we encountered about three swarms of Death Scorpions before exiting the pyramid. Any party besides us would had most likely perished. Thanks to Lunas Increased Drop Rate, we had already collected enough vials for our quest, and any subsequent vials were stored in our magic bag. By the end, our bags were almost bursting due to the large number of items we obtained. [At the end of the day, what is important is that you came back alive. Heres the reward for completing the quest.] (Receptionist) [Thank you.] (Youya) The reward for the quest was an insane amount as even a single vial of Death Scorpion Poison was expensive, and that price was further raised for the quest. [Excuse me, Youya-san. This is a difficult request, however the demands for potions and antidotes has been constantly on the rise, however everyone refuses to hunt for Silent Death Scorpions for their items. Thanks to this, there is a severe lack of materials.] (Receptionist) [The fight against a swarm of Silent Death Scorpions is a long and punishing one. One mistake and you will likely be slowly eaten alive.] (Youya) Adventurers often avoided such harsh monsters that led to death if even one mistake was made. We were still beings who valued our lives. Even worse, it isnt even a joke to consider hunting monsters who were superior in their covert movement and travel in a swarm. [That is the case. However, there is another urgent quest from another vendor. And as a representative of the guild we cant reject the quest. Aside from the Desert Canal, there is another dungeon where the Silent Death Scorpions spawn. Would you hear me out?] (Receptionist) [I understand. If thats the case, Ill accept the quest.] (Youya) [Thank you for helping us with the pinch!] (Receptionist) The receptionist took out a piece of paper containing the contents of the quest. This quest was more or less identical to the one I had just cleared. However, since it was reported as an urgent quest, the reward was even higher than before. [Hmm.. If this is the amount, then this should be enough.] (Youya) Reaching into my Magic Bag, I took out the required number of vials for the urgent quest. [Eh..?] (Receptionist) The receptionist widened her eyes in shock. [With this, Ive completed the quest.] (Youya) Increased Drop Rate is a really convenient skill to have. Just by raising the skill to the maximum level, items would have more than double their original drop rate, making it easier to obtain rare items and common item collection quests could be easily completed. As monsters often spawned in a fixed number per group, this would mean that we would have no need to hunt for a second group if a single group was enough for a quest. [Uhhh. Thank you very much. Uhm, if you still have any with you.. Ill like to purchase them from you.] (Receptionist) The receptionist began muttering quietly. [In that case, I only have twice the amount required for the quest with me, so Ill sell them.] (Youya) [Only.. twice you say? Then lets settle the payment together with the quest.] (Receptionist) With a pitiful look, the receptionist glanced over at the remaining vials before continuing with the procedures. Most likely, she planned to stockpile the Death Scorpion Poison for any future quests. However, saying that I had only twice the amount was a lie. I had kept another stock of vials so that Ill be able to complete the quest again should another quest pop up. Since there is a high demand for material collection quests, there will definitely be another quest issued for the material while we are staying in the town. It wouldnt be smart of us to sell everything we have for the regular price when we could save them for a quest, obtaining them at a quest price as well as obtaining guild points. [Now then, Ill be heading to another dungeon. Our destination is the Crimson Volcano. Please give me any quest that is available in that dungeon.] (Youya) [If that is your destination, then there are some good quests available. Since the monsters spawned a while ago, they may have already been hunted however, in that dungeon, there is a request for Beef (Average). You can obtain it by defeating the Red Horns.] (Receptionist) Since the Death Scorpion Poison is a somewhat troublesome item to obtain, we managed to help her clear two quests which would be otherwise difficult to clear. This time, she was giving us a somewhat easier quest to clear. Professional relationships revolve around a give-and-take basis, so long as the guild is willing to support me, then I would reciprocate their efforts. In any case, our next goal is to obtain Beef which is easily obtainable from Red Horns. They are also capable of dropping Beef (Excellent) albeit in very rare cases. Just having dishes using Beef (Average) was already delicious, I wonder how delicious if they were made with Beef (Excellent instead? Ive come across several lumps of Beef (Excellent) in the past however I had sold them immediately to nobles and aristocrats who would easily throw their money just to have a taste of the meat. With Lunas Increased Drop Rate, we may even come across it. Since our wallets are sufficient for now, we should enjoy the beef if we come across it. . . . I headed over to the tavern where Luna and the girls were waiting after accepting a quest from the receptionist. This quest provided a pretty decent reward and at this rate, we will most likely become silver-grade adventurers by the time we leave Flaregard. Silver-grade adventurers received discounted prices for the guild services while being able to accept quests which arent available to ordinary adventurers. However, the benefits between a silver-grade and a gold-grade adventurer are worlds apart. [Thanks for waiting everyone. The quest report is completed and our next destination has been decided.] (Youya) [Youya, Luna is excited for the next dungeon.] (Luna) [Anywhere except the dungeon is great. The hot weather is unbearable.] (Til) I smiled bitterly as the two girls immediately drank the remaining juice in their cups. It was a good thing I went to complete the daily report alone today as usual. If Luna was present during the negotiations, she would most likely point out that I had made a mistake in the amount of Death Scorpion Poison I had and may even spill any other secrets we had. [It isnt the desert, however we are heading to a volcano, the Crimson Volcano. The boss room is also located there, however it has most certainly been defeated. Our levelling sessions will also serve as a simulation for the boss battle. Be sure to recognise the terrain and prepare yourselves for the boss as it is also a battle against time.] (Youya) Everyone nodded in response. [Just hearing the name makes me feel hot.] (Til) [The dungeons in Flaregard are all similar in that aspect.] (Phil) This is the city of earth, metal and flames. Greenwood was too comfortable as compared to this. For elves and foxes who are resistant against the cold were weak against the heat. In this situation, lets cast a bait for them. [Are you sure you want to say such a thing? By the time we are level 30, well most likely obtain a rare meat that is incomparable to a Beef (Average) and more delicious beyond your wildest dream. Furthermore, the monster that drops such a meat spawns in the Crimson Volcano.] (Youya) Luna and Til who had their attention somewhere else gave a sharp look towards me. [Luna loves beef and looks forward to the beef more delicious than anything! Shell hunt while having fun!] (Luna) [Youya-niisan. Say that earlier! The crescent moon tonight desires for blood!] (Til) Luna and Til began to display how they plan to handle their prey enthusiastically, as expected of the girls who love rewards. [Youya, since we have Lunas Increased Drop Rate it is highly possible for us to obtain a Beef (Excellent), however should we really eat it when we can sell it for a large sum of money?] (Phil) [Unlike the past, we have plenty of money. We should focus on having fun and enjoying ourselves while we can.] (Youya) Recently, I began to think that way. Aside from just becoming stronger, we should become stronger together while laughing and having fun. [Erik, this will be your first battle. Try your best to support us.] (Luna) [KYU!] The Faerie Dragon hanging from Lunas shoulder responded to Luna with vigor as it seems to have found its favourite spot. Now then, its time for us to depart to the dungeon and prepare us for the boss fight while becoming stronger. Then, lets enjoy ourselves tonight with a feast. Volume 3 epilogue Volume 3 epilogue At last, we have defeated the Corona Dragon. It was a pretty tight battle having to defeat the Corona Dragon without any flame-resistant equipment, and there were several dangerous moments but its great that we managed to defeat it. Battles like this leads to the growth of strength that isnt represented in our status, the power that is battle experience. Life-threatening experience gave the fighters experiences that could never be obtained otherwise. It was possible to become strong by defeating weaker enemies, but as an adventurer your battle instincts would dull when only battling against enemies weaker than you. To be capable of making rational decisions in decisive life threatening situations was easier said than done and all we had to do was to take a step forward and be in those situations. [Unlock. Whats in the box~, What is it~ What is it~.] (Luna) [What is it~, What is it~.] (Til) Luna unlocked the bonus treasure box given as a reward for defeating the boss as Til inspected the contents. The remaining three of us just watched with light hearts as we enjoyed the festive atmosphere. [Its open! This what is this?] (Luna) [What is this, isnt this just a normal item.] (Til) Looking at the item that came out, the two of them tilted their heads as it wasnt a normal item you would normally see. It was definitely a magic item but it wasnt an item for adventurers, but for a person to use at home. For such an important treasure chest, there was no way for a dud to come out. Phils eyes began to shine as she is the one who wanted it the most. [Ehh. Yuuya, the item actually came out.] (Phil) [Yeah. WIth this our travel will become much easier.] (Yuuya) [I had already sold the one I had because I had problems during my journey.] (Phil) Phil had a face of nostalgia as it was a convenient item which helped us greatly outside of battles. Thanks to its convenience during long journeys, the demand for the item was high therefore Phil had no choice but to sell it reluctantly when she was in a financial crisis. [Yuuya, is this a good item?] (Luna) [Yeah, its a seriously good item. Now then, its already been two minutes. The door will be opening in a minute so lets get out asap.] (Yuuya) [Uhn, lets leave immediately!] (Luna) [Lets escape before we get into another battle!] (Til) [Kyuu!] Luna and Til ran towards the blue vortex while Erik followed behind them. [Yuuya-ojisama, what do you plan to do about the Crimson Hounds?] (Selene) [That bunch, wouldnt it be a waste of time to make them our enemies? While hiding ourselves tonight and taking a caravan first thing in the morning towards the city of Grannel near the Laluzulu Kingdom, well escape from the city. Ive already arranged a private room in a restaurant as well as an inn to hide in. Although, they will still continue to monopolize the boss while desperately searching for us inside the dungeon, therefore I will reveal the secret. In the first place, it was something which belonged to every adventurer.] (Yuuya) The timing was just right as the inheritance ceremony was going to begin soon. Since the monsters had just respawned, I wanted to dive right into the dungeon and earn as much experience as possible however our safety comes first. Furthermore, not many caravans were available when travelling to the Laluzulu Kingdom. Although we could make it by the next caravan, we wouldnt have any time should any problem arises which made the next caravan the best time to leave. [Thank you very much, Yuuya-ojisama.] (Selene) [Anything for my cute disciples. Come on, lets go now.] (Yuuya) [Yes, Lets go then.] (Selene) I ran after Selene after the two girls who had gone ahead of us. I hope that everything will go as smoothly as predicted. . . . . After entering the blue vortex, we were transferred outside of the dungeon where we were greeted by an unusual sight. The entire party of the Crimson Hound, including the bosss main party. Looking at their equipment, they had a Warrior, Fighter, a healer and a hunter. [Youre finally back. Ive been waiting for this moment.] (Crimson Hounds Boss) This is unexpected. There were only two blue vortexes in the dungeon, one in the boss room and one in the vicinity of the hidden path. Since it should take at least two hours to travel to the entrance, we had only taken an hour for us to defeat the boss which meant that they shouldnt have made it in time. [Did you use a Return Stone? That may be your good point, being willing to spend unnecessarily.] (Yuuya) Using a Return Stone returned you to the city immediately, although it is a pretty expensive means. Even in my prime I hesitated to use it since it would cost us two full months of earnings to replenish them. Using it in such a situation is frankly commendable. [It was an expensive but necessary expense. Especially when youve stepped all over the name of the Crimson Hounds.] Gosh he irks me. In two more minutes, two more parties will join in on the battle. Meanwhile, the main party has already pulled out their blades which meant that persuasion through words was impossible. Looks like trouble loves me as it stuck to me like glue. Violence was inevitable however if we could hold out til the morning well be able to leave. However, they are misunderstanding this situation. They arent the only ones who are angry. Luna whom I thought of as my daughter, Til who acted as her sister and Selene who was my important disciple. Even my lover Phil. I had always endured this for their safety, however there isnt a need for it anymore. I pulled out the black magic sword from my magic bag. [Shouting bullshit here and there. Barking like a bunch of stray dogs. Are you going to come? Or are you going to stand there like a bunch of lost dogs?] (Yuuya) [Getting all cocky just because you defeated the boss. Ill beat the living hell out of you! Once youre half dead I will play with those girls as you sit there helpless!] With his unkempt face flushed with anger, he swung his blade overhead. [Everyone, dont partake in this. This battle is all mine.] (Yuuya) [Yuuya, but-] (Luna) [Do you think Ill lose to this people? Ill end this right now.] (Yuuya) Just by looking at their sloppy movements, I knew that the girls were capable of defeating them on their own. However, it wouldnt be a battle where they could hold back. In order to neutralize a threat without killing them, it required skills far beyond your opponent. I do not want them to carry the burden of taking another persons life. [First is you.] (Yuuya) The enemys Monk started to chant. Most likely it was a support spell. I threw my sheath towards him, landing directly on his chin causing his brain to shake and knocking him unconscious. [DAMN YOU!] [WELL KILL YOU!] As their healer got knocked out, the remaining members became even more fired up as the hunter fired arrows one after another towards me with a bright red face. I walked towards him as I cut down only the arrows which would hit me. Weak accuracy and weak force. Only one third of his arrows were going to land while having lesser impacts as compared to Phil. If it was Phil she would had been releasing the same number of arrows while performing three other actions simultaneously. As I was walking towards him, their front-line finally arrived as the Fighter arrived first as I expected from his status. In the battle between a fighter and a swordsman, spacing was important as the battle is overwhelmingly advantageous for the fighter if he could move in range to the swordsman. The fighter stamps his feet as it took up an unusual stance, closing the distance quickly with Godspeed. With a speed which looked like teleportation, the Fighter moved into range of me in an instant as he laughs at me thinking that he was within range. However that was naive. Godspeed was a convenient spell however its limitations was the fixed distance it could travel and the stance required to activate it. [Aside from monsters, using it against another adventurer is suicide. Even if you were to disappear from my sight, it doesnt amount to anything if I know where youll be.] (Yuuya) [GUHA.] I placed the handle of my sword at the end point of his rush as the opponent thrust himself right into it, causing the handle to thrust right into his solar plexus. He dropped right down to his knees in agony as he tried to gasp for air. Rushing in right from the start with your skills, what a stupid way of fighting. The boss who was right behind the fighter hesitated as he rushed forward, his face flushed with anger as he laughed thinly and roared in anger. His movements were quick, however his techniques were horrendous. It was just a revolution attack whose only merit was his high stats. Having a poor stance and large wind-up restricts the persons movement and reveals the persons movements three counts in advance. I also felt the activation of a skill. [DOUBLE SLASH!!] As his sword began shining brightly, I jumped backwards as he released two simultaneous slashes cutting through my original position. It was a combat skill which Magic Warriors couldnt learn however it was a skill I disliked despite its potential for inflicting high damage. It was a skill with superior consumption and damage efficiency to my favourite Bash, furthermore it was a skill which attacked simultaneously from the left and right, making it difficult to perceive. However its downside was the slight rigidness which comes before and after its invocation. It was a balanced skill as it was a difficult skill to activate and a difficult one to dodge. However, it was a fatal opening to expose during a close-range battle such as this. He is clearly superior to the previous Fighter, however the amount of experience he had was not enough. After jumping backwards to dodge his attack, I immediately pushed the ground as I landed next to him and swung my blade. The black blade was a blade specialised in single slashes as I swung my wrist and hit the back of his head with the back of my blade. [UGH!?] At last, only the hunter was remaining as the Crimson Hounds boss collapsed forward onto the ground. I turned to face the hunter. [HIIIIIIIIEEEEEE, PLEASE FORGIVE MEEEE.] The hunter ran away, showing the unsightly sight of abandoning his own party mates. Well, it just shows that is all he amounts to. They were merely high-levelled people who had been fighting advantageous battles with their superior equipment. Their skill doesnt even amount closely to their levels. [Yuuya, amazing!] (Luna) [Uhn. You looked extremely cool!] (Til) [I cant help but stare in amazement at your skills oji-sama.] (Selene) [Looks like there wasnt any need for support.] (Phil) The girls began to cheer as I became slightly embarrassed. The boss turned his head over as it looks like I wasnt able to completely rob him of his consciousness due to his higher stats. However he was still incapable of standing properly and was trembling on the spot. [I wont forgive you. Making light of me. ILL KILL YOUUUU. You must have done something. THERE IS NO WAY WE WOULD LOSE TO AN OLD MAN LOWER LEVELLED THAN US!!!] That sentiment was completely wrong. Although I had a lower level than him, I had the bonuses from my level reset, making my status at my current level much higher than his. However even without them I would had beaten him easily with my old status. The reason they lost wasnt due to their status but due to their lack of understanding of their skills. They hadnt polished their own abilities but rather relied on their skills. Now that I think about it, this is the perfect opportunity since he hasnt lost his consciousness. I grabbed his hair and pulled his head up to my face. [Strength isnt just about your status and equipment. If you dont even know that, then let me tell you right now. You are weak. But if you still cant comprehend it then you should know that my patience is waning. You can continue barking all you like but Ive been resisting my urge to kill all of you. If you ever dare to hurt my precious girls, then I wont hesitate even for a second to kill all of you right there and then.] (Yuuya) The eyes of the boss began to turn moist as they begin to tremble. The moment I released my hand, he began to tremble as his eyes refused to turn away from me. However, my timing was bad as right after my warning, the people who were left in the dungeon appeared from the exit. After witnessing the situation, they realised the severity of the situation as they watched the boss who was just threatened trembling on the spot while the rest of the party laid unconscious. Afterwards, no one moved an inch as me and the girls turned our backs to them and walked away. The boss couldnt even let out an order to chase us then. [Yuuya, Luna is Yuuyas precious woman!] (Luna) [I didnt know that I was valued that much. Yuuya-niisan is such a player! Although Im happy about it.] (Til) Luna was clinging onto my left arm while Til was hugging on my right. [Even though I said precious, I meant as my daughter and sister. Its getting hard to walk properly so could you both let go please.] (Yuuya) [Hmph. Dont wanna.] (Luna) [If Luna says so then I wont either.] (Til) Sigh these girls.. [If Luna was your daughter and Til was your sister, then what am I I wonder.] (Selene) [Youre my precious disciple.] (Yuuya) [Then what am I?] (Phil) [Of course you are my precious lover.] (Yuuya) Selene and Phil both smiled at my answers. Although it was a weird situation, in the moment I was definitely happy. [Lets end this conversation here. Lets celebrate with a bang tonight. Its our last dinner in Flaregard. Be sure not to leave any regrets!] (Yuuya) [Uhn. Lets eat all the delicious food.] (Luna) [I wanna eat all the deserts!] (Til) Many things happened however our trip to Flaregard was fruitful as we obtained many things here. Money, good equipment, powerful materials, a Magic Pet, levels and more than anything, battle experience. And now well finally be heading to the Laluzulu Kingdom, Selenes home country. In that country well be dragged into all sorts of troubles however Im sure that we can overcome it. Besides, for me, that place holds a lot of memories for me. There are people I want to meet and things I have to do. After the inheritance ceremony, there will be a battle to decide the strongest knight in the country and once more, Selene will return to the limelight as Princess Lutra. And I will redeem myself as the absolute strongest knight. Volume 4 Chapter 0 prologue Volume 4 prologue At the Crimson Volcano, we defeated one of the three elemental dragons, the dragon of Flames as well as clashed with the members of the Crimson Hounds. I may have shown my superiority over them however it is also possible for a counterattack to occur thus well be leaving Flaregard as soon as possible. Right now I was busy preparing for our departure while Luna and the girls headed to the restaurant we booked beforehand that provided private rooms along plus the store had a good reputation for its services, having no leakage of private information from any customer. Thus, I was currently alone in the guild to report my retaliation against the Crimson Hounds And the rights for everyone to attempt the boss fairly. . . . After entering the guild, I continued the usual pattern of checking the quest board for any quests that could be completed with the items I have on hand before heading to the usual receptionist. Among the quests, there was a collection quest for the Death Scorpion Poison in its natural state. Thankfully I had saved several vials expecting a quest to appear as the demand for potions were high thus the raw materials were equally as valuable. [Yuuya-san, thank you for all your hard work. Firstly, congratulations for defeating the Coronoa Dragon! It is amazing that you managed to defeat the dragon without any flame-resistant equipment!] (Receptionist) [It wasnt just me. It was thanks to my amazing party that we managed to clear the boss room.] (Yuuya) Information had spread fast, too fast even though I hadnt reported my victory against the Crimson Hounds since I was busy packing for our travels. [Yuuya-san is as humble as your are good with words. Also, I managed to set aside an excellent quest for your party.] (Receptionist) I handed the quest document I found on the board as well as the items required for its completion. [This much!? You must have found an excellent hunting ground in the dungeons. The rewards and guild points for this quest is a considerable amount this time. Although you have not collected enough to reach a Silver rating, you will definitely be able to become a silver adventurer by the next quest.] (Receptionist) The ranks for adventurers werent just for show. For silver adventurers, it was possible to enter cities without an admission permit with their rank and even caravans and similar transportation could be used free of charge. This was beneficial for both the city and the entering adventurer as the adventurer would be allowed to enter the dungeons inside the city for their own benefits while the city would benefit from the materials and treasures obtained in the dungeon by the adventurer, improving the citys financial situation. Furthermore, by riding in the caravan the safety of the caravan would be guaranteed. The quest completion process was completed as the receptionist gave me the rewards for the quest. With this amount we should be fine even without the silver rank for a while. [Oh right, There is a quest that was recommended for Yuuya-san. You can celebrate as It has an even greater reward than the Death Scorpion Poison collection quest!] (Receptionist) It was an extremely amateurish move by the receptionist to say so even if it was that high. Of course I would be happy at the opportunity to make even more money, however quests provided by the guild isnt all sunshine and rainbows. The higher the reward meant the higher the risk. With this high of a reward it is unlikely that there wouldnt be the risk of death. Furthermore, I already planned to leave the town tomorrow. [I apologize. I have already made plans to leave the city tomorrow with the caravan.] (Yuuya) [Ug. What should we do. This quest, asking anyone else but Yuuya-san is like telling the other adventurers to die. Im in a bind.] (Receptionist) Even if it was a harsh move to refuse, a difficult situation is still difficult. I badly want to leave with the caravan tomorrow in order to escort Selene back to the Laluzulu Kingdom for her inheritance ceremony without any trouble from the Crimson Hounds. However, it looked like the receptionists behaviour wasnt for show as she seemed to seriously be in trouble. What should I do now..?/ [For now, Ill just listen to the request.] (Yuuya) [Truth is..] (Receptionist) I listened to the receptionists story while holding my chin as I realized that a huge burden was forced onto her. The quest was too confidential to allow any adventurer in the city to perform and too important to neglect. [Why didnt you release the quest on the quest board? Isnt this a matter of life or death for Flaregard.] (Yuuya) I rubbed my head over the seriousness of this request. This was even more important than the confidentiality of the request. [Initially we requested for a famous party to complete the quest. However the party was annihilated by a certain boss monster. Currently we are looking for a replacement candidate and we have only seven days left.] (Receptionist) I didnt expect their situation to be this dire. The quest was a quest I am familiar with as it was one of the events that happened during the game. It was an event quest that could cause Flaregard to crumble if the quest was unsuccessful. Any ordinary adventurer party wouldnt be able to clear the quest as a mid level 40s party was required to clear it. Furthermore it couldnt be cleared by several parties collaborating. It would be tough for Flaregard as the adventurers here were mostly around level 30 to level 35. The Crimson Hounds were capable enough to clear the quest, however due to the circumstances the city couldnt afford to allow a bunch of crooks to complete the quest. That is why the guild had been scrambling to search for adventurers who were capable enough to clear the quest. The moment they received word that we managed to defeat the Koronoa Dragon without any flame resistant equipment, they decided to nominate us who were equally as capable as an adventurer party in the mid level 40s. It was a crisis for Flaregard and I strongly wished to do something for the city. Furthermore there were various merits to completing the quest. Firstly, somewhere near the midpoint of Greenwood and the Laluzulu kingdom, was our destination, a town called Grannel. However for adventurers we would require an admission letter to enter the city which required a process of examinations which would take a day. However, if we were at least Silver-grade, we would be exempted from this. Second, we would be allowed to enter a special dungeon that a normal adventurer wouldnt be able to enter. There are materials there which couldnt be obtained otherwise. The Temple of the Primal Flame was a special quest during the game where the door of the dungeon would only open when the quest was available, and the door would close when a party was attempting the dungeon. Thirdly, the guild would owe me a favor, and having a guild owe me a favor is a huge opportunity. [I understand, I accept the request. However I have several conditions. I want you to lend me a carriage for my raptor to pull. That way I will be able to rendezvous with the caravan in the next city. No matter what I have to join that caravan.] (Yuuya) The caravan would pick up and drop passengers in every city. For this quest, no matter how quickly we cleared it, it would still require two days for us to clear it. However, with Raptor we could catch up with the caravan in the next town by heading over right after the quest. [If that is all, then we could arrange it for you. Speaking of which, please wait a moment Where is that document. Found it! Actually, we were planning to exhibit a double-raptor operated wagon for the guild-sponsored auction next week .Do you wish to buy it?] (Receptionist) The guild regularly purchases the items and materials obtained by adventurers in the city and sells them using their connections to trade unions and other sources. However for larger guilds, they still regularly hold a large auction. It was a largely anticipated event as the items sold there were much cheaper due to the items going straight to their customers. I have also been saved by them several times in the past. [Certainly it would be much more convenient for us to have our own carriage than constantly travelling with a caravan.] (Yuuya) [Thats right. All high level adventurers have their own carriages as their travelling ability was most important.] (Receptionist) The merit of a caravan was the security as well as the leisure of enjoying the ride as passengers. However they travelled extremely slowly since the load was much heavier and the horses would require more rest breaks. Furthermore it was also frequently delayed by large-scale activities. They may not be travelling to the town you wanted to go either. In regards to this, having a horse carriage would allow us to travel multiple times faster since we had a Raptor instead of a horse plus we were able to leave anytime we want. Our party were also considered high-levelled and we would be able to protect ourselves. Currently with a carriage we should be able to travel much more freely than before. [No its okay. I cant wait until the auction next week.] (Yuuya) [You dont have to wait for it. Since its a carriage managed by the guild, we could get it to you right away. With this, what do you think?] (Receptionist) The receptionist showed me the price which was cheap despite the fact that it was a used carriage, at roughly 60% of the market price. However, it wasnt an amount anyone could carry around leisurely. [It is an attractive proposal. Ill make my decision after I take a look at the real thing.] (Yuuya) Since the carriage was a used one, I had no way of knowing what its condition currently is. [Of course. Now then, this way to our warehouse.] (Receptionist) Afterwards, following the receptionists lead we headed towards the guilds warehouse. The guilds warehouse was much larger than a usual warehouse as mountains of goods were constantly being transported in and out of the location. If they had a surplus of magic bags they could make due with a smaller warehouse, however magic bags were expensive which is why they decided to make a larger warehouse. Thus, I carefully inspected the carriage that the receptionist presented to me. It was a good carriage which was spacious enough for five people to idle comfortably. Although as expected it would be too cramped for the five of us to sleep in, so we would have to set up a camp and sleep in our tents at night. I entered the carriage in order to ensure its craftsmanship and decided that it was okay although it looked somewhat shabby, it had been made by excellent craftsmen and was durable. It had also been well maintained. I was also impressed by its design as the weight of the carriage was minimized by removing unnecessary areas while maintaining its durability. [So what do you think Yuuya-san?] (Receptionist) [It is too good and I feel bad for buying it at such a low price.] (Yuuya) [Theres a simple reason for that you know. Its worn out and unlike ordinary carriages, raptor carriages are much plain-looking as even the decorations on the carriage were removed for efficiency. Thus they were only used by adventurers.] (Receptionist) Raptors were stronger and faster than normal horses, however it had a tendency to eat the weaker people and were mostly only obedient to adventurers. People who owned carriages were often the rich who craved recognition and time in the limelight, thus they would avoid this sort of carriages which were much more plain than normal carriages. [I understand. Ill buy it. There is also something I have to report. After defeating the Koronoa dragon, I was ambushed by the Crimson Hounds who were upset and we successfully repelled. Because of that, they are somewhat persistent towards us.] (Yuuya) This was my other purpose for coming to the guild. [About that, you do not have to worry about it. Outside of the dungeon, among the Crimson Hounds, four men including Gardo Kelrose, the leader of the Crimson Hound had attacked Yuuya-sans party. It was also reported that you had done it in self-defense against their party as they had been sexually harassing the girls in your party. Because of that we have already detained Gardo on the premise of assault and sexual assault. Of course, Yuuya-san wouldnt be convicted of any charges.] (Receptionist) Just how did she know that much? I wanted to ask but I fought back the urge. The only explanation that came to my mind was that there was a spy planted into the Crimson Hound by the guild. I intended to file an assault report in the city but this was a pleasant development. [Im glad. I was regretting that fact that I had to resort to attacking once or twice and that I would be punished for doing so. Now I feel much more at ease.] (Yuuya) [Please leave it to us. It is the guilds responsibility to punish lawbreakers and detain them. Another curious matter we had was the matter about how you managed to pull out ahead of them and reach the boss without confronting them first.] (Receptionist) [About that, Ill reveal it on the condition that it is spread to everyone else in the guild. It isnt fair for one party to occupy the boss room.] (Yuuya) Regardless if their boss is detained, the Crimson Hounds wont stop chasing us for the secret. Thus I plan to expose it to the public as it would be difficult for them to secure both the front and back doors with just seven parties. By sharing the information with the guild, it was possible to share the information with effectively the entire population of adventurers and thus, I told the receptionist everything I knew about the hidden path. [I understand now. So its that kind of method. However, are you sure about publishing it in the guild? Having this sort of information could benefit Yuuya-sans party greatly. ] (Receptionist) [I dont mind it. Please do so.] (Yuuya) [I understand now that you do not want to keep the information confidential. In that case, the information will be confirmed by the guild today and well publish them tomorrow. Next, do you need help purchasing a Raptor? There is no use for a carriage if there isnt anything to pull it. There is a ranch dedicated for the guild where you will be able to purchase an excellent raptor.] (Receptionist) [Ah. Then Ill have one. I already have one Raptor so Ill just need a second.] (Yuuya) As expected it would be too much to expect Raptor to pull a carriage with five of us by himself. With this, our business at the guild was completed. Until we left the guild, we were allowed to rent the rooms meant for the guilds guest. With the current situation, it is now possible for us to obtain a high-quality carriage at a low price, secure a safe living quarters while becoming a silver-grade adventurer by the next city. We were also given the opportunity to enter the special dungeon where the Temple of the Primal Flame exists. Over there well be able to obtain a final souvenir before leaving the city. Itll be great news for Luna and the girls who are waiting at the restaurant. Its about time for me to head to the restaurant as Im sure Luna and Til are already completing and crying out their hunger since I hadnt arrived yet. Note: the Primal flame came up previously in the previous volume however I am unsure what I named it back then. Ill be changing it to the Primal Flame instead. Volume 4 Chapter 1 Once my business in the guild was over, I headed towards the restaurant. The moment I entered the room, Luna shook her head as they had been waiting for me before starting dinner. [Even though I asked you guys to start dinner without me.] (Yuuya) [It tastes better when Yuuyas here with us!] (Luna) [Uhn uhn. What she said.] (Til) I felt happy after listening to Luna and TIls words. [Hou. Even though they were shaking back and forth constantly crying Im hungry! for a long while, they behave well in front of you.] (Phil) [Ugh.. This is this and that is that! They are unrelated!] (Luna) [Onee-chan, its mean of you to expose us like that!] (TIl) It was unusual for Phil to be poking fun at them as Til would often tease right back. Meanwhile, Selene was looking at the three of them with a warm smile. I went to my seat and ordered quickly before clearing my throat as I planned to talk about the matters in the guild before our food arrived. [Girls, there are two important matters that Ill have to report. Firstly, I mentioned earlier that we would be taking the caravan tomorrow to leave the town, however, that plan has been canceled.] (Yuuya) [If we arent riding the caravan setting off tomorrow, does that mean that well be waiting for the next caravan to arrive?] (Selene) I shook my head [No, I bought a carriage earlier at the guild. Thanks to the raptor carriage, well be able to leave anytime without relying on the timings of the caravans.] (Yuuya) [Ahh so you bought a raptor carriage. With this well have plenty of freedom when it comes to traveling.] (Phil) Phil who had ridden on a raptor carriage in the past had a pleasant expression as it was essential equipment to have when we become expert adventurers. Most higher leveled adventurers didnt settle for the monsters in dungeons belonging to a single town, but rather memorised the respawning date for specific dungeons and rotating between each dungeon throughout the week. Since every dungeon respawned at different timing, it was much more efficient to travel between towns and hunt in multiple dungeons. [The second matter is related to the carriage. I decided to accept a special quest as it was an important quest which could potentially damage Flaregards economy if left uncompleted. The quest is to retrieve the gem of the Primal Flame. If the gem wasnt retrieved once every decade, the Primal Flame in Flaregard will die out, making it more difficult for adventurers to acquire powerful equipment while damaging Flaregards business. Phil and Selene who understood the situation gasped at the severity of the quest. [If thats the case, then I understand why Yuuya-ojisama decided to accept the quest.] (Selene) The Primal Flame was a flame which hadnt stopped burning since it came into existence. If it were to be extinguished, then magical metals which can only be processed here couldnt be processed. Furthermore, the flame was the reason why the hot springs here had its special properties. Once the flame dies out, Flaregard wouldnt survive for long. Another important reason was only known to me from the game, which was why I couldnt afford to let the flame die out. This was the true reason why this quest was an event quest during the game. [However, the difficulty of this quest is quite steep as the Primal Flame can only be found in a dungeon with a difficulty level of 40. The Temple of the Primal Flame was a dungeon recommended for adventurers level 40 and above and once the door is open, only one party can enter at any point in time. Once entered, well have to retrieve the gem at the very back of the dungeon.] (Yuuya) This was an important condition as we wouldnt be able to enter and complete the quest if there were adventurers unable to complete the quest, getting themselves stuck in the dungeon in the progress. It was also troublesome that there would only be one Primal Flame burning inside the dungeon. If the gem were to fall in the wrong hands, the person might demand a higher reward as compared to the quest since the Primal Flame was Flaregards lifeline. Once the flame dies out, Flaregard would lose a large amount of its income hence only nominated adventurers recognized by the guild are allowed to attempt the dungeon. In this situation, we hadnt accumulated enough achievements to get the guilds recognition, until we defeated the Coronoa Dragon. The receptionist must have vouched for my character while the guild recognized our feat of defeating the boss without any flame resistant equipment. The guild was most likely searching for another party to clear the dungeon since we would most likely fail considering the dungeons difficulty, and if we were to succeed then it would relieve their burden of searching for another party. [Uhn. Its a difficult quest. Well burn them all!] (Luna) [Were close to the level of a first-class adventurer party. We can clear any quest in our way.] (Til) The two young girls displayed their confidence as I let out a slight smile. [Now then, enough of work. We have already depleted all our mana, mental and physical strengths, and items during the boss battles. Lets forget about tomorrow and rest for tonight. Its a celebration! And tomorrow, well challenge the difficult dungeon!] (Yuuya) [Uhn.] (Luna) [Okay.] (Til) [Understood.] (Phil) [Ill do my best.] (Selene) We held up our drinks for a toast as the celebration began. Although I told them to rest easy tonight, that isnt the case for me as Ill have to come up with our measures and tactics for the Temple of the Primal Flame otherwise I wouldnt be able to properly advise the girls tomorrow. Its a difficult quest but the rewards are just as rewarding. Monsters that cant be found anywhere else and items which would be perfect for Luna. This is a perfect chance to get everything I need and I have to seize this opportunity. . . . In the middle of the night, we were inside the guest room within the guild premises to avoid exposing ourselves. Til and Luna were hugging each other in their sleep with a blissful face in contrast to Selene who was sleeping quietly in a composed posture. I couldnt help but smile at the sight of these beautiful girls sleeping peacefully. I began my preparation for our trip to the Temple of the Primal Flame tomorrow as it was a dungeon recommended for adventurers in their upper level 40s. As compared to the level 30 dungeons we were used to, the monsters and cunningness of the monsters will be turned up a notch. This is why I had to come up with safety measures to ensure their safety. [Yuuya, youre putting too much weight on yourself.] (Phil) Phil walked over with a cup of hot tea. [Thats how it is. Im a little afraid to bring those girls to the dungeon tomorrow. Im starting to regret my decision.] (Yuuya) [This is unexpected. I didnt think you were this conscious about tomorrow. Dont worry, Ill be protecting the girls with my full power as well and with the two of us, nothing bad will happen.] (Phil) [Youre right. Im not alone anymore. It was conceited of me to try and do everything alone.] (Yuuya) Phil was currently level 29. Although it was still seven levels below our levels, she is just about to reach level 30. Furthermore, with her level reset bonus, shell be on an equal footing with Luna and the girls. It may be fine for me to be more ambitious from now on. [Thats how it is. The current me is on the same footing with Yuuya, so you can rely on me more.] (Phil) I felt much more at ease as we decided to prepare for tomorrow together. With Phils words and support, I felt like my mind became open as tomorrow will be easier once I took Phil into account. [Its about time for us to head to bed.] (Yuuya) [Yeah, well have to wake up early tomorrow.] (Phil) I felt my anxiety fade away as we kissed lightly while heading to our futon. . . . In the morning, I gave a lecture to Luna, Til and Selene about the monsters, traps and various gimmicks present in the Temple of the Primal Flame. In the meantime I had Phil go and purchase the consumables that we may need during our adventure with an escort from the guild as per their instructions. Then, after we had our lunch we began heading towards the guild as the temple was a special dungeon that is closely guarded by the guild. The receptionist who took good care of us accompanied us and called out to me before we entered the magical door. [Yuuya-san, since this is a special case, heres a gift.] (Receptionist) She handed each of us a Return Stone. [Thank you very much. We appreciate the gift.] (Yuuya) [Yuuya, this is an expensive item!] (Luna) [Thats great. Well be able to eat a nice dinner now!] (Til) Luna and Til were excited as they were innocent and unaware of the receptionists intent whereas Phil had a difficult expressions. She wanted us to return if the prospects of clearing the dungeon were grim. This quest was important enough to warrant the guild to provide something this expensive. [Lets do our best to avoid using her goodwill in this dungeon. Now then, lets head on.] (Yuuya) After thanking the guild officials, we jumped into the magical door. If our adventure goes well, we should clear the dungeon within two days. To describe this dungeon in a single word, its hell. I couldnt clear my anxiety towards this dungeon. Could the girls survive a battle against a foe even stronger than the Coronoa Dragon? . . . Our teleportation was over as we arrived at our destination [Yuuya, its just like the Crimson Volcano!] (Luna) [Ah its really the same before entering the volcano.] (Til) Similar to the Crimson Volcano ,there was a volcano in front of a road and a tunnel passing through the volcano. We began walking towards the tunnel. [However, this time feels unusual. Since the beginning, Yuuya-niisan had never told us anything about the dungeon ahead of time. However this time he told us everything from the monsters to the traps and even the gimmicks.] (Til) [Til, what are you implying?] (Yuuya) [Weve defeated several bosses in a row so we can take this dungeon much more easily?] (Til) [Youre wrong. If I hadnt said anything, then our journey would end in this dungeon. Listen, this dungeon is usually sealed off and everyone is prohibited from entering it. This means that the dungeon is highly populated with monsters. Furthermore this was a dungeon much more difficult than a usual dungeon and with the rule restricted the number of parties to one, we are the only people here. It is important for us to reach the end of the dungeon as efficiently as possible to prevent unnecessary exhaustion.] (Yuuya) Til gulped towards my harsh tone. Honestly, well have no choice but to use the Return Stones if we faced this situation directly. The strategy the guild had in mind was to send us as the advance party into the dungeon, rushing ahead with all our strength and clearing as many monsters as possible before returning with the Return Stones. Then, they would send the second party and the cycle repeats until the dungeon is cleared. This was a strategy to clear the dungeon. However, if we were to avoid that we would have to clear the dungeon with minimal exhaustion and rest in the dungeon overnight before completing the dungeon. And I didnt intend to return recklessly with the Return Stones. If I were to display weakness to the guild, they may replace me with another party instead. Itll be nice if we were the party to clear the dungeon although I highly doubt they would be able to find another party either way. As we entered the dungeon, Luna exclaimed with an excited voice. [Yuuya, its pretty!] (Luna) [Uwah, its a beautiful temple.] (Phil) [Its my first time seeing something like this.] (Selene) [This is the Temple of the Primal Flame.] (Yuuya) The beautiful white temple lit by the magma of the volcano appeared. It was this temple that we had to defeat. [Listen. Every point of mana, every potion and arrow is important. And even more important of all, every monster is powerful in this dungeon. Well push forward at 100% from the get-go. Now then, lets go!] (Yuuya) The girls grinned at my declaration as we began running towards the entrance to hell. Lets aim to clear this with everyone. Volume 4 Chapter 2 We began walking around in the Temple of the Primal Flame as Luna placed her small hand onto the large temple door, pushing it open to be met with a swarm of flame breaths and flaming arrows. We split up into two, dodging to the left and right at a timing impossible to react to. We had preemptively dodged to the side as we already knew about the attack beforehand. [Uwah, Yuuya-niisans warning actually came true.] (Til) [Uhn. Its a good thing that we were prepared.] (Luna) Truth is, the monsters here were set to attack the moment the door opens. Furthermore, the setting of the dungeon prevented any monster from being seen when the door was closed, making it impossible to notice the monsters hiding behind the door before their attack. The only way to dodge the attack was to use Presence Detection or if you knew about the attack beforehand. The moment the rain of flames came to a halt, the five of us jumped out immediately as I counted 12 monsters behind the door. The monsters consisted of two monsters, the Crimson Grim Reaper which wore a shabby cloak and a Fire Spirit. Just as its name implies, it was a spirit made of flames although it doesnt feel like a very fitting monster for a temple. Normally I would rejoice at the high number of enemies however this wasnt a time to celebrate as they had a powerful formation with some of them hiding between chairs and the rest keeping a distance away. Phil and Tils arrows began flying over our frontline as we tried to close the distance and shave down their numbers. Itll be nice to preserve our magic and items by not using them respectively but this battle would be fatal if its prolonged due to our fear of expenditure. [Everyone, dont worry about wasting resources and use your items and mana if you need to! Itll be nice but itll be difficult to beat level 40 monsters without some expenditure!] (Yuuya) I shouted as I plunged right into a wave of flame arrows and flame breaths. If it were simple spells such as these, it can be easily brushed off if we concentrate, however, the problem comes when ranged attacks with advanced spells are used. The Crimson Grim Reapers were capable of using advanced flame magic suitable for their level as three of them began chanting. [Phil! Til!] (Yuuya) [Leave it to me, Yuuya-niisan.] (Til) [Understood!] (Phil) As per my instructions are given earlier, the two sisters turned their targets towards the Grim Reapers who began their chants as a direct hit from advanced fire magic is fatal to me and Luna. One of the Grim Reapers received three attacks from their arrows however it hadnt faltered. As expected of a level 40 monster. Our situation was dire as there wasnt just one but three Grim Reapers who were chanting as we couldnt approach them due to the rest of the monsters blocking our way. [Yuuya, do that thing when we beat the boss!] (Luna) [Nice idea.] (Yuuya) I turned my back towards the enemy as Luna ran towards me. I placed my hand onto my right knee as Luna stepped on my foot, flying through the air towards the monsters being protected in the back. [Assassinate!] (Luna) Luna twists in the air as Bazerato slides into the Grim Reaper filled with arrows, eliminating it. The Grim Reapers weakness was the magic core at where a persons heart is, causing her critical amplifying to activate. However [It isnt dead!?] (Luna) This is the strength of a level 40 dungeon. The battle was completely one-sided as we had one second left before the spell activates. The Grim Reaper laughs at Luna as its face was broken by a blade, turning into blue particles. [That was a close call.] (Yuuya) [Yuuya amazing!] (Luna) Even for me, it was impossible to get through this group of monsters, thus I threw my blade directly to the monster instead as I had practiced my sword throwing for emergencies. As a proper knight, you might get upset at how rough my blade was being treated, however, I viewed it as an actual means of attack. Of course, I wouldnt do it until it was a last resort as the lack of a weapon was deadly. However, I wasnt barehanded as I took out my spare black magic sword and turned to face the rest of the enemies. . . . Five minutes later, we managed to defeat all the monsters. The Grim Reapers advanced magic was troublesome however the Flame Spirits were also annoying without Phil as they completely invalidated any physical attacks, making it impossible to damage them without Magical Enchantment: Water. [Yuuya, right off the bat were exhausted.] (Phil) [Im also quite tired right now. Normally we would be able to defeat the monsters within several shots however they didnt falter at all.] (Til) [It hasnt even begun as these guys were much easier to deal with as compared to the other monsters. At this level monsters often have a balanced composition with monsters in the front line and monsters meant for the backline. This time we only faced off against monsters who were better suited for the back line.] (Yuuya) Im going to account for a Luna-boost in the future as it was a powerful move we could do since she was light. However, we cant use it willy nilly as it would isolate Luna within the enemys formation. [Being thrown by Yuuya was exciting.] (Luna) [Ah. Thats what I thought too. Yuuya-niisan do that to me next time!] (Til) [What would having our backline thrown to them do..] (Yuuya) As Til typically prioritized her enjoyment, she suggesting something ridiculous as I picked up the items dropped on the floor and my sword while Phil and Til picked up their arrows. Arrows were an important resource right now as we had to preserve our resources as much as possible. [Are the number of arrows sufficient for the two of you right now?] (Yuuya) [So long as we are frugal about them we should be able to make it until the boss battle. Itll be pretty exhausting to constantly use Arrow generation for this.] (Phil) [Ah, weve been using the arrows onee-chan bought in the city, however, our offensive abilities have dropped quite a bit.] (Til) Normally they would have used their skills to produce their custom arrows however we had used up all of their generated arrows in the battle against the Coronoa Dragon. They had tried to generate enough arrows before attempting the dungeon however it wouldnt have been enough so I had Phil head out and purchase some arrows and potions for us. [Well do something about it as long as we can.] (Phil) If we had one more day to prepare we would have enough arrows however time wasnt on our side. I walked towards the center of the temple as a statue of a goddess appeared holding a rose. The transcript in front of the goddess read Fill up the cup with flames and itll illuminate your path.. [Yuuya, what will we do? I dont see any path for us to proceed.] (Luna) [Well, just wait a moment.] (Yuuya) I took out a flint and the oil we used for our campfires from my magic bag as I filled the cup with oil and ignited it with the flint. [The writings say that the goddess would lead the way once the cup was filled with flames. With this, we should be able to proceed.] (Yuuya) After a minute or so, there was the sound of earth shifting as the statue slid aside, revealing the stairs under its original position. This temple was a dungeon that went deeper underground and if the riddle wasnt solved then you would only spend your time wandering around above ground. [Yuuya-niisan, this dungeon leaves a bad taste in the mouth as you would be stuck here if you didnt know about the riddle.] (Til) [Im of the other opinion as I think that this is plenty easy. Having the riddle come out at the beginning of the dungeon meant that you wouldnt have to waste time to return after traveling deeper into the dungeon.] (Yuuya) [Uh. That does sound worse.] (Til) Til made a disgusted face as Selene was deep in thought. [Selene, what are you thinking about?] (Yuuya) [This feels a little suspicious. Why didnt the guild advise us about the solution to the riddle?] (Selene) Selene was sharp as she noticed this sort of details quickly. [Youre right. This is strange since the guild actually wants us to clear the dungeon. If they wanted us to clear the dungeon then they would have actually advised us on how to solve the riddle.] (Yuuya) It was strange. The guild shouldnt want us to spend our time about the mysteries as they even went out of their way to give each of us a Return Stone, they should be advising us on this. [Could it be that the guild knew that if it was Yuuya, that we would be okay?] (Phil) Phil came up with her hypothesis as I came to that sudden realisation. I thought that our party was nominated for this quest as we defeated the Coronoa Dragon. However, it could be that someone with information recommended our party for this quest instead. If you knew that I and Phil were both once top-tier adventurers before our levels were reset, it wouldnt be strange for us to be nominated and even neglect to advise us on the riddles. [Even if that is so, it is meaningless for us to think about this for now. Lets head down.] (Yuuya) No matter how much we theorize, we wont get our answer until we get out of here. This dungeon is a gold mine so lets be sure to make as much money as we can before we get out of here tomorrow. Volume 4 Chapter 3 Eight hours have passed since we went down the hidden staircase. Right now we were at least four levels underground in a labyrinth area. In this labyrinth, there would be a magical exit at the end of the labyrinth however if we were to go down the wrong path, we would reach a dead end and sent to the entrance and start over. And we had just got teleported back to the entrance [Yuuya-niisan, were starting all over again!? Im sick of this.] (Til) [Yuuya, Luna also wants to cry. However, Luna will do her best. Lets go Til, lets take the right path.] (Luna) Looking at the start point we visited numerous times, Til let out a sad voice looking at the forked road ahead of us. She has already been mentally defeated being sent back to this forked road. To make matters worse, every time were sent back to the beginning, the monsters that we defeated on the way will be revived, causing our physical strength and resources to be slowly sapped as time goes on. This would be an ideal farming spot as the number of monsters we could hunt are endless however Ill have to give up on that. Although as expected, even with my knowledge I wont be able to remember the exact path for this labyrinth. Thanks to this, weve returned to the entrance numerous times and forced to fight the same battles over and over but this time it looks like we can finally clear it. [Wait a moment, the two of you. Thats a trap. Although this forked road looks exactly the same as the entrance, it may actually be the exit instead. If we assume that we are at the entrance and head right, well just end up back here eventually. The correct way to go here is the left. Look carefully at the left path. Do you vaguely see the torches illuminating the wall?] (Yuuya) [Theres no way you can notice that!] (Til) Til lashed out as her elven ears turned red. [Yuuya-ojisama, is the person who made this labyrinth a devil or something. His character is way too bad to create this dungeon like this.] (Selene) [I think so too. You cant help but feel like hitting the guy who created this labyrinth.] (Yuuya) As I was despairing returning back to the same location over and over, I barely managed to notice the mechanics of this labyrinth although it took a lot longer than expected. I really felt like killing the person who made this labyrinth. However, it was finally over. Although I had forgotten the details, I remembered that the first and final battles were extremely impactful. Thanks to that I remembered that we would be able to head to the fifth floor by heading to the left road. However, we wont be progressing any further today. [We can stop here for today. Well spend the night here and clear the dungeon by tomorrow. Lets take a break.] (Yuuya) After hearing my words, Selene let out a sigh of relief as the two girls collapsed on the spot. Experiencing an extremely long series of battles on the fourth floor, their fatigue, and mental strength have reached their limits, making it extremely difficult to continue forward. This was a good spot to set up camp as the environments cooling and safe because monsters wont show up. This is one of the three camping spots present in the Temple of the Primal Flame. [Phil, could you please do that?] (Yuuya) [Sure, leave it to me. Ill blow away everyones fatigue. In this kind of situation, having a delicious meal is the best.] (Phil) I took out the magic tent as Phil began preparations for dinner. [Take a look. This is the magic tool we got from the bosss treasure chest.] (Phil) Phil took out a bunch of ingredients as well as a large metal bag from her magic bag. It looked like a metal attache case and a bunch of pans, knives and other kitchen essentials housed within. Once the contents were taken out, Phil pressed a button present on the bag causing the case to deform and form a grill and a water valve. This was a tool that was basically a portable kitchen. Thanks to the power of magic, water could flow out endlessly and the flames could be burnt without fuel, allowing the user to clean all their utensils without any worry. Once Phil began boiling water on the stove, Luna and TIl jumped on the spot. [Yuuya, thats weird! There are water and fire coming out.] (Luna) [With this around, well be able to eat onee-chans delicious food anytime and anywhere!] (Til) [Yes, this is a convenient item as it allows us to cook the meat we obtain from hunting monsters as well as being able to access a fire source or water source at any time.] (Phil) It is a mistake to neglect the importance of water, food, and fuel in dungeons as you would often enter a dungeon for dozens of days, making it important to pack that many days worth of food. However, if you were to go for a long trip you would want to secure space in your inventory for materials obtained in the dungeon. Thus this portable cooking set is a great way to reduce your luggage which was why Phil and I were disappointed when she had sold hers away. [Onee-chan, what will you be cooking today?] (Til) [I intend to use the chicken meat dropped earlier to make pasta.] (Phil) [Phil, is that delicious?] (Luna) [Its very delicious, Luna-chan.] (Phil) The two children began their mysterious dance. I thought that they had reached their physical limits but it turns out that they were fine. Phils cooking skills were great as she placed the dried pasta into the pan, crushed the chicken meat before seasoning it. Then she placed the butter into a frying pan as she peeled off the chicken skin and fried them. It felt quite luxurious for us to be able to boil dry pasta in a dungeon using water. She then placed the chicken into the frying pan and as the chicken was cooked, she put the boiled pasta into the frying pan with fresh cream, eggs, and seasoning before putting it on a plate. Just by looking at it I could understand that it was delicious. All while she was doing this, she had also prepared her homemade soup on the side. [Luna-chan, Til. Could you take out the dishes?] (Phil) [Food, Food!] (Luna) [Food, Food!] (Til) The two children were busy moving around with an atmosphere that didnt feel like we were in a dungeon. As expected of Phil who had a great cooking skill as well as the portable cooking set. . . . It was finally time to eat as herbal tea and chicken pasta with the soup was placed on the table. [Phil, this is delicious!] (Luna) [As expected of onee-chan!] (Til) [This is really very delicious. I cant imagine that this was made with plain ingredients.] (Yuuya) I also let out my opinion as it was really amazing. The taste of the fat of the chicken skin, as well as the spices with the meat, matched perfectly. Furthermore, the pasta was entwined in fresh cream allowing it to slide down the throat easily. [Please eat much as you wish since theres enough for another party.] (Phil) At once, the two children rushed to Phil requesting for seconds as Phil anticipated that, making a large amount of food earlier. Just like this, we were blessed as we were able to eat to our hearts content in the dungeon. Back when I didnt have a magic bag, I could only carry a limited amount of food and their taste was light and bland whereas recently Ive found myself enjoying meals in the dungeon more often. Magic tools such as the magic bag and portable cooking set are just far too valuable not to have. Im glad that these girls didnt have to go through what I went through back then. After the meal, Phil presented the baked meringue with egg white and honey which she didnt use for the chicken pasta. It had a pleasant light texture with tender sweetness as the sweetness spreads throughout my body which was tired from the consecutive battles, releasing my mind from the fatigue. [Phil, it was extremely delicious! Thank you. With this Ill be able to do my best tomorrow!] (Luna) [Uhn uhn. The power of delicious food is really amazing!] (Til) [Luna and Til, you should be very thankful towards Phil as even if the body is forcefully healed with potions, your mind and heart wont be. Thus a good meal is as effective as an expensive potion.] (Yuuya) There have been many parties that I was a part of that neglected this aspect resulting in our demise in important situations. It is also important as I wanted these girls to have an enjoyable time adventuring rather than slug their lives out. Phil began collecting the dishes and placed them into the attache case. This also made it very convenient to clean up as the dishes would be clean once we opened up the case the next time. [Yuuya, youre going overboard with your praises. Is the pace of our exploration going great for now?] (Phil) [Ah, its going according to plan. At this rate, well be able to clear the dungeon by tomorrow. Its great that we managed to clear the labyrinth today as it is an important milestone for this dungeon.] (Yuuya) Our goal was to reach the seventh floor of the dungeon. Since we were currently on the fourth floor, we had already cleared half of the dungeon. However, our consumables were also decreasing rapidly as we just survived a battle of resources in the labyrinth whereas the monsters will just become stronger as we progress deeper into the dungeon. [Its all okay! With Phils delicious food were all energetic!] (Luna) [Uhn uhn. My arrows will show up sharper than ever tomorrow!] (Til) [Til, you look like youre in great condition. Lets start replenishing our arrows using Arrow Generation for now. If we drink potions that naturally increase our mana regeneration, then well be able to regenerate all of our mana by the morning.] (Phil) [Yuuya-ojisan, would you like to tell me more about the monsters and traps well be encountering tomorrow before we go to bed?] (Selene) [KYUU!] (Erik) I was afraid to enter this dungeon as I thought that we werent ready but it seems that everyones mind and body were much stronger than I thought. If they keep this up we may even become a top tier adventurer party within a year. I let out a small laugh as I began the briefing for tomorrow. Itll be much tougher than today but Im sure itll be fine tomorrow. Volume 4 Chapter 4 The next morning, after clearing our campsite we continued to move deeper into the dungeon, clearing the fourth floor within the hour. Currently, we were on the fifth floor which appeared to be a catacomb as we came across several graveyards in a tunnel illuminated by the torches on the wall. [Yuuya, this place smells. Everything smells rotten here. Luna wants to leave now.] (Luna) Since Luna had a keen sense of smell, the smell was much more damaging to her than it was for us. [Clearing this floor shouldnt take too long however well still have to watch for traps here.] (Yuuya) [Yuuya, there are red stains all around the ceiling. It looks like theres a trap ahead.] (Luna) Just as I gave a warning to Luna, we encountered a trap in the dungeon. Even though we hadnt touched the trap, another trap was activated causing a hidden door back at the entrance to open, releasing a wave of zombie-esque monsters made of soil, Ground Ghouls into the tunnel. They had low attacking power and were extremely slow, however just like a horde of zombies they were tough and resilient, making them difficult to deal with in a horde. [Yuuya-ojisama, its impossible for us to fight against that many monsters. Lets escape.] (Selene) [Thats impossible, we wont have enough time to disarm the trap. Other the other hand if we activate it well be wiped out too.] (Yuuya) This was an amazing and at the same time a dangerous combination of traps including the Ground Ghouls. The fact that Presence Detection didnt detect the monsters hidden meant that they were only spawned the moment we activated the trap. Itll be suicide for us to fight that horde head on. Sensing the danger, Erik immediately activated his Blessing of the Dragon. [Phil, Til, dont fire any arrows until I give the signal. Ground Ghouls are highly resistant against physical attacks.] (Yuuya) Their bodies were made of soil causing their bodies to be resistant against physical attacks. Furthermore, monsters made of the earth were resistant against the Lightning attribute. My Napalm strike could be useful here, however that would be too difficult. However, there is something else that I could do right here. [Ice Age!] (Yuuya) As the Ghouls were extremely slow, it gave me enough time to achieve my goal which wasnt inflicting damage but to freeze all of them. [Now!] (Yuuya) Phil and TIl fired their arrows in response as the ghouls who lost their physical resistance after being frozen began crumbling one by one. Meanwhile, I grabbed one of the frozen Ground Ghouls and threw them towards the trap ahead. The flying ghoul was detected by a sensor as a liquid began pouring out from the ceiling, appearing to be acid as the zombie melted after coming in contact with it. Getting surprised by the horde of Ground Ghouls behind, rushing to your death underneath a rain of acid or mustering up the courage to battle the physically resistant monsters whether the trap was noticed or not and dying in battle or melted by the rain after retreating. This was the advanced leveled dungeon displaying its difficulty. [Ive heard of many dangerous traps including acid-types but its even worse looking at it in person.] (Selene) [And itll be even worse if you managed to survive the trap once caught in it.] (Yuuya) Selene and Phil covered their mouths in shock watching the Ground Ghoul melt in front of them. [However, so long as youre observant you can see the way out. There will be instances where you are forced to get caught within a trap and monster combination in the dungeon. So long as you can see it, Im sure there is a way out.] (Yuuya) Knowledge and experience are what defines an adventurers which is why only strong adventurers are able to avoid falling prey to dungeons. With knowledge, you can prevent unnecessary risks and dangers towards you while having experience and ability allows you to overcome situations with your own power. [Looks like we wont have enough time for a break.] (Yuuya) When the acid rain stopped falling, two zombies holding a sword rushed towards us at a high speed. [Its conceited for mere zombies to use a weapon!] (Til) Til fired an arrow towards the Zombie Swordsman however it is not an ordinary zombie as its name implies. It was capable of basic swordsmanship, with a fairly good status and this zombie displayed it as it struck down the arrow Til fired, running towards her. [What kind of monster is this, to strike down my arrow?] (TIl) [Til, let me give you a demonstration. Remember how firing three shots at once was just acrobatics?] (Phil) [Uhn. I asked you to teach me because it looked cool!] (Til) [It is effective though for this kind of opponent.] (Phil) Just as she finished her sentence, Phil fired three arrows towards the zombie as the first arrow gets struck down. However, the remaining two arrows proceeded to penetrate where the throat and heart of the zombie should be as the zombie stops moving. Without missing a beat, she fired another arrow directly into its forehead, defeating it. [For opponents like this, its important to strike their brain, throat, and heart. So long as one of them hits, youll either be able to defeat it outright or restrict their movements for a moment. Then, itll be a matter of taking out its conscientiousness by taking out its brain.] (Phil) [I cant do something like that you know! Its difficult to hit three arrows at the same time let alone aim them at key points!] (Til) [Youll just have to work hard. Its fine since you have much more talent with the bow than I do. For now, even if you dont hit the three points you can focus on firing three arrows at the same time. Now then, the second swordsman is rushing over here, please go ahead.] (Phil) Even while teary-eyed, Til fired three arrows towards the zombie swordsman right on target, however since they werent fired towards the crucial points the zombie swordsman continues moving forward without being paralyzed. [KYUU] Erik jumped from Lunas head, releasing a breath of blue wind towards the zombie. It was an ability called Stun Breath, it was capable of stunning a monster for a moment even if it was a boss. Since it was Eriks skill, it was extremely useful however since we couldnt control its timing it is relatively ineffective but it has great potential. [Thank you, Erik. Yosh, I can do this. This time Ill do it] (Til) Til tried again and managed to land another two arrows onto the zombie as it turned into blue particles. [Uuww. As expected its impossible. But Ill catch up eventually!] (Til) [Yes, Im looking forward to it but training will be difficult for that end.] (Phil) [Although the training is already difficult!?[ (Til) [Well, youll be able to do it when the time comes.] (Phil) It seems that Phil was quite spartan-like in some way. Thanks to that, Tils archery skills were becoming much better. Surely shell overtake Phil in the future. . . . Afterward, the path to the exit was smooth as we arrived on the seventh floor. The seventh floor looked like a gigantic pit filled with magma while a temple was floating on the surface of the magma. As one would expect, the temple at the entrance of the dungeon was merely a display whereas this was the actual Temple of the Primal Flame. [Weve finally arrived. In that temple well find the torch holding the Primal Flame.] (Yuuya) [Hurray! Yuuya, lets hurry up and retrieve the torch and go home!] (Luna) [Uhn uhn. I thought that this was impossible however weve finally achieved our goal.] (Til) We finally arrived at our goal at the cost of all of our resources as weve used up all of our recovery potions. The war against the horde of ghouls earlier was the main culprit as the fifth and sixth floor mainly consisted of riddles and problem-solving gimmicks making the trip here smooth aside. Furthermore what made this dungeon exhausting was battling consecutive battles against powerful monsters while being on the watch for dangerous traps as moving forward in an advanced dungeon ignorantly causes you to suffer the consequences. If we had to challenge another floor before arriving at the temple, I would have backed out without any hesitation. Stone scaffolding floated on the surface towards the temple from the edge of the lake as we walked carefully towards the temple. Of course, one misstep meant it was over. The path was risk-free as we arrived at the temple and I placed my hand on the door. However, I hesitated at that moment without opening the door. The main purpose of the dungeon was to provide trials for the attempting adventurers, testing a different aspect of their personalities. For example, the endless labyrinth on the fourth floor tested the persons wisdom while the fifth floor tested the persons courage. This floors main theme was to test the adventurers strength. After clearing the monsters in this floor, each of them would drop a material needed to create a dagger and combining all of the materials would be sufficient to craft the dagger. This was a special test which could be the easiest or worst test depending on the parties. And there could even be no end to the test depending on what happens. There is no advice or instruction I could give to the girls for this trial. [Yuuya, whats wrong?] (Luna) Luna looked up towards me in concern. [Yuuya-niisan, whats wrong? Are you afraid of the final test or are you relieved that were finally here? Cause Im relieved you know.] (Til) [Could it be that Yuuya-ojisama is worried about us? Dont worry as weve been trained by you personally all this time. Theres no way well be defeated in this trial now that weve come this far.] (Selene) I let out a slight smile as I was worrying too much. Selene was right. There was no way they would lose after being single handed trained by me. Ive made sure to train them and honed their true strength. Furthermore, theyve also put in a lot of effort to keep up with my expectations. [Youre right. Lets go then!] (Yuuya) Believing in their spirits, lets challenge the final trial and finish this! Volume 4 Chapter 5 I opened the door to the Temple of the Primal Flame located at the bottom of the dungeon. Unlike the display at the entrance of the dungeon, there werent any monsters waiting to ambush its door but rather, a mysterious organ began to play as a candlestick in the center of the temple decorated with jewels emitting an ominous red light. [Its beautiful.] (Selene) Selene let out her voice in astonishment at the Primal Flame. That was the item that would allow Flaregards forge to continue running, however, we couldnt immediately retrieve the candlestick early. Reason being, that the last test hasnt begun yet. [Everyone. This is the last test. Dont forget that you wont be able to receive any help for this test.] (Yuuya) [Uhn. We understand. Luna has plenty of training from Yuuya so shell be fine alone.] (Luna) [Uhn uhn. Based on what we heard from Yuuya-niisan theres no way we cant clear the exam.] (TIl) [Thats right. Itll definitely be cleared easily.] (Selene) [Yuuya, Itll be embarrassing if they were the ones to clear before we did.] (Phil) I let out a wry smile as it seems I was too worried. It was time to put my faith in these children. [How reliable. In that case, lets go!] (Yuuya) As we approached the candlestick, the music of the organ became louder and louder as the Primal Flame became stronger and stronger, forming the figure of a goddess as she appeared to smile. [Welcome. Adventurers who have cleared the six trials. The seventh trial shall be the final trial to see if you are worthy of possessing the flames of god.] Just as expected, the previous floors were trials which led up to this moment. [The seventh trial tests your inner will. Now display your strength to your hearts content.] As soon as the goddesss monologue ended, the earth began to rumble as I felt the strange sensation of floating in the air as if we were being transferred. In the next moment, I found myself not within the temple but in a black room as I was all alone. This was a test of the individual will, and whoever that passed would be granted the right to bring the Primal Flame home whereas those that fail would lose their lives. [I cant afford to be the last one to clear the trial. Its about time for me to get ready to clear this.] (Yuuya) I sharpened my senses as I tightened my grip on my blade, staring at the person standing in front of me. He had equipment much similar to mine and even had the same face. He was also holding a sword however he had a complete difference stance from me despite possessing the same status as me. Just as the goddess said, this wasnt a test of the persons strength or status, but rather the experience, tactics and discipline, the persons inner strength. Fighting someone who had the exact same skills and abilities you did. As if you were fighting a perfect AI-controlled character in a game, weeding out any adventurers who relied on their powerful equipment and superior abilities to overwhelm their enemies but doing the same back to them. That wasnt the way I had raised the girls which were why they, as well as I, had faith in their ability to clear the trial. There wasnt any way they would lose to themselves who relied on their skills instead of their own innate abilities. Without any hesitation, tricks up our sleeves or secrets between us, we rushed to each other head-on. As we brought our swords up towards each other, the copy activated a skill which was I was extremely familiar with Bash. However efficient it was, it was an extremely predictable skill as its attack trajectory and timing was telegraphed during its activation. At the end of the day, it was still a beginners skill and wasnt a skill used frequently by the top adventurers aside from situations where it would be guaranteed to land. It was all about reading and countering the attack. Rushing into close-quarter combat, I dodged the attack by taking a step diagonally letting the attack pass right past me, raising my blade up to the copys neckline causing blood to sprout out of his neck like a fountain. The copy immediately rose its blade to attempt a second attack as I stuck my blade to the ground, placing my palm onto its chest. [Napalm Strike.] (Yuuya) Heat erupted in an explosion from my palm as the entire copys entire body blew off into smithereens. [There was zero chance of me losing to my own status.] (Yuuya) Even if they had my own status, I wouldnt lose to my own mirror image as they would have died a hundred times over back in the day. In order to survive, I had to possess skills far greater than my status. The face of my copy distorted as a monster-like lump appeared, turning into blue particles. It was a special monster which could only be found in the Temple of the Primal Flame, Mirror Clayman who was capable of replicating its opponent down to their equipment. It was impossible to use the weapons replicated by them though I did hope that I would get their item drop. However, it didnt drop it as I hoped that one of the other girls would be able to obtain it. Just as I was thinking that my thoughts were disrupted by the strange sensation of teleportation as I was transferred back to the temple. Now then, I wonder if everyone made it safely. . . . Feeling the sensation of teleportation on my skin, it seems that I was the first to appear back into the temple. I sighed a sigh of relief as I managed to maintain my dignity as the teacher of essentially the entire party. Shortly after, I saw a second silhouette as Phil returned to the temple. Although she only took slightly longer than I did to return, her condition was so tattered that I wouldnt call it a clean victory. [Are you okay? I thought that if it was you, then you would clear the trial relatively easily.] (Yuuya) [If I was even half a step slower, Im sure that I would have been dead.. Speaking of which I was surprised. I didnt think that it would start the battle with that technique.] (Phil) [Is that technique something I should know of?] (Yuuya) [Druids arent just capable of granting attributes and supportive magics. There are also lethal techniques that could be used against others and the image tried to use it at the beginning. In hindsight Im glad I got to see it although I myself didnt get to experiment with it.] (Phil) In regards to Druids, I am completely clueless. I have never seen a druid even back in the game era. [If its that strong, then itll be a waste if you dont experiment with it. Theres no meaning in learning a skill you wont use.] (Yuuya) [Thats the point. I may not be able to use it but its just an insurance in the event that it is necessary. What it is though, is still a secret~.] (Phil) The fact that the ability nearly took down a first-class combatant like Phil meant that it had quite a significant impact on the battle. I look forward to the moment when she unveils her ability. While I was pondering about Phils ability, my thoughts were interrupted as it was Selenes turn this time to appear. [As expected of Yuuya-ojisama and Phil-san. You finished your battles even quicker than I did.] (Selene) [Im just glad that you ended up completing the trial safely.] (Yuuya) [Most likely, my battle ended up to be the easiest among our party since Renoirs shield was a special equipment, its functions couldnt be replicated.] (Selene) I was worried that her battle would be the tightest battle among the four of them but it seems that hers was the easiest unexpectedly. [As expected of the shield of the battle princess Renoir. Ill have to become a knight worthy of the shield as soon as possible.] (Selene) Selene strokes her shield as she let out a slight smile. [By the way, did the Mirror Clayman drop any item for both of you?] (Yuuya) [There was none for me.] (Selene) [None for me too.] (Phil) [As I thought. The drop rate is horrible after all.] (Yuuya) Based on probability, theres no helping it but theres still a chance as I waited expectedly for the two girls returns. And finally, the two girls returned almost simultaneously as Luna was slightly quicker, causing Til to be upset. [Yuuya, Luna got a souvenir! Look look!] (Luna) Luna ran up to me holding a lump of clay in her hand. The lump of clay was an item called Physical Clay which retains the same properties of the Mirror Clayman, allowing it to change into anything. That is the reason why it was a special item. By making use of its unique property, you could produce a material allowing you to forge a powerful weapon. However, in order to produce the property that I desire, it has to be processed in a specific location and once we arrive at that city, Ill be sure to do it myself. [Well done Luna. As expected of your Increased Drop Rate, its an amazing ability. Thanks to this Ill be able to forge a powerful dagger especially for you to wield. [I look forward to it! Although I still want to use Bazerato even then, can Luna be a dual wielder?] (Luna) I let out a wry smile as she has taken good care of that dagger, however shes far too obsessed with it. [Dual-wielding has its benefits and disadvantages. One critical con is that it is incompatible with the Assassinate style of attacking that uses a persons full body strength. Besides, the new dagger could be created using Bazerato as its base. Since the dagger will be made using bazerato, itll be the same as bazerato being recreated.] (Yuuya) [That is fine! Bazerato is Lunas treasured item from Yuuya to Luna and Luna wants to use it forever!] (Luna) Lunas tail shakes back and forth as she hugged her own fluffy tail. As usual, Lunas gestures are always adorable. Behind her was Til who was rushing towards us. [Ugg, I cant believe Im last place.] (Til) [Its more important that you won the battle. Its proof that youve become a first-rate adventurer.] (Yuuya) [But I still feel bitter! Next time Ill be the first! Lets leave the temple and restart the trial!] (Til) [Unfortunately, this trial can only be taken once in your entire life.] (Yuuya) Hence why the Mirror Claymans item drop is precious. With a drop rate of 20% there was a chance we would never get it. [Speaking of which, I got an item drop too.] (TIl) [Thats great news. Its possible for the item to turn into a material for something other than a dagger. Since you got the item, is there any specific equipment you want to use it for?] (Yuuya) [In that case, something that improves my attacks!] (TIl) [Ill have to find something that works then.] (Yuuya) Luna and Til began their strange dance as their expectations to their future equipment skyrocketed. Now then, since everyone is back its about time for the main event to start. Just as I thought, the goddess of flame appeared in front of us once again. [Brilliant work. Congratulations on succeeding against all of the trials placed for you. The primal flame shines bright onto your future.] The goddess begins to fade as the candlestick shines brighter and brighter. After picking it up, the candlestick disappears as a blue vortex appears to take its place. [Now then, lets go back. After completing the quest, shall we head to the hot spring one last time? Since were departing tomorrow, it feels fitting for us to enter the hot springs one last time.] (Yuuya) [Lets go! ] (Luna) [That sounds great! I want to soak in the hot springs and drink a refreshing cool glass of juice!] (Til) [On the other hand, I want to perform some maintenance on my armour since this time I had received a large number of attacks. My armour is about to be unusable if it isnt repaired.] (Selene) [In that case, its probably better for you to get a whole new set of armour. Since theres a large variety of rewards possible for us, we could probably get a bunch of first-class armours for ourselves.] (Phil) It has been a difficult battle but its great that everyone was managed to get through safely. Although Im sure that the guild would be surprised that we managed to clear the dungeon in two days, we may even be able to meet the next party of adventurers who were waiting for us to return with the Return Stone. Volume 4 Chapter 6 We managed to get our hands on the Primal Flame from a dungeon that was equivalent to an expert dungeon for the best adventurers. Not only is the True Clay valuable, but more importantly the experience we got from successfully clearing a dungeon of this magnitude. With this item, we will be able to increase the quality of Lunas equipment by another level. Although I wasnt quite fond of the progress we made in that dungeon level-wise as only Phil managed to gain a level despite the fact that this special intermediate dungeon had earnt us a least a month-worth of experience if we remained in Flaregard. Entering the blue vortex, we were returned to the entrance of the dungeon. In other words, back in the guild. The guild staff who were present at our arrival instructed us to wait as they rushed back to the offices, coming out not with the usual receptionist but an executive of the guild. [How far did you make it? Please tell me that youve at least made it to the fourth floor. Itll be a huge relief on us if you did since itll make the rest of the dungeon much easier once you return.] (Executive) I knew that he wasnt being disrespectful, I couldnt help but feel offended by his words. Although it seems that were the only party be tasked to complete the request. The number of monsters in the dungeon was much higher than a usual dungeon which meant that a partys resources would be used up much quicker. Even with Me and Phil leading the way, finishing each battle as efficiently as possible while relying on Lunas Presence Detection to avoid any unnecessary battles, we still used up all our resources before reaching the end of the dungeon by being frugal. Such was the level of a dungeon similar to advanced dungeons. [Ill answer that question.] (Yuuya) In response, I took out the Primal Flame from my magic bag. Note: The flame itself is actually a lantern but I felt that it would be easier to just omit the lantern. [I never thought that you would clear it in two days..] (Executive) [Its the opposite. I cleared it because I only had two days.] (Yuuya) Since I didnt have that much time to remain in Flaregard, we only had two days to finish the request to catch up with the caravan. Additionally life in an advanced dungeon was a stressful one. The only proof one needed was to witness how sluggish the girls aside from Phil were behaving right now at the end of the second day as they barely managed to clear the dungeon. Hence this was an irreplaceable experience for us to have right before breaking through the intermediate to advanced rank. After listening to my response, the guild members found themselves tongue tied as they began to smile. [Hahaha. Im sorry. It seems that Ive been misjudging you from the beginning. From the bottom of my heart, Im sorry and thank you. Now then, lets talk about the rewards for this request. FIrstly, you can keep the return stones. Truly thank you. As expected of the hero Leonard, only someone like him could introduce someone to become the new saviour of our city.] (Executive) [Sorry..? Could you tell me the details?] (Yuuya) Did I just hear something outrageous? The person who recommended us was Leonard? [Didnt you hear about this? Initially we had requested for the Heros party, Leonard to fulfill the request. However he gave me a counter proposal, stating that there was a party in the city that was capable enough of completing the request. And that if they were to fail, they could send another message and they would travel here to finish the request themselves. The rest happened as youve seen. Now that youve cleared the dungeon, there isnt any reason for the heros party to step up. I hadnt had any faith up until now but your party actually managed to clear the dungeon at your levels.] (Executive) How much about us does Leonard actually know? I cant figure out whats his objective either. However this does answer some lingering questions I had towards the guild. Why wasnt the guild surprised at the fact that we had five members in our party, why they hadnt advised us on the riddle in the dungeon and most importantly, why did they delegate such an important request to a party that had relatively low levels to the dungeon itself. [That was the situation. Even if you had failed to complete the mission, we would be able to rely on hero Leonard to complete the dungeon which was why I ordered the receptionist to hand you a Return Stone. Lets head over there to settle your reward as well as the matter about your raptor carriage.] (Executive) Frankly speaking, this situation doesnt appear as appealing to be as before, but I wont be complaining either. It was still a quest with an attractive reward, and I am about to receive that reward. .. And Ill be sure to send Leonard a letter myself. One of the services provided by the guild is to contact other adventurers after all. Itll be difficult for adventurers themselves to locate other adventurers throughout the year since we had an extremely mobile lifestyle. However parties had to register themselves at a guild to complete or accept a request, and that information is being shared throughout the guild making it much easier for the organisation to contact a specific adventurer. . . . After obtaining the rewards, we proceeded towards the shopping district. I went around replenishing our supplies such as recovery potions while Til bought an accessory which originated from the dungeon, providing its user an increased resistance against stuns and improved concentration. Selene had went to the armorsmith to purchase a new set of armour rather than repair her old broken set. Her new set of armour was rather spectacular in performance as well. It was a set made of leather from a monster which was rather flexible and resistant against flames that covered the whole body. Not only is the leather strong against sharp weapons and attacks, even her vital spots were protected by another layer of magic metal which were rather lightweight and durable as well. It was a seriously impressive set of armour, allowing its wearer to move around easily and fight much longer due to its lightweight. Im sure you wouldnt find anywhere else but Flaregard. Thus, shortly after obtaining our rewards, we had already spent all of it. In fact, I even had to take a chunk out of my savings in order to supplement our shopping spree although it was fine since it was unusual for a single request to cover the cost of a full-body armour and a magic accessory. Now that we were done with our shopping, we carried our exhausted bodies towards the hot springs where we ate a delicious meal. [This is happiness~ Delicious food and hot springs. Luna wants to stay here forever~.] (Luna) [Me too~. Its like heaven here.] (Til) The two girls seem to enjoy Flaregard as I smiled wryly. [Its true that their hot springs are the best. But if we travel around the world, well be able to find other hot springs and even delicious food that you would never be able to find here. So long as we keep moving, well be able to discover more blissful things in other towns.] (Yuuya) [Luna looks forward to it! Luna, wants to find even more wonderful things!] (Luna) [As expected, it was a great idea to escape from the village! Although they had plenty of amazing things there, there are even more amazing things outside of the forest! Speaking of which, if we ever come across my home village, Ill be sure to introduce everyone to all the best food youll ever eat!] (Til) [Til, there are delicious food there too? Luna is interested!] (Luna) [Fufufu. They are many things that youll never find outside of an elfs village. If we ever travel to an elven village, well bring you plenty of delicious food! Well oneechan will!] (Til) Til looked towards Phil with a smug look as she pushed the responsibility towards her sister. Luna began sticking her body out towards Phil as she looks directly at her with drool flowing down her mouth. [Looks like I dont have a choice. If we come across our village, then Ill be sure to prepare all sorts of elven dishes. Please look forward to it.] (Phil) [Thats great! Since I specialise in eating.] (Til) [Sigh, I wonder what will happen once I get a brother-in-law.] (Phil) [No way, that will never happen. Our journey isnt over yet! Until our adventures are over Ill be by yours and nii-sans side!] (Til) [Luna too!] (Luna) Are they freeloaders!? They seem so excited and frankly enjoying themselves like this. Although looking at this spectacle, Selene seemed to have a glint of loneliness around her. [Selene, its too early for you to worry about the future.] (Yuuya) [Thats true. But I cant help but think that itll be great if this could go on and on without ending. Is that weird of me to think so?] (Selene) [No. That isnt weird in the slightest. At the very least I dont think so.] (Yuuya) Our current party was the most enjoyable party I have ever had. However even this would come to an end soon. At that moment, well have to choose the option that will leave behind the least regrets.. . . . On our way back towards the guild, it seems that there were several people following us from a distance. Im surprised the children hadnt noticed them, especially Luna who not only had the ability to detect nearby presences, but was also the sharpest naturally. However, it seems that they were still unable to fool Phil as Phil sent a glance towards me. [Yuuya, once we return please brush Lunas tail! Everytime you brush Lunas tail, it becomes so light and fluffy!] (Luna) [In that case I want a lap pillow!] (Til) The two girls continued their rowdy requests ignorant of our guests as Phil sent subtle signs while continuing the conversation. According to her, it seems that the targets were Luna and Til. At this rate, itll be rather tiring to continue towards the guild while being mindful of their movements. Perhaps displaying an opening here might be for the best. [This way, I know a shortcut.] (Yuuya) I deliberately led the girls towards a less crowded area as I wondered whether they would follow us. The answer to my question came quickly after as I felt their presence quickly approaching us. This persons presence feels familiar.. Oh. It seems that my warning wasnt sufficient then. The years must have been mellowing me out as I grabbed across Lunas shoulder with my arm, rotating a full 180 degrees as I threw the dagger holstered under my armpit. A scream came out as I turned around, the boss of the Crimson Hounds was standing there with a dagger imbedded into his hand, and another on the ground. The instant I turned around, he had already began rushing towards me, however, it was already too late. I took a step forward as I pulled my sword out of its sheath and raised it. Before anybody realised what happened, a right hand could be seen flying through the air. Meanwhile his two lackeys who were behind him had began their escape. [I thought I had already warned you. That the next time you try to lay a hand on any of my girls, Ill kill you. It wasnt an empty threat.] (Yuuya) [HIIEEE. Stop it please, I ju- just want to talk.] The boss began pleading as he held where his right arm should be. [Let me understand your intentions then. Rushing towards someones back with a knife in their hand is your way of starting a conversation? In that case, let me give you my greetings.] (Yuuya) [No.. please. I dont want to die.. Someone save me.] [Im a naive person. However Im not stupid. Once I get bitten, Im twice as shy.] (Yuuya) It seemed that he reached his limit as he tried to escape.. But he couldnt even take a step as his waist was separated from his torso. [Is everyone okay?] (Yuuya) [Luna is okay.] (luna) [Im alright too, Yuuya-niisan.] (Til) Although their words said one thing, their faces showed another as I hugged both of them tightly and began stroking their heads. The shock of having someone cut down in front of them must have been difficult. [Yuuya-ojisama. Shouldnt he be arrested right now? Why did he even consider attacking you despite the gap he should have experienced in the dungeon. He knew that he couldnt win.] (Selene) [By paying a large sum of money, you could be released on parole. And Im sure you know what was on his mind.] (Yuuya) I let out a huge sigh. As a veteran who has led numerous adventurers, I believed that everyone made mistakes. That was what made them human, which was why I believed that they could learn from their mistakes as well. However, people like him were the reason I decided that one chance was all they would get. Rather than learn from his mistake and changing his ways, he fell even further, becoming hellbent on revenge. Hence paying what he could afford to be placed on bail and tried to retaliate against me who had humiliated him. He understood the difference between us from the previous battle and decided to aim for a hostage instead, aiming for Luna. Ideally he was waiting for the moment when Luna was alone in order to defeat her with numbers, however he realised that it was never going to happen and decided to attack. [Im sorry, Luna and Til. For not settling matters properly, and having to show you something like this.] (Yuuya) [Yuuya doesnt need to apologise. Yuuya protected Luna.] (Yuuya) [Were adventurers too. We should be used to this sort of things. We dont mind.] (Til) Although their words made me happy, this was an incident that shouldnt have happened in front of them. [.. Thank you. In any case, lets head back to our room in the guild. Ill report to the guild about what happened today. Although something unexpected happened today, lets rest well tonight and prepare for our departure tomorrow.] (Yuuya) Being conscious of my tone, I lightened up my tone as everyone continued walking to the guild. Even now, I hoped that my policy of second chances was right.. I dont want to change it as it was what I believed in. However, if I have to go against that policy to keep these girls safe, then Ill do it to avoid any unnecessary risk. I would never be able to forgive myself otherwise. . . . The next day, I received news from the guild regarding the incident with the Crimson Hounds boss and it seems that my actions were deemed as self-defense as he didnt actually pay the bail, but escaped from the authorities. The Crimson Hounds had attacked his envoy as he was being transferred somewhere. The envoy was critically wounded and thus a bounty was placed. Through a surprising chain of events, we unexpectedly earned ourselves an extra reward. For this reward, I intend to use it solely for Luna and Til considering what they witnessed yesterday. Regarding his lackeys, it seems that they had turned themselves in and confessed to everything. After I made my last report to the guild about our departure, they told me that arrangements had been made in our next stop as a consolation about this entire incident. Free of charge of course. Thus, we entered our carriage and finally left Flaregard. [Yuuya, the carriage is so much faster than the caravan!] (Luna) [Yuuya-niisan, the wind feels incredibly good yo~.] (Til) Luna and Til stuck their heads out the window of the carriage and narrowed their eyes. [We should make it to the next city quite quickly with the carriage. So Ill take this time to explain to everyone what well be doing at the next city.] (Yuuya) The two girls energetically returned their heads to the carriage as I began my briefing. Our next destination was a city in the southern area of the Laluzulu Kingdom. However, with our carriage the distance between that city and the capital is quite short. In this town, I wont be raising our levels but rather focus on teaching everything I know to Selene and whatever time remaining will be spent making our journey an enjoyable one. Our journey together will be one remembered with laughter even as we part. Im quite rusty on this so do let me know if there is anything that could be improved on. Just to clarify Lunas speech patterns, she typically speaks in third person, Luna looks forward to it however there are instances where she speaks in first person, I look forward to it. This is because in Japanese they often omit the noun and just mention their actions/ thoughts. Eg: B! (I will do my best). I thought that adding the first person noun here would be more accurate as compared to Do my best!. Luna does this often but the times where she does refer to herself, she does it with her name. There are probably other things that I should clarify (if you read the raws) but I did this as direct translating certain aspects of the novel is awkward in english (such as above). So if there is anything you find unsatisfying. Do let me know! Volume 4 Chapter 7 On the road leading away from Flaregard, a raptor carriage could be seen travelling as it left several merchant carriages in the dust, overtaking them with speeds several times higher than normal horses. Not only were Raptors much stronger than horses, they had an extremely light appetite as well which made them much more efficient in longer travels. Despite this, merchants often avoided raptors as they had a primitive mindset, following only beings that were stronger than itself. On the other hand, adventurers preferred Raptors to horses as they were much easier to handle as compared to a horse. At the front of the carriage, the sound of a bell constantly rang due to the shaking of the carriage. Since monsters disliked the ring of the Amulet Bell, we were less likely of being attacked so long as we kept moving. Luna crawled onto the coachman seat as she placed herself comfortably onto my lap. Ive been spoiling her too much recently. [Yuuya, the wind feels good~~~] (Luna) [I agree. You wouldnt be able to feel this if you didnt own a Raptor.] (Yuuya) [Hey Yuuya, why didnt we use this back at the Temple of the Primal Flame?] (Yuuya) [The bell only works on monsters below level 30. Its not really usable against monsters in the dungeon but its pretty useful for trips like this.] (Yuuya) Most monsters that live outside of dungeons are usually lower levelled making the Amulet Bell much more useful here. Although we would be safe even against a surprise attack by lower levelled monsters, the same couldnt be said for our carriage and our Raptors. [But arent Raptors monsters too? Why dont they dislike it.] (Luna) [Domestic Raptors have been trained since birth to grow accustomed to items such as this. So we dont have to worry unless youve tamed a wild Raptor who finds the sound disturbing.] (Yuuya) [Uhn. Im glad.] (Luna) Luna is a kind child. She may have been worried about Raptor this entire time and came to me to ask about it. While we were travelling on the road, Lunas eyes began shining as she stared at the surrounding scenery, shaking her fox tail vigorously. Her tail was extremely ticklish though. [Hey Yuuya, what kind of city is our next city?] (Yuuya) [Ah! Im curious about that too Yuuya-niisan!] (Til) After catching wind of Lunas question, Til began moving towards the drivers seat. She started hugging onto me from behind as if she was competing with Luna. Since Til still had much room for growth, I hope shell learn to be more mindful of her actions. [Its tiring for me if you continue on like this. Can you sit next to me instead.] (Yuuya) [Uhn I understand. So what kind of city are we going to?] (Til) Her tone this time around seemed much more serious than before. [Lets see. Grannel became a prosperous city as its situated near the Laluzulu Kingdoms capital. Their specialities are similar to Greenwood in that the surrounding nature is thriving, making their main attractions the scenery and their agriculture. Dungeon-wise, their difficulties are around the same levels as Flaregard and the environments are mainly greenery like Greenwood.] (Yuuya) [Hurray. Luna is weak against heat. No more heat.] (Luna) [Uhn. Forests are great. Us elves are unstoppable in the forest.] (Til) It looks like the two of them are satisfied not having to deal with the heat anymore. Their feelings are understandable though since one was a fox-demihuman with a thick and fluffy tail while another grew up in the cooling forest. [Yuuya, is there any speciality like hot springs in Grannel?] (Luna) [Sure there is. Grannel is also known as the City of Dolls as there were many dolls being sold in the city. There are many stores in the city selling not just cool and cute dolls but even human-like dolls which can be ordered in the stores there. A Luna doll or a Till would be cute to have.] (Yuuya) [Dolls!] (Luna) [Ahh that may be good. Its embarrassing to have a doll made after me though.] (Til) It takes around thirty minutes for a skilled craftsman to make a human doll for a lucrative albeit reasonable price, however it could also easily become a lifelong memory. Having the doll in your possession though, could give a hidden effect to its holder. Its unknown whether it would take effect in this world however it was still worth a buy. It was an item that was already worth its cost to purchase, even more if it was possibly a special item. [There is even a legend revolving around the doll, where having the doll in your possession will protect you even from the worst of situations. It has even become a popular trend for couples to keep the doll of their partner as a lucky charm.] (Yuuya) It is a romantic albeit cheesy saying but its not bad either. [Luna wants a Yuuya-doll!] (Luna) [Me too! Me too! More than my own, I want Yuuya-niisans doll!] (Til) [Both of you arent my lovers though.] (Yuuya) I let out a wry smile however the two girls were unconvinced. [The person who protects Luna is Yuuya.] (Luna) [What she said. No one is more reliable than Yuuya-niisan. Besides, if we want to keep it as a lucky charm then it cant be anyone but Yuuya-niisan.] (Til) [If you put it that way, then I guess Im fine with it.] (Yuuya) If the people themselves want it then I guess its fine. [Uhn. Good thing Luna saved her money. Its okay even if its expensive.] (Luna) [Im lost at how to spend my money too. Its a waste to spend it just because.] (Til) By the way, our party functioned with a pocket money system with me managing 80% of the money we earned as the partys funds. These funds were used for our operational expenses such as travelling, equipment, consumables and food. The remaining 20% was distributed to everyone for our own use so even though we divided the 20% among us, it was still a large sum of money for the two of them. Luna had always spent her money on buying delicious food while Til mainly bought accessories. Since they still had some money left, I felt that a doll would be a good buy. Luna and Til began chanting Hu-man dolls, Hu-man dolls while dancing around on an unstable platform. Their variations of the mysterious dance is increasing day by day. It isnt even on the level of acrobatics anymore, its already in a league not possible by anyone else at this point. After catching wind of this ruckus, Selene and Til both came to the front. [Its unfair for the three of you to keep this a secret. I want to have a doll of Yuuya-ojisama too.] (Selene) [Of course as a lover, Ill be getting one as well.] (Phil) I hadnt considered the two adults to jump on the bandwagon as well. [. wait a minute. Isnt it weird to have everybody just have my doll? Well be making four dolls of me you know.] (Yuuya) [Thats not it. Its the act of equivalent exchange. Well be exchanging our dolls with you so youll be getting our dolls too.] (Phil) [Uhn. Of course. Ill protect Luna and Yuuyas dolls.] (Luna) [Be sure to treasure it Yuuya-niisan.] (Til) [Now that were doing this, its somewhat embarrassing.] (Selene) Everyone supported Phils idea. These four beautiful girls having my dolls I cant help but worry about what kind of experience I will have walking around the town. [I understand. Lets do it. Itll be cute to have everyones doll around. Itll be a good thing to keep them on us regardless.] (Yuuya) If it makes them happy then Ill endure the looks from the people there. Although I have to admit, Im looking forward to this too. . . . Thanks to the Raptor carriage, the trip which would have taken more than a week with the caravan was reached in three days. On the third day, after our breakfast I stopped the raptor as I took out a Drop of the World Tree from the magic bag. I recalled the events in the guild back when Til joined our party as I looked at the clear liquid in the bottle. As soon as the liquid enters my mouth, I tasted a subtle sweetness in the water as strength filled my entire body. It was as if all the cells in my body was welcoming the liquid. This special liquid is known as a tonic for longevity and is only effective for men as a drop will rejuvenate the body, preventing the body from aging for one day as well as making the body younger by a day.. Since I was in my mid thirties, my body was on the decline however with this Im able to halt the process and even make my body younger. Since its been three months, my strength hasnt waned but its even stronger than before. After judging the amount I have, I have about two years before my entire stock runs out. It still feels surreal that in four years even though Ill be thirty-eight years old, my body would actually be thirty-four years old. It was this very drug that caused the elves to be targeted by other races. [Ahh Yuuya-niisan, I see that you are drinking my fluids.] (Til) Til came over to the drivers seat of the carriage in her pyjamas as it was still early in the morning. [ again with the weird wordings. Could you stop saying it like that. Ive already asked before but just what are the ingredients for this medicine?] (Yuuya) [Uhm.. Elf juice?] (Til) I have a feeling I wouldnt want to know the details. [Yuuya-niisan is lucky you know. Since it takes about five years to make just one bottle, if you were to drink from both me and oneechan then youll never grow old.] (Til) That is true. Since a bottle lasts for two years and it effectively slows down the aging process by four years, with two bottles my body will eventually become younger than older since Ill have two bottles every five years. [The bottle I have now is my reward for letting you into the party. There isnt a reason for me to receive a second bottle from you.] (Yuuya) On the other hand, Phil isnt a maiden anymore since shes together with me. [Ohh didnt oneechan tell you? An elven maiden is meaningless if their neither a virgin nor have a person they love. This ability was given as a blessing by the ancient elves in the past to relieve the burden of loving someone outside of their race, closing the gap in lifespan between the two races. This was why it only worked on races with short lifespans and once youve given it to more than two people, that elf will forever lose her ability to produce the medicine.] (Til) So its that sort of power. Its something that allowed the maidens to live with their loved ones longer than they actually could. And since it wasnt a power but a blessing, does it become ineffective if it wasnt made with pure love? [Til, that is a saying passed down as an elven secret. If any other beings from other races catch wind of this, itll be taken advantage of.] (Phil) It seems that Phil had noticed our conversation as she came over to the driver seat. [Ah oneechan. Sorry but wouldnt it be better for Yuuya-niisan to know about it?] (Til) [Fuu, such an irresponsible child.Yuuya, thats how it is. Truth is Ive already begun making the Drop of the World Tree. Since Ive been making it even without a partner Ive three bottles with me, and the fourth should be done soon. Someday itll all be given to you.] (Phil) [I never knew that such a thing was ingrained so deeply into the elven culture. So if you were to fall in love with another guy, then it wouldnt matter what you did. Your body would naturally react otherwise and the age-halting process would forcibly halt.] (Yuuya) Even now, Im still awestruck at Phils conviction about me. [I dont have any guy besides Yuuya that I care about in this world so please dont think like that. Also, you wouldnt have to worry about Til since I have a large amount of Drops with me and Til will have to save hers for her future lover.] (Phil) Just as Phil said. Although its extremely tempting to have both Til and Phil make more Drops for me, its just doing more harm to Til than good. Shell someday find someone well-suited for her. [Awawa, I know that too. Uhn. How about if I find someone cooler than Yuuya-niisan then Ill consider it. Now then, Ill be heading back to the carriage. Til quickly returned to the carriage as Phil had a difficult face. [Looks like Yuuya noticed it too.] (Phil) [Girls at that age tend to admire the adults around them.] (Yuuya) Although I consider myself dense in that regard, looking at TIls attitude its easy to tell. Plus Ive nurtured numerous adventurers including female adventurers so Ive been on the receiving end quite often. Its fine being admired but I also know the dangers involved for female adventurers. Those girls just hadnt had the chance to widen their view to the entire world. Itll be outrageous of me to just enable their ignorance towards the world. [Im glad to hear that. Everything I say now is just my own feelings. Truth is the elven race is highly depended on polygamy. Since its so difficult for a child to be born, there arent enough men for the women if we were to stick to monogamy. When a elven maiden rejects the idea of polygamy or is unable to fall in love, they would eventually get married to a male of a different race. Matter of fact is that Til and I have the same father, but different mothers.] (Phil) [What are you trying to imply?] (Yuuya) [That.. Im not willing to say out loud.] (Phil) I let out a wry laugh. [Anyway, I would never stoop so low as to toy with a childs heart. Besides, the person I love now is Phil.] (Yuuya) [Hearing that is reassuring as your girlfriend.] (Phil) Phil sat closely next to me as I started the carriage, leaning her weight onto me. . . . Finally, the city of Grannel can be seen in the distance. I took out the evidence of my silver-rank and hung it around my neck. Although I didnt really like to show off this sort of thing, without this I would have to queue up and prepare the money required for admission. Since Ive went through huge troubles to obtain this thanks to the Temple of the Primal Flame, Ill be sure to enjoy this privilege. [Everyone. Weve finally arrived at Grannel. Well hurry towards an inn, register ourselves at the guild and head to the shops to prepare our dolls!] (Yuuya) Dusk is rapidly arriving soon. Well do our best in the dungeons tomorrow so its time for us to enjoy ourselves today. Voices filled with happiness filled up the carriage. Even in a new city, as adventurers we should enjoy ourselves to the fullest. Volume 4 Chapter 8 - The old man gets a doll. We arrived at the town of Grannel, a town situated in close proximity to the capital of the Laluzulu kingdom. Grannel is a town that is larger than Greenwood as a whole, and was divided into two sections: the agricultural zone and the commercial zone. The agricultural zone covered a large amount of land with the most prominent crop being the rice paddy as it was currently in season. [Looks like we arrived at a good timing. Well be eating freshly harvested rice that is so sweet and delicious that you could eat it alone.] (Yuuya) Since this worlds wasnt especially globalized, their preservation and distribution technologies were lacking, causing the quality of food outside their seasons to drop. Although it was possible to eat rice during the other seasons elsewhere, it was difficult to eat freshly harvested rice making it a luxury. [Luna prefers bread but rice is good too.] (Luna) [I feel that way too. Its hard and dry and has a weird smell. Its delicious with soup though.] (Til) [Youll understand once youve tasted how its supposed to be.] (Yuuya) Once theyve tasted rice at its best, Im sure their opinions will change. Ill have to choose the store carefully though as most stores would only replenish their stores with fresh grains once the older batch are sold. [Although the first thing would be to head to the guild..] (Yuuya) Normally I would head to the guild while the girls acted on their own however it was time to show Luna and the other girls to the guild as accomplished adventurers. [Everyone, lets head to the guild together.] (Yuuya) [Uhn! Lets go!] (Luna) [Yuuya-niisan has finally recognized us.] (Til) The two girls had responded first as it seems to have been on their mind for awhile. Although Selene has been visually frustrated ever since we entered the town. [Relax a little. I doubt anyone will recognize you since your hair colour is different. Even if someone looked closely you would just look like a passer-by.] (Yuuya) [I understand but I just cant help but get nervous being this close to the capital.] (Selene) I could understand where shes coming from. Although this wasnt the capital city, there were still many people who knew about Princess Lutra of the capital. Since she was the child who was born with silver hair, people were singing about the second coming of Renoir. However since everyone was focused on her silver hair, her other features were not as well-known. She has always been thinking about the time her disguise would be blown, however there was no reason to worry to that extent. . . . After arriving at the guild, we were being taken care of by a popular receptionist as we handed over a letter of introduction by Flaregards branch, placing us higher on the priority list. As usual, the popular receptionist was a beauty. [Nice to meet you. My name is Maria1. Youve had a wonderful career, piling up this number of achievements in the past month alone. Let alone the number, each of them are impressive in itself. With the average level of only 35, defeating the Coronoa Dragon as well as defeating the Temple of the Primal Flame at level 36! It is my honour to be serving you. It is important to navigate past difficult quests however it is important to enjoy yourselves as well. I hope you enjoy yourself in Grannel and leave the matter about your lodging to us.] (Maria) She seemed to be an extremely bright person as we proceeded to register our party. The registration process itself was short and simple and our lodging was already prepared. However, the receptionists eyes turned cloudy as we completed our registration. [Uhm. Yuuya-sama. This may sound rude but could you please decide on a party name? Even though its fine to continue being nameless, considering your achievements so far there might be people who would nominate you for a quest. Itll be difficult for your potential client if you continue without a name.] (Maria) [Well.. Thats true.. ] (Yuuya) Our party name is important. More so in something as private as a nominated quest since the information had to be conveyed to the client. Even the guild wouldnt be able to introduce my party as *Yuuyas Party* if they did not know of me in the first place. Eventually, even the towns weve been to would forget us without a name and well lose the opportunity to complete difficult quests while making a name for us in the process. [Yuuya, weve been procrastinating on this for a long time. How about we decided on the name right now?] (Phil) Phil came up to the desk as the receptionist widened her eyes in shock. [Could you be, that charismatic Phil Etherlance-sama!?2 I saw you at a parade I went to once! Weve also met once at a guild gathering! Phil-sama was already perfect as a receptionist.. But as an adventurer you were in the same party as the hero Leonard? Yuuya? Are you that Yuuya? The master of the hero, the strongest yet weakest knight, the undefeatable apex of all swordsmen, that Yuuya Grandwood?3 Its a lie~~. Me of all people, meeting two of the members of the Roaring SIlver Dragon. Ahh Im glad to be alive~] (Maria) The receptionist continued to smile, staring at me and Phil while letting out a joyful voice. Well.. I expected someone to recognise us sooner or later. On the other hand, it would be weirder for someone to think I was just someone who resembled me at this point. [Firstly, could you please treat us differently. In fact, isnt our guild registration number different?] (Yuuya) Everybody receives a guild registration together with their status card. Since it is the most reliable identification method that cant be hidden along with the persons status although our information have been resetted along with our levels. In fact, this is likely the reason why weve been treated differently by every other person in the past. Thanks to this I couldnt receive any messages sent to my previous number, however the advantages of travelling as a separate person was greater. [I see that you have your own circumstances. I understand. I wont pry nor will I snitch. Leave it to this Maria! Ill keep Yuuya-sama and Phil-sama in my heart!] (Maria) Thankfully she looked like a good girl wholl keep her word since itll be troublesome if someone asked me about my level. I could hear Luna and Tils voices from behind. [Yuuyas previous party, Roaring Silver Dragon So cool.] (Luna) [Yuuyas titles are cool too. Master of the hero, the strongest weakest knight, the undefeatable apex of swordsmen. I want to have my own titles too.] (Til) I clenched my fists to hide my emotions. Please stop it Til. I may have thought they were cool as other people called me by my titles but now I wished to have a simpler title It was a dark time.. [Well lets just leave it at that. Weve talked about the name of our party before havent we? Did anyone come up with a name they want? Otherwise well leave this matter as it is and decide on another day.] (Yuuya) We still have plenty of things to do before the day ends. Itll be much more beneficial to discuss tonight rather than spend time trying to think of a name. [Luna wants Yuuya and his happy friends!] (Luna) [Rejected. That sounds like the party revolves around me.] (Yuuya) How did you even come up with that name? [How about True Dragon Knights? Dragons sound cool. Knights sounds cool too. Mixing the two is even cooler!] (Til) [Isnt the only one even remotely resembling a dragon Erik? In fact, where did you even get the idea of knights from?] (Yuuya) Please stop this, I cant handle anymore than that. [Speaking of dragons, Yuuya-niisans previous party Roaring Silver Dragon didnt even have a dragon did you.] (Til) [Kyu!] For some reason Erik was even cheering Til. He might even be happy to hear that our party may represent him with our name. [That party is that party and this party is this party. Anyway, rejected.] (Yuuya) In any case, there was indeed a dragonkin thief in our party. Speaking of him, I wonder if Lyle is doing well now. I kinda feel like having a drink with him after such a long time. Theres just the two adults left as I turned my gaze towards Phil and Selene. Phil was the first to voice her opinion. [Uh. The name I thought of was the Mixed Wine. With elves like me and Til, a fox-girl in Luna, a human in Yuuya and a noble in Selene all together in a single party. Different people from different backgrounds put our powers together, as if it was a perfect blend of wine.] (Phil) [As expected of Phil. Its a nice name that suits us.] (Yuuya) It could be a surprisingly nice name for us. [What about you Selene?] (Yuuya) [The name I thought of was the Twilight Home. I think of this party as a place that I want to return to.] (Selene) [Uhn. Luna understands how you feel. Luna will return to wherever Yuuya is.] (Luna) Phil and Til both nodded as their eyes told me that they were convinced. [Looks like its settled. Our party name will be Twilight Home.] (yuuya) [Uhn. Perfect.] (Luna) [The True Dragon Knights will give up!] (Til) [I think that its nice too.] (Phil) Selene looked a little embarrassed at our reactions. [Thank you. Im happy that everyone decided to use my name. Im starting to get embarrassed. Speaking of which, weve not heard the name that Yuuya-ojisans4 name yet. What name did you come up with?] (Selene) [I put all of our specialties together, Foxs Bow, Sword and Shield5.] (Yuuya) [Yuuya, if this name is fine then I dont understand why you are embarrassed by the Roaring Silver Dragons.] (Luna) [My thoughts exactly! Exactly!] (Til) [Kyu kyu!] As I thought, is it a feeling thats absent in children? The two names are completely different. [Uhm. Sorry Yuuya but I dont understand either.] (Phil) [I agree as well. I dont see how they are different.] (Selene) What?. If the two of them are saying so I should reflect on this a little, just a little. . . . After registering our party name as the Twilight Home, we proceeded to check in at the inn arranged by the guild and kept our luggage before leaving the inn. Our raptor carriage was also left at a reliable store. Then, we arrived at a Doll store. Although there were many stores that sold dolls in the city, I decided to head towards the store that was the most prominent during the game era. Since princess Renoir was a legend from hundreds of years ago, we are probably several centuries ahead of the game era although there wasnt anything to prove that something special in the game would work now. Regardless, Ill gladly keep any item that might have special effects since it is also likely for the abilities of the store to be passed down to future generations. [Looks like were lucky. There isnt a long queue.] (Yuuya) [Lines are a little troublesome.] (Phil) [It looks even more popular than the last time we came.] (Yuuya) [I remember now. At the time we couldnt even afford a single doll so we didnt even consider getting one.] (Phil) Phil began to laugh as she recalled what happened in the past. At the time the thought of enjoying myself didnt come to mind as I was always thinking of charging forward. [But Yuuya-niisan. Its already late and Im hungry. By the time the queue ends our stomach will reach our backs.] (Til) [Luna too.] (Luna) I am prepared for that as well. [Truth is Ive bought onigiri from a restaurant recommended by the receptionist.] (Yuuya) I began distributing the onigiri in my magic bag to the unimpressed girls as the onigiri looked fairly simple. [It doesnt look delicious.] (Luna) [Ill still eat it since Im hungry.] (Til) Luna and Til6 bit into the onigiri as their eyes became wide open. [Delicious, its fluffy and not hard and dry at all! This rice tastes like magic!] (Luna) [The filling is delicious too. Its sweet and spicy meat and goes well with rice. Yuuya-niisan, one more please!] (Til) [That is how rice is supposed to be.] (Yuuya) I handed over a second piece to the two of them as I began eating my own portion.I bit into the onigiri causing the unique fragrance and sweetness of the fresh rice spread throughout my mouth right The filling consists of simmered pork cooked in honey causing the meat to be soft and allowing the fat to melt and mix with the rice although it was cold. This was my first time having such a delicious rice ball. [Yuuya-ojisama. Its so delicious that Im surprised such a thing existed this close to the castle. Ive not seen anything like this.. Im glad that I got to experience such a thing on my trip.] (Selene) [Lets leave the solemn mood to the end shall we. Lets enjoy today to the fullest.] (Yuuya) [Yes, lets do that.] (Selene) Selene smiled as we continued to enjoy our onigiris until it was our turn. Without any discussion and any hesitation, we ordered four Yuuya dolls. . . . After two hours, we finally left the store. Im exhausted.. After placing our order, I felt the gaze of all the customers and the craftsmen pierce through me as they all heard the order for four Yuuya dolls and one of each girl in our party. I felt like I could hear the atmosphere mumbling harem,harem,harem the entire time we were in the store. The four girls were all amazing in their right with Luna and Til being a little young, but I was still shot with envious and jealous gazes from the other customers. When asked by the craftsmen about our relationship, I made sure to mention that they were my disciples, with Phil being my girlfriend and Til being her sister. [Yuuya, lets exchange dolls!] (Luna) [Me too, Its my doll!] (Til) [Ill take good care of Yuuya-ojisamas doll.] (Selene) [I pray that this will make you think of me.] (Phil) I received the doll from each of the girls as I gave back a doll of my own. Since each of the dolls were made after a beautiful girl, by an expert craftsmen, each of the dolls were beautiful too. They were all made well and I wanted them even if they were just plain dolls. As soon as the girls received my dolls however, the scene of each girl treating my doll so affectionately caused the atmosphere to become flowery. [Everyone, remember the legend involving the dolls. If your feelings towards the person are true, then if you were to be in danger, then the doll will take your place and take the danger away for you.] (Yuuya) That was the dolls ability in the game. There was a hidden status behind everyones status, which was shared between companions. By exchanging dolls between companions with this status above a certain value, youll be able to survive any misfortune7 or lethal damage by taking your place making it an extremely useful item. However unlike the game, I cant confirm how intimate I am with my companions. Since Im constantly thinking of my companions, I believe everyone is doing the same and that well definitely be protected by the doll. [Uhn. Luna likes Yuuya. Yuuya also likes Luna! Which is why the doll will protect us.] (Luna) [Me too, but I dont want my Yuuya doll to be destroyed.] (Til) The two girls raised their opinions as Selene and Phil merely smiled at the scene. It feels as if the dolls had caused our partys relationship to deepen. Now that weve done everything on our list, its about time for us to return to the inn. Since Luna and TIl mentioned that they werent satisfied, itll be a good idea to return to the shop earlier and purchase a couple more onigiris. [Tomorrow, be sure to prepare yourselves. Itll be time for the monsters to be re spawned.] (Yuuya) I heard a bit of good news from the guild, that the monsters will be re spawning tomorrow. Tomorrow will be the perfect time to raise our levels, so lets hunt to our hearts content. Note: Maria in the raws was called ꥢ (Meria). I couldnt tell what name it was so.. Maria it is I vaguely remember translating her name once but I couldnt remember what it is, so.. Etherlance it is. Youve probably guessed that Im bad with names. So.. Grandwood it is. The author didnt mention ojisan which is how Selene addresses Yuuya so Im inserting it since it sounds like Selene. Oh gawdd please stop it with the names. I have absolutely no idea how to translate this so someone please enlighten me. This is probably the chapter I would never want to translate ever again. T.T. The kanji is (,夦󤸤). The author made an error and wrote Phil but Im assuming its Til anyway (I guess Im not the only one bad with names) The word used for the doll means misfortune or danger, but it can also mean death. Volume 4 Chapter 9 - The old man goes into the jungle Having bought our dolls, we returned to our inn. As expected of the inn recommended by the guild, their service was solid. Since this inn was going to serve as our main base of operations, its a great location for us to raise our levels before the succession ceremony and with the quality of the inn, well be able to rest comfortably for the rest of our stay. After organizing our luggage, I turned towards the dolls in my possession. In the game, this was a useful item for surviving unfortunate situations. I had bought this with hopes that its ability was still in effect. However at the same time, it is also highly unlikely that this is the case. The dolls actual ability was to prevent any events that were deemed as *unfavourable* aka misfortune flags, breaking itself in the progress. The effects of such events included an old trauma of mine, a reduction in the victims status due to old injuries, randomly destroying an item in your possession due to wear and tear or reducing the amount of currency you had by half due to counterfeit currencies. I often felt miserable playing this game in the past. Previously while I was deep inside the dungeon, out of all the items in my possession the one item that was broken was my magic bag. I ended up leaving most of them in the dungeon when I escaped above ground. Just that plight alone dealt enough damage to me to cause a trauma. Since the game was now reality, the concept of having a bad flag being raised with an event didnt exist. If it was a game, the game would merely send a system message stating that the event has occurred. In reality however, a process was required. Using our party as an example, my old scar of lowering the status could easily be prevented by performing proper body maintenance. Having damage inflicted onto our belongings could also be prevented through proper equipment checks while you could only lose money through actual cases of fraud. If anything, Im looking forward to whatever ability that will replace the effect of negating a misfortune flag. There were also a small fraction of higher monsters capable of bestowing curses onto players. Even players were capable of inflicting cursess onto other players. It isnt an ability registered as a skill, but rather a bloodline trait. These families also offered their abilities as a service, inflicting curses given the right amount. Just as there are ways to inflict curses, there are also items capable of preventing curses. Thus, even if they werent easy to come by they were important items to have on hand. Especially for someone as prominent as Selene. Inflicting harm without getting your hands dirty is a dream ability for people in the political world which made the necessary countermeasures necessary. [Yuuya is so cute. Luna will be hugging Yuuya to sleep tonight.] (Luna) Startled by the voice behind me, I turned around to see Luna lying in bed while embracing my doll tightly. I was relieved as the one Luna will be hugging to bed tonight isnt me but my doll. Sleeping right next to Luna was Til. [Luna, you must really like that doll. Youve been playing with the doll the entire time.] (Til) [Uhn. Its my favourite. Wasnt Til also been grinning while caressing the doll earlier.] (Luna) [Its not like I was thinking of anything weird. Dont go around saying weird things in front of Yuuya-niisan.] (Til) [Why are you getting embarrassed? Luna wasnt saying anything weird.] (Luna) Unlike me, Luna and Til seemed to genuinely like the dolls as I began to blush watching them pamper my doll-look alike. I understood how they felt though since I thought that their dolls were cute too but since itll paint an unsightly picture I decided not to play around with the dolls in self-restraint. [Kyu kyu!] (Erik) Erik flew towards the two children with a loud cry as it began kicking the doll in Lunas embrace. [Erik, bad boy!] (Luna) [kyu..] (Erik) Erik looked despondent as Luna raised her voice towards Erik with genuine anger. The unexpected sight of Erik making Luna genuinely angry was amusing as I let out a laugh. [You got pretty angry at that. Erik must have been jealous.] (Yuuya) [Jealous?] (Luna) [You and Til have been all over your dolls that he must have felt threatened by them.] (Yuuya) Thinking back to awhile ago back when Til just joined the group, Luna had felt a similar sense of jealous thinking that I was going to be taken away, resulting in her treating Til with more hostility than necessary. Erik was going through something similar to Luna in that time. [I understand. Erik, you kicked Lunas precious item and you are a bad boy. But Luna understands so Luna isnt angry anymore.] (Luna) [Kyu!] (Erik) Luna hugged Erik as she began stroking his head causing Erik to let out a cry. The scene of the young girl playing with a faerie dragon was a therapeutic experience as I thought to myself, I want it to stay like this. However I couldnt say that out loud as I had to prepare for tomorrow. [Now then, lets begin discussing about our exploration tomorrow. Itll be our first time entering this citys dungeon. The environment of the dungeons here are different from Flaregards. There are several key pointers to remember.] (Yuuya) Everyone began to gather as I started my briefing. The dungeons in Grannel were intermediate dungeons. Compared to the Temple of the Primal Flame, the dungeons here were easier however underestimating the dungeon was dangerous. Hence the reason they are called dungeons. Thinking about our levels alone, there shouldnt be a reason for us to be wary of intermediate dungeons. Hence this time, Ill be minimizing my advice to observe the girls abilities to respond to unexpected situations. The main objective is to gain experience mapping out uncharted territory without any information about Grannels dungeons. Note: I am interpreting curses and misfortune flags as two separate things as they have different kanji in the raws although their abilities might be similar. Their effects might also be preventable by the same items at least based on my understanding. . . . The next morning, we arrived at the dungeon entrance. Since it was right after the dungeons reset, there were a lot of adventurers entering the dungeon. The glint in everyones eyes changed as they entered the dungeon. At this rate, well be left behind. [Yuuya, its green everywhere!] (Luna) [This isnt what I expected. The wind feels stuffy and the ground feels muddy. I dont like this place.] (Til) [Its much more of a jungle than a forest.] (Phil) [Im looking forward to the monsters that will appear in this dungeon.] (Selene) Everyone began saying their first impression and as Phil stated, Grannels dungeons werent forests but a jungle instead. The greenery surrounding the town looks similar to Greenwood, however the rainforests here were filled with countless vines and undergrowth. The atmosphere here became even hotter as if it was agreeing with Tils sentiments. [Everyone, have you properly prepared your equipment?] (Yuuya) [Perfectly!] (Luna) [I saw several good items in the market.] (Til) Luna and Til took out a raincoat from their magic bag. [The unique trait of this dungeon was its weather. Squalls often occur here causing the weather to change extremely quickly, making it difficult to deal with without rain gear. At the same time, underestimating the rain isnt an option either. Being drenched in the rain saps away your body heat reducing your physical strength as well as causes your footing to become unstable from the mud. Furthermore long ranged attacks had reduced accuracy and power. We wont be able to challenge the dungeon at our usual speed and risk exhausting ourselves quickly. Itll be easy if this was any other dungeon, however be sure to listen to your body this time around. If its getting difficult, well fall out immediately.] (Yuuya) Normally, the weather in the dungeon doesnt experience changes. However this point onwards, well start to experience dungeons with unique weather. Furthermore those dungeons often have gimmicks which takes advantage of this. In this dungeon, there is also a hidden floor containing treasures which can only be entered by understanding the change in weather. Since this was a secret that could be understood by other adventurers, I have to be on the lookout for other adventurers. [Understood. But Yuuya, Erik doesnt have a coat Erik, if it rains be sure to enter Lunas raincoat!] (Luna) [Kyu!] (Erik) This should be enough preparation before our departure. Lets begin our departure. [Yuuya-ojisan. The quest I accepted in the guild was to gather meat from Paradise Birds.] (Selene) [Ah. The Paradise Birds appear in this dungeon. Normally the meat dropped by monsters are roughly categorized as Beef and Pork. However there are rare cases where the meat has a unique name. For those cases, the meat itself is a delicacy. One of those meat belongs to the Paradise Bird, typically served as a special dish in the upper echelons of luxury for Grannel. I havent tasted it myself, but Ive heard that it tastes exactly the same as its name, like paradise.] (Yuuya) There were many people who visited Grannel just to eat this special dish. Just as you would expect, I did encounter the item in the past however as I was more concerned about my financial status I sold it. This time however I am curious about its taste. [Luna wants to go to paradise!] (Luna) [Uhn Uhn. I want to taste it too. We definitely have to get it. Itll be our dinner tonight!] (Til) [The two of you should listen carefully. Our quest is a gathering quest and that takes priority. Although if were able to obtain more than required for the quest, well be able to enjoy it too.] (Phil) [Luna will do her best!] (Luna) Luna perked up her fox ears and began searching around. Whenever food is concerned, her motivation increases by another fifty percent. [Now then, lets begin moving forward. We arent the only ones targeting the Paradise Birds. Above all, its meat sells at a high price. Everybody who is capable will be targeting it. Itll be a scramble.] (Yuuya) This was the reason why the adventurers attitudes flipped around as they rushed towards the depths of the jungle. Everyone was eyeing to hunt the Paradise Birds to make some quick cash. In other words, everyone is our enemy. Our main weapons were our mobility, Lunas Presence Detection and her Increased Drop Rate. Lets earn as much as we can today using our specialized Thief and her exploration skills. . . . We are currently walking within the jungle. Due to the heavy downfall, the soft soil turned into mud as our ankles began sinking to our ankles. [Its difficult to move.] (Luna) Luna had a tense look as her main weapon, her speed was being affected. Lunas fox ears began twitching out of the blue. [Its here! A bird-shaped monster. But something is wrong. I feel it there by the tree but theres nothing there.] (Luna) [No, youre right. Look carefully. Its on that branch.] (Yuuya) [Ahh. I understand. The bird is perched on the branch right there. It has the same colour and shape as a leaf. It looks exactly like a normal leaf.] (Luna) For male Paradise Birds, they stood out prominently with their gaudy coloured bodies while the females camouflaged into their surroundings like this. Thanks to this, the male Paradise Birds were often hunted by adventurers for their meat while the females were left relatively untouched as they went by unnoticed. [Til, can you hit it from here? If we get any closer than this, itll notice us.] (Yuuya) The distance between it and us wasnt that far however our footing was unstable due to the mud and the trees were dense here. Firing arrows in this condition would be akin to threading a needle. [Fufufu. Who do you think youre talking to. Something like this can be done even with my eyes closed. Look at this.] (Til) Til was full of confidence while Phil seemed to be uneasy watching her behave like this Or rather, she didnt seem that worried as Til reached out for an arrow. Til continued to fire with her usual elegance as her arrow flew cleanly through the vegetation towards her target. However, the arrow was slightly off as it pierced through the branch, shaking it. The Paradise Bird took off in surprise as it tried to escape towards the sky. However before it noticed, Phil immediately took out her bow and arrow, firing two arrows which seemed to home towards its body, piercing it before falling towards the ground. [It wont escape.] (Phil) Phil acted so quickly that I wouldnt be surprised that she had expected Til to miss. She was certainly expecting this outcome as Til grasped her bow tightly. [What is this!? I did it as usual. I read the wind correctly.] (Til) [You missed precisely because you fired it normally. You werent able to read the power of the wind correctly. The environment here is very humid making the wind heavier than usual. This shows that youve never fired an arrow in this climate before.] (Phil) Til seemed tongue tied as she began to close her eyes, trying her best to grasp the feeling of the wind blowing past her body. [So this is what you mean. I still have a long way to go. However I wont miss the next one.] (Til) [If its you, then Im sure youll get it once you try it out several times. The important thing to confirm your surroundings as compared to firing everything as usual.] (Phil) Til continued to ask questions. Phil was as great of a teacher as I expected. Knowing her I can leave Til in her care with confidence. [Meat.. I guess not.] (Luna) Luna proceeded towards the location where the two elven sisters defeated the Paradise Bird however she turned around dejectedly, walking slowly back towards us. This couldnt be helped as the meats drop rate was so low that even with Increased Drop Rate it was incredibly unlikely. [We dont have time to idle around. The more time we waste, the more Paradise Birds will get hunted by other adventurers.] (Yuuya) [Uhn. Lets continue searching.] (Luna) For all we know, the male birds could have already been wiped out. Its just a matter of how many female birds will be overlooked by the rest. Well have to be incredibly lucky to get the meat no matter how much we want it. Just as we continued our hunt, heavy winds and rain began to pour as if a bucket was flipped over the sky. This was perfect as there were some places that we wouldnt be able to access without the rain and it was about time for us to head there. Supposing no one has accessed the area yet, the Paradise Birds in that area will be ripe for the taking. Volume 4 Chapter 10 - The old man climbs a cliff. We entered the hot and humid jungle in Grannel where squalls and heavy downpour occurred excessively. Just as expected, a squall occurred just as we entered the dungeon. Thanks to the horrible weather, our visibility was effectively zero making it impossible to advance deeper into the jungle. Instead we looked for the largest nearby tree, hiding under its reach to seek shelter from the rain. Despite this, Luna and Til were still in high spirits. [Yuuya, Yuuya. Look at my cute raincoat!] (Luna) [The rain is unexpectedly fun.] (Til) The two of them enjoyed putting on their newly bought raincoats. Phil and Selene on the other hand, didnt enjoy the rain in the slightest. Their reactions were much more reasonable as heavy rains were disastrous for adventurers. Firstly, at this level of downpour our vision is effectively cut off and rendered ineffective. Second, the sound of the rain drowns out any nearby noises and even washes away any smell lingering in the area. With our eyes, nose and ears being ineffective against our enemies, we may as well be defenseless. [Luna, no matter the circumstances do not turn off your Presence Detection. This rain is extremely dangerous.] (Yuuya) [Uhn? But I cant sense anything at all. Wouldnt the monsters be the same?] (Luna) [What you just said is the most dangerous thing yet. Think about it from another perspective. In this situation where our eyes, nose and ears arent reliable, our actions are affected and limited. For monsters who live in this environment, they are likely unaffected by the rain. How much of a threat are they to us?] (Yuuya) [That sounds dangerous.] (Luna) [Yuuya-niisan, isnt that dirty. In this rain even though I dont have the confidence to shoot my bow. Even my lightning spells cant be used. If I was as good as my sister then maybe I would be able to do something.] (Til) [Thats not true. If it was just a drizzle then it should be alright but with rains this heavy, I think the maximum distance I can shoot is only thirty metres.] (Phil) Although a distance of thirty metres is the distance a normal archer could guarantee to land in perfect condition in the perfect environment. Til and Phil were abnormal in retrospect as they could easily land arrows a hundred or two metres away [Yuuya-ojisama, how would the monsters be able to see us in this weather?] (Selene) [Its simple. Using Presence Detection. There are also monsters capable of using it from time to time.] (Yuuya) Monsters capable of using the same skills as us also exists. Albeit rare there are still monsters capable of using Presence Detection. Among those monsters, the most famous is the Silver Slime. It was a monster which gives an insane amount of experience once defeated, as if you had just defeated the boss of the dungeon. Essentially everybody wanted to defeat this monster, however with Presence Detection it escapes from its predators with incredible speed whenever it senses danger. Furthermore, its much more difficult to defeat the monster let alone keep up with its speed while its escaping. The only known way to defeat the Silver Slime was to corner the monster by cutting off its escape route, chasing it into a dead end and attacking as hard as possible using your strongest skill with a critical hit. Without a party capable of using Presence Detection and Assassinate together, its pretty much impossible to defeat the monster. [I understand! Luna will do her best using Presence Detection.] (Luna) Although Presence Detection didnt drain its users mana to activate, it does place a huge mental strain onto the user making it difficult to maintain for a prolonged duration. However in this rain we can only rely on Lunas Presence Detection. Well have to do our best. . . . I began to feel drowsy as I continued to listen to the sound of the rain. The water on the ground wasnt being drained quick enough as the mud pools on the ground had piled up, merging into a gigantic shallow mud lake. Due to this, we had no choice but to switch to our waterproof boots. It was a lot heavier than our usual footwear and slowed down our mobility significantly. [Yuuya, theres a monster approaching us from the back.] (Luna) [What kind of monster?] (Yuuya) [Probably a cat?] (Luna) [The monster I was hoping wouldnt appear is here. It isnt a cat. Its a Squall Panther.] (Yuuya) It was a monster who utilized its Presence Detection and the frequent squalls to sneak up on its prey. It sneaks up within the storm, targeting its unsuspecting prey neck with its razor sharp fangs. It was an intelligent monster which hid in the shadows during the clear weather and became active once it begins to rain. [Everyone, do not turn back. Its a cowardly monster. Once it realizes that weve noticed its presence itll definitely escape. It may be a difficult monster to deal with but well definitely defeat it. It also drops desirable items for us.] (Yuuya) Since it was a monster that only appears during the rain, adventurers would not encounter this monster often and even if they did, it was a monster that only appeared whenever it was confident of its kill. [Yuuya, it is only 10 metres away from us. Its slowly approaching us with silent steps.] (Luna) [Youre lying. I cant sense its presence at all. And Im pretty sensitive to the presence of others.] (Til) [Were in this rain after all so it cant be helped.] (Phil) Although we were currently within a rainstorm, it was still impressive that the monster couldnt be detected by Til and Phil who were elves with sensitive senses. That was its natural ability it possessed being born as a panther. [Another 5 metres.] (Luna) [Who is it targetting?] (Yuuya) [Phil. It feels like its looking towards Phils neck.] (Luna) [Understood. In that case, well continue to move forward to hide our intentions. Selene stay next to Phil and the moment it pounces, youll intercept it using your spikes.] (Yuuya) [I understand.] (Phil) [Ill make my preparations.] (Selene) Selene seemed to be nervous as she began clutching her shield. Since we were unable to turn around, we had to focus our nerves behind us. It was likely too close for Luna to give us any signal since our voices could reach its ears. The moment it was within two metres, I finally caught a glimpse of the Squall Panther. However, what I noticed wasnt its figure but its murderous intent as I was particularly sensitive to it. Taking advantage of its body structure, it leaped into the air, masking its actions using the strong winds. Selene who was next to Phil turned to the side as she held Renoirs shield into the air. [Shield Bash!] (Selene) Using the strength of her entire body, she stuck out Renoirs Shield, releasing a spike into the Squall Panther who was about to bite into Phils neck, blowing it into the large tree we used to seek shelter. The Squall Panthers body began conversing as it laid on the ground, turning into blue particles several seconds later and leaving behind its pink skin. [Fuu. Somehow I actually defeated it. I was worried that Phil-san would get injured to my incompetence.] (Selene) [I knew that I would be safe since were talking about Selene after all.] (Phil) Though it may sound like it, Phil wasnt speaking words of flattery as she was a veteran explorer with a reliable sense of evaluation. She wasnt naive enough to leave her life into the hands of someone she couldnt trust. [Yuuya, that was a vicious monster.] (Luna) [Uhn. It look extremely disgusting too.] (Til) [That was the result of evolving into a predator specialized in assassination.] (Yuuya) The Squall Panther was covered in pink skin with a rubbery texture. Since it didnt have any hair it wasnt bothered by the rain and could move around easily in the rain and mud. Furthermore it didnt have any eyes, nose and ears with a huge mouth. Since it evolved to rely on Presence Detection, its other organs werent necessary and had deteriorated severely. [Weve gotten a good souvenir though.] (Yuuya) [What are we going to do with that rubbery skin?] (Til) [If we use this to craft an armor, the end result is a piece of equipment highly resistant against the lightning element. Eventually among the three dragons, well need specialized equipment against them. Against the Wind Dragon, well need to have lightning and wind resistant equipment before we challenge it. Without it, it wouldnt even be a battle.] (Yuuya) The Coronoa Dragon which took us a difficult battle for us to defeat was actually the weakest among the three dragons. However it was still possible to defeat it without any flame resistant equipment. Unlike the Coronoa Dragon, the other two dragons were impossible to defeat without it. [Yuuya-ojisama. I dont really want to imagine myself wearing equipment made of that pink skin.] (Selene) [Just as Selene probably imagined, the equipment will turn out as a rubber suit which sticks to your skin. Its colour will likely remain pink just like its ingredients. Well its look aside, its performance is excellent too.] (Yuuya) Even during the game era, the equipment was also avoided due to its appearance however it was still worn despite that due to its good performance. [It doesnt just nullify the Wind (Lightning) attribute, but it is also light with high defensive properties. It has a high level of resistance against blunt attacks while providing some protection against sharp attacks. Very few equipment in existence were blessed with such properties .] (Yuuya) [I see I see. But Ill have to refrain from that. It isnt just embarrassing but doesnt that equipment classify as a piece of clothing? In that case, I think itll be better for someone who wears light equipment rather than armor to have it instead.] (Selene) That was a rather blunt excuse but a sensible one as well. I turned towards Phil. [Ehh? Is it going to be me? For me.. Well. I have my highest ranked equipment that I kept from our previous adventures. My equipment is pretty amazing you know. I could live peacefully for the rest of my life if I sold this on the market.] (Phil) What Phil said was true too. Her equipment could be said to be the best set possible for a bow-user. In fact, the pink rubber suit was probably inferior by several levels compared to her equipment. The only person left.. [Uhm.. Yuuya-niisan, are you going to make me wear that!? Ill look like a pervert!] (Til) Til began shaking her head forcefully however unlike Selene and Phil, she had no reasonable excuse to avoid it. Since its already at this stage, should I just make her wear it? [Uhn. Luna wants to try it! It looks interesting! Luna wants to try putting it on.] (Luna) Luna began wagging her fox tail with shining eyes as if it was a lie that she felt uncomfortable looking at the Squall Panther. Actually, it would also be better for our partys balance to have the front-guard wearing the Wind (Lightning) resistant equipment. [I understand. In that case, the clothes made from this will be given to Luna.] (Yuuya) [Hurray! Luna looks forward to it!] (Luna) Im looking forward to seeing Luna in a tight rubber suit, however what is this guiltiness rising up from my chest? Just as we resolved the matter about the rubber suit, the rain began slowing down. Its about time for us to continue moving forward. . . . As the weather cleared up, we decided to continue travelling deeper into the jungle. After walking for a little while, Luna found another Paradise Bird as Til shot it down with an arrow, displaying her amazing learning ability. Although the strength of the wind was different when compared to the previous squall, she had adapted well to the environment. This time however, we managed to obtain a lump of Paradise Meat as the two girls performed their usual mysterious dance. The moment we reminded them that we needed to find a total of three Paradise Meats for the quest, they froze halfway through their performance with an extremely hateful look. The scene had made for an extremely interesting sight. We continued forward until we reached a dead end, arriving at a cliff wall with a height of over 100 metres. Just then, Lunas fox ears began twitching. [The top of the cliff. Presence Detection is telling me that there are four Paradise Birds up ahead. Since there are four right up ahead, it feels like there will be many more up ahead.] (Luna) [*Slurps* If thats the case. Then we have no other choice! Since the skys getting darker, well barely be able to complete the quest otherwise!] (Til) Til was right. If we wanted to get enough meat to try it out for ourselves, well have no choice but to overcome this cliff. [The two of you. Please calm down. Its fine for you to try your best but itll be a huge mistake for you to climb the cliff. Please take a look.] (Yuuya) I placed my hand on the cliff and wiped the surface of the soil, revealing a steel wall. It was impossible to get a firm grip onto the soil and neither is it possible to stick a knife into a steel wall. Just as one would suspect, it was impossible to scale a steel cliff. [Luna doesnt want to give up. Just beyond this cliff is tonights dinner!] (Luna) [I want to try the Paradise Meat and go to paradise~~. Even though the delicious meat is in our grasp, I dont wanna eat more preserved foods!.] (Til) The two girls continued to stand on the cliff with despair as if it was the end of the world. It should be fine though as Ill be able to teach them how we could overcome the steel cliff without much trouble. Truth is, this cliff could easily be overcome by using a gimmick utilizing the stormy weather. However, just as I was about to act, Phil nocked an arrow with a hook at the arrow head and at the bottom, a magic rope was tied to the arrow. [Its height is about 123.43 metres. My rope should be enough and so is my range. Although Im unsure about my strength.] (Phil) Phil fired three arrows into the air. Since all three arrows had hooks and were connected to the same rope, the arrows flew in a parabola over the cliff as Phil pulled down onto the rope causing it to stay taut. [With this, well be able to climb up with ease. Now then, lets go ahead and collect our dinner.] (Phil) [Phil is amazing! I love you!] (Luna) [As expected of onee-chan! Im getting goosebumps!] (Til) [That is an amazing display of skill. It is incredibly difficult to fire and place the three hooks in place accurately while pulling down the rope at the precise timing.] (Selene) Even before I got to explain the gimmick of the steel wall, Phil surpassed everyones expectations with her ridiculous archery skills. [Since itll be dangerous for all of us to climb simultaneously, Ill go on ahead. Once I arrive at the top Ill reinforce the hooks to make it more stable. Looking at the weather, it shouldnt rain for awhile longer. This is our chance.] (Phil) Phil began climbing the rope and within the minute, she had already arrived at the top of the cliff. After arriving at the top, she continued to secure the rope as Luna and Til also displayed their excellent physical capabilities as they climbed to the top of the cliff within several minutes. Although Selene was following behind them, she wasnt as fast and had the riskiest movements out of all of them. [Yuuya could you please hurry up. Luna-chan and Til have already gone up ahead to hunt the Paradise Birds. They were afraid that the birds would escape if we took too long.] (Phil) [Ahh. Is that so.] (Yuuya) Although we still managed to scale the cliff, what is this sense of reluctance Im feeling? It feels strange. Even though the gimmick I knew made use of the rain, I had expected to wait awhile for the rain to arrive however even without waiting for the rain, Phil managed to overcome the cliff immediately. What is this sense of regret that is welling up within me although were able to begin our hunt much earlier? [Once the squall arrives, blowing away all the mud and soil on the cliff. There will be a hint that appears which will reveal a hidden door. Once you discover and solve the hint, itll be much easier for you to climb the cliff.] (Yuuya) Even though there was no one around to hear it, I explained how the gimmick functioned. Its a good thing though as there wouldnt be the need to go to the trouble of solving the hint in the midst of the bad weather. This method was much easier too. [After overcoming this cliff, the area will be filled with Paradise Birds. Although it was fairly difficult to get the Paradise Meat to drop, the birds themselves gave large amounts of experience that didnt fit with their levels, allowing us to earn a large amount of experience points. After clearing the difficult entrance, well be able to access a bonus stage with tons of experience and items that we can hunt.] (Yuuya) However, there wasnt a need for me to explain this as the two girls already had their hands full trying to hunt as hard as they can. After climbing the cliff, Luna and Til turned around and ran towards me. [Yuuya, tons of meat! Theres already four that dropped!] (Luna) [If we manage to hunt all of them then well be able to eat as much as we want!] (Til) With sparkling eyes and a face full of smiles, the thought of explaining the gimmick didnt matter to me anymore. [Yes, lets eat plenty together tonight. Since the best place for the meat to belong to is the frying pan. Itll make an amazing broth. This will be a great time for us to cook the freshly harvested rice we purchased at Grannel.] (Yuuya) [Hot pot! Porridge!] (Luna) [Uwa! Sounds amazing!] (Til) Thus began the second mysterious dance. However this time, they wouldnt be interrupted as they would be able to eat as much Paradise Meat as their hearts desired. [Yuuya, will we be camping out here tonight?] (Phil) [Thats right. Its already the evening and were too far away to head towards the magic vortex to return. Since were already in a good hunting ground, trying to return to the inn is wasteful. Lets just stay here tonight. Lets hurry up and set up our tent since itll be dark soon.] (Yuuya) [I understand. Then Ill properly pick up the wild herbs in the area and make a delicious pot of soup for everyone.] (Phil) I let out a smile as I wanted to try out the Paradise Meat too albeit not at the same level as Til and Luna. Im starting to look forward to our dinner now. Volume 4 Chapter 11 - The old man is requested. My initial plan was to set up camp in the jungle next to the cliff, waiting for the rain in order to overcome the cliff using a gimmick. I had zero intention of turning back and returning home, especially when the hunting ground was right in front of our eyes. A large number of Paradise Birds lived in this area and their meat tasted so good that youll be sent straight to paradise,and their experience value was in the same league. Just defeating one of them provided a large amount of experience. This was the league of the area dubbed the Bonus Stage in the game, it may even be possible for us to raise our levels sometime today or tomorrow. In terms of camping grounds, there isnt a place any better than this deeper into the dungeon as there werent any monsters here apart from the Paradise Bird. Furthermore, we were the only few people who currently had access to this area. Trying to solve a mystery in the midst of a harsh squall when you could barely see anything in front of you, especially one hidden on the cliff which would likely be discovered only if you had prior information about it. Its not surprising that nobody else was here right now. . Although this time, the gimmick was bypassed by Phils ridiculous archery skills. No other party was capable of repeating this feat. [Meat! Meat!] (Luna) [Onee-chan. Hurry hurry!] (Til) Luna and Til were making a ruckus while watching Phil begin her cooking. Phil began unwrapping the Paradise Meat covered in bamboo skins as item drops are usually covered by bamboo skins. As she started to unwrap the meat, a delicious smell began spreading through the area. A strange smell that was uniquely delicious, as if the blood itself was sweet but there was no smell of decay in it at all. [Meat looks so beautiful! Luna, wants to eat it now.] (Luna) The colour of the meat was a beautiful ruby red, the skin extremely glossy while the fat was thick and appetizing. [Please wait for a moment. Ill begin cooking it right away. Ill prepare it the way Yuuya taught me to.. However I dont have much confidence if itll be that good, making a broth without any stock.] (Phil) Phil placed the Paradise Meat into a pan, lightly frying it as she filled a pot with water and began boiling it. Then, she placed several wild herbs into the pot before cutting the meat into bite-sized chunks and throwing them into the pot. Normally, Phil would prepare her broth by using several dried mushrooms. However, since we were using the Paradise Meat this time, she had skipped over this step. Its said that the delicious soup made from the Paradise Meat would be ruined and turn cloudy if other soup stocks were added in excessively. Phil continued to watch the fire while carefully removing the skum from the soup. [Yuuya, Yuuya. The delicious smell is getting stronger!] (Luna) [I know right. I cant wait to eat it.] (Til) Luna and Til continued staring into the pot as they smelled the fragrance of the soup. Lunas fox tails were rapidly wagging back and forth while the tip of Tils elven ears began turning red. Just the fragrance of the soup alone were making these two children go crazy. After the meat was cooked, Phil tested the taste of the meat. Phils entire body stiffened as she touched her lips with the tip of her finger. Just watching her actions felt strangely erotic. After awhile, Phils consciousness returned as she continued to test the taste of the soup. Luna and Til became even more curious about the taste but Phil merely smiled playfully in response. The only thing I could decipher was that it tasted extremely delicious. Above all, the fact that the food-loving Phil had only added salt after her taste-test was a testament that the soup was perfect on its own. Our expectations for the soup had risen to its peak. [Its ready now. Please take out the kitchenware.] (Phil) It was finally time for dinner. We can finally taste the Paradise Meat. . . . Dinner had finally begun as a large bowl filled with mountain vegetables and Paradise Meat with another bowl of soup was placed on the table. [My stomach has been starving!] (Luna) [Uhn uhn, my stomach is running empty now too. I wonder if well actually go to paradise?] (Til) [Lets start our meal before it turns cold.] (Selene) [Please do so while its hot. Youll be surprised once you taste it.] (Phil) The girls began to chat as I decided to start the meal drinking the soup. The soup made from the meat of the Paradise Bird and mountain herbs produced a rich taste as the flavour of the meat and melted fat in the soup spread throughout my mouth. Not only was it delicious, but it was an amazing tonic for the human body as well. As I was resisting the temptation to drink the soup in one go, a piece of meat accidentally entered my mouth. I felt the tenderness of the meat as more of the meats juices flowed out with each bite, spreading the taste of the skin and fat throughout my entire mouth. I couldnt help but agree with the ingredients ridiculously high price as this taste was something the wealthy would travel just to have a taste. [Delicious!. Luna thought that beef and pork were more delicious than chicken but, this chicken is special!] (Luna) [I know right. Meat was delicious too but its my first time drinking such a delicious soup! I wanna drink more!] (Til) Luna and Til had stuck together as they emptied their bowls and presenting it to Phil. [Seconds! More soup please!] (Luna & Til) They were perfectly in sync as they asked for seconds. Their large appetites wasnt anything new as they were two growing children. [Im fine with seconds, however remember that there wont be enough soup for later if we drink it all now. We wont be able to try the delicious porridge that Yuuya told us about.] (Phil) [Uuwuu, lesser soup then.] (Luna) [Even though I would like more soup, Ill endure it for more delicious food!] (Til) Phil let out a wry smile as she took out a large serving of vegetables and meat. However, the food didnt last long as Til and Luna began gobbling down the food once more. Would they even be able to try the porridge after this? As I turned to the other side of the table, Selene was done with her first serving although she hadnt asked for a second serving since the porridge was mentioned earlier. I wonder if it was okay to make the porridge. [This soup is superb. Although the Paradise Meat was served to the royal family several times.. It tastes much more delicious.] (Selene) [Of course, compared to a suffocating meal in the palace, its much more enjoyable to eat it with your friends. Plus Im sure the cooks were stressed preparing meals for the royal family. They wouldnt be able to make a dish as plain as this. For this dish especially, itll taste much better without any excess preparations.] (Yuuya) [Its just as Yuuya said. As a chef this dish induces anxiety into me as its unsettling to serve a dish with minimum preparation. Even now I have the feeling that I should have done more for the dish.] (Phil) Regardless, even the sauce for a normal hot pot is excessive when dealing with this dish. Thanks to the two gluttons, our hot pot became empty as it was finally time for the main dish. Phil began pouring the rice into the empty pot as the rice began to swell with the boiling soup. As the soup continued to boil, it gradually grew thicker as its delicious smell became even stronger. The sound of someone swallowing their saliva could be heard as we were finally able to have a porridge made with Paradise Meat. Without anyone saying anything, Phil began pouring several bowls of porridge and handed them out as everyone began their second rounds. No one said a single word as everyone was relentlessly gobbling up their food and in no time at all, everyones bowls became empty. [Fuu, so this is the porridge with Paradise Meat.. Its even better than I expected.] (Yuuya) Just this one dish was filled with all sorts of flavours. Even if it was just a normal soup, it was still a perfect match for the freshly harvested rice from Grannel that I couldnt get away from. [It was delicious! Luna is going to paradise!] (Luna) [Me too! Heading to paradise isnt just a saying. Its so delicious that it feels so good as if Im in heaven.] (Til) [This makes me wonder just what kind of cook prepared the soup Ive eaten till now.] (Selene) [Its a shame that we dont have seconds. However we do have some meat left in stock so well be able to enjoy it tomorrow.] (Phil) Well be able to enjoy ourselves tomorrow too. However, there are still other dishes I plan to eat tomorrow as this soup was capable of drawing out the hidden flavours of the Paradise Meat. The true charm of this soup has yet to be seen as it has hidden a lot of different dishes. After eating such delicious porridge, the atmosphere felt lighter as everyone became excited. Furthermore, even though Phil said that we had extra meat leftovers for tomorrow, she proceeded to present a lean cut of meat from the Paradise Bird that she secretly prepared. It was presented as a steak cooked rare with a special sauce which caused me to crave for sake. It was going to be an enjoyable supper although people avoided late night food while camping out. This was the luxury of a safe zone in the dungeon. . . . Since a squall was going to arrive, we proceeded to enjoy the supper in our tent. With the Paradise Meat which could be eaten raw, when cooked rare with a delicious sauce its delicious meat presented a taste that could only be tasted with a high quality of meat. Currently, the two girls were asleep as they both had a weak alcohol tolerance. They each had extremely blissful sleeping faces while Phil began preparing another tent for Luna and the girls tonight, leaving me alone with Selene. [Selene, theres something I want to ask. Is your elder brother strong?] (Yuuya) If possible I would like to know about my enemy before the actual battle begins. [Hes very strong. He too received training with the stone from a young age and his level might even be higher than mine currently. Furthermore he had a good battle sense with smart intellect. He was someone I had idolized after in the past.] (Selene) It was surprising to hear that Selene had idolized her brother in the past. According to her, if her brother was to gain control over the Laluzulu Kingdom, the people would definitely suffer and thus she planned to challenge him for the right to the throne in order to pass it to her sister. [If its someone that you had idolised someone in the past, then wouldnt it be fine to leave the kingdom to him? That way youll be able to leave your kingdom in good hands while remaining in our party. For most likely the rest of your life? The Selene Im seeing now looks much better than Princess Lutra from before.] (Yuuya) [Fuu, that sounds plausible. I would definitely be happy if I could do that. However, my brother who was kind-hearted to everyone including me, has changed. Several years ago, rumors about his self-centered shenanigans had spread throughout the kingdom, replacing his initial reputation. Then, he began keeping his distance from me. My brother who was filled with greed and an obsession for power, began to respite me, who was born as the splitting image of Renoir-sama with her silver hair.] (Selene) Selene looked into the distance with melancholic eyes as she began talking about her brother. [For better or for worse, people change. Im sure youre still harboring hope that hell return to his old self. If thats the case, then Im sure he will return one day. However, theres something strange. Is his level really higher than your current level? Furthermore isnt the training he received the same training you did?] (Yuuya) Ever since Selene joined our party, we began raising our levels several times faster than an ordinary adventurers which was why its surprising that her level was still inferior to his. [Me and my brother are the same and yet were different. My mother was a concubine. After my brother left me, my brother who could access the dungeon and proceeded to receive training from the royal knights. On the other hand, I could only rely on my mothers side for training and the only dungeons I had access to were the public dungeons.] (Selene) I hadnt realise that Selene had such a complicated family situation. This explained why she was found hunting inside Greenwood. Just as she mentioned, it was known that the royal family had an exclusive dungeon which could let you hunt to your hearts content without dealing with other adventurers. In terms of efficiency it was an excellent dungeon as well. Furthermore, he was taught by the royal knights which was a family specialized in their sword skills that was refined over several generations. [He definitely sounds formidable. The other party has so many advantages over our side. However, theres something else I want to ask, is this instructor, the royal knight better than me?] (Yuuya) [Fufu thats not true at all. Yuuya-ojisama is the number one instructor in the world.] (Selene) Selene let out a small laugh in response, displaying her beauty and her charm as a woman. Luna and Til were both cute girls however, in her case she was the definition of beauty. [I pray for Selenes victory. Selene will win the succession ceremony, and Ill win the knights tournament and become the strongest knight. That is the reason why were heading towards the Laluzulu Kingdom.] (Yuuya) That was what I decided. And I will do everything in my power to make that happen. [ Ever since I decided to fight my brother, Ive never been able to sleep. Regardless of how exhausted I was, just thinking about the future makes me anxious. But the moment I met Yuuya-ojisama again, Ive started to sleep again. My anxiety seemed to just melt away.] (Selene) [That is the confidence having a good teacher can give you.] (Yuuya) [It isnt just from a teacher. It isnt just that. Its because its Yuuya-ojisama that I can rest easy. Yuuya-ojisama. If I were to say my true feelings after everything is over, would you answer me?] (Selene) Selene closed the distance between us as a sweet smell wafted past my nose, it was also a smell of reason. [I..] (Yuuya) At that moment, the sound of footsteps began to approach as Phil was done setting up the tent for Luna and Til. [Half of it was a joke. Half of it was serious, and the other half was serious too. However, I dont have the intention of troubling Yuuya-ojisama. Its about time for me to head to the other tent.] (Selene) Selene and Phil grabbed Luna and Til respectively and carried the two of them to the other tent. Sigh this is bad for my heart. That small princess Lutra has become a fully grown woman. I must be becoming too old as I emptied another cup of sake. Its about time for us to head to bed. I should focus on everything I can do right now and focus on raising our levels by hunting tomorrow. That is all that is on my mind now. Volume 4 Chapter 12 - The Old Man heads towards the capital. As expected of the Paradise Meat, ingredients as delicious as this was hard to come by. If there were to be another meat that surpassed this, it would either be another unique meat, or meat of any category that exceeded the Excellent quality, the Special quality. Special quality meats could only be dropped from monsters in the late level 40s and even then, only a small portion was dropped. Even for me, Ive only come across it a handful number of times. This time however with Luna, it could be a reasonable goal to strive for as feeding her more delicious meat could be good for her growth. My skin felt much tighter than usual, due to the effects of the Paradise Bird. Currently we had already cleared out our campsite and began our exploration for the day. [Paradise Bird is the best! Luna wants to eat more!] (Luna) [Uhn uhn. This is addictive Fufufufu, well have to hunt as much as possible before returning today. We have to get some today!] (Til) [Kyu!] (Erik) Luna and Til were burning with motivation. If they are this passionate then Im looking forward to the results of todays hunt. [Luna-chan. Til. The Paradise Meat is delicious but the truth is, there are also other unique meats just like it. At our level, we may come across them if were lucky. Instead of hoping to come across the Paradise Meat, it might be better to focus on searching for other delicious meat instead. ] (Phil) Luna and Tils eyes began to shimmer at the prospect of Phils words. [Uhn! Definitely will eat more delicious food. Weve eaten a delicious chicken meat so next time well eat a delicious beef!] (Luna) [Not just meat, what about delicious vegetables! There should be some that exist right!] (Til) It seems that Tils imagination began running wild at the prospects of unknown food. Several items came to mind at the two girls proclamation. For pork, there was the Pearl Pig while there was the Silk Cow for beef. These two were also famous for their unique meat. For fruits there was the Golden Mango. Each and everyone of these ingredients were considered exquisite cuisine. [There are many of them. For meat, vegetables and fruits. Every single one of them were highly valued on the market and only a small portion of the wealthy were capable of obtaining it. Unless you were one of them, your only option would be to find the item yourself. It might be much more interesting to travel and find them in my opinion.] (Yuuya) [Luna wants to do it. Im look forward to it.] (Luna) [My bow will pierce any prey I see!] (Til) After completing our errands in the Laluzulu Kingdom, well be heading to a town further north called Dirupusuno(ǥץΩ`) to create Lunas new weapon. That town contains several intermediate and advanced dungeons as well as one possible unique meat drop. However the dungeons were difficult to explore and the drop rate of items there were horrendous. As a result, the unique meats existence itself was unknown to the public, making its taste a complete mystery. Even in my case, I only knew about its existence by looking through the list of items in the game although I had merely glanced across its name. Its taste was still a complete mystery however its name sounded delicious. Since were heading towards dirupusuno, it could be a good target to keep in mind. [Now lets end this conversation here. Other adventurers might be able to access this area anytime now. Lets hunt the monsters until then!] (Yuuya) Everyone replied energetically. Hunting monsters in this Bonus Stage will increase our levels quickly. Lets do our best. . . Afterwards, we continued to hunt Paradise Birds using Lunas Presence Detection. Although there were various other monsters deeper into the Bonus Stage, there werent any monsters which could pose a serious threat to us. We continued to hunt monsters until day break and as a result, everyones level increased by one thanks to the experience gained from the Temple of the Primal Flame and defeating flocks of Paradise Birds. Normally, it would take a month to get to the next level making our leveling speed extraordinarily quick. And.. [Big catch, big catch!] (Luna) [Fu~Fun, this must be a Paradise Bird festival!] (Til) Thanks to Lunas Increased Drop Rate, defeating a large number of Paradise Birds would statistically get us a higher than average amount of Paradise Meat. Furthermore, storing the meat into the magic bag prevents the meats condition from deteriorating, allowing us to enjoy the Paradise Meat for a long time. [Phil, although making soup broth with the meat is delicious, it looks like well be able to experiment a lot.] (Yuuya) [It might be a good idea to make skewers with it and grill it over a bonfire with some salt. The idea of chewing its tender meat filled with juices sounds delicious.] (Phil) Til stomach began to grumble as she became hungry just from listening to Phils recipe. Such was Til as she naturally made everyone laugh by her actions. [Its about time for us to return to the town. Beyond this jungle is the magic vortex for us to return.] (Yuuya) We also came across several treasure chests that spawned at fixed locations. In the end, there werent any other adventurers who came to the Bonus Stage. It seems that the adventurers in Grannel didnt know the method to going past the cliff. Until now Ive had the assumption that the number of people who knew about the gimmicks was not zero however it seems that the gimmick has been left entirely untouched. Otherwise this amazing hunting ground would have been monopolized. The monsters in this area were weak and unable to attack from the top of the cliff. Furthermore the item drops from the monster was expensive and provided a large amount of experience. The desire of monopolizing this area couldnt be light as even though we were planning on leaving this city, I had the intention of leaving the day after the monsters were respawned. Although this wasnt possible given our short time frame. [Yuuya, I found a new monster! Its huge, probably a rhinoceros.] (Luna) Luna raised her voice as she warned us about our upcoming opponent, the rhinoceros-type monster. In this dungeon, this monster would be the most troublesome opponent to defeat. Ill have to sharpen my mind for this battle. . . . Several days have passed since we arrived at Grannel as it was already time for our departure. Although we werent able to gain any levels since the second day, we did manage to complete several quests, earning us a hefty sum of guild points and a heavy wallet. Despite extending our stay in Grannel to experience the town entirely while spending luxuriously, our financial gain was still positive. Aside from the first day, we explorations were only light journeys into the dungeons as I decided on spending more time for Selenes training. In the final sprint before her ceremony, it seems that Selene had managed to overcome a wall as she had become significantly stronger. The date for her inheritance ceremony was only three days away as I hurriedly received my Raptors from the stables and connected them to the carriage. [Everyone please get on the carriage.] (Yuuya) Luna and Til who were desperately cherishing their final memories of Grannel by stuffing their mouths full of onigiris, climbed onto the carriage followed by the smiling Phil and Selene who were looking tenderly over the eating duo. [Is everyone ready?] (Yuuya) [Uhn. Completely ready.] (Luna) [Me too.] (Til) [I dont have any issues departing right away.] (Selene) [Everything is prepared here as well. Lets depart immediately.] (Phil) I pulled onto Raptors reins as we finally departed from Grannel. Although our stay here was short, we had accomplished many things here. I can confidently raise my head high, knowing that Ive done all I can before the inheritance ceremony. . . . We managed to arrive at the Laluzulu Royal Capital before sundown. Since it was the Royal Capital, the security was naturally tight as the tall outer wall even bordered around the outer city. Not only does the wall look sturdy, it was enhanced by magic as well. There were also sentries armed with bows keeping watch on top of the wall. I got off the carriage, heading towards the gatekeeper to perform the procedure to gain entry into the city. [Could you show me your entry permit please.] (Guard) [Is this sufficient?] (Yuuya) I displayed my status as a silver-grade adventurer. [A silver-grade adventurer? I apologise. Normally we would have granted you entry however the day of our kingdoms inheritance ceremony is nearing. In this period, you will need an official permit to enter the city.] (Guard) The guard shook his head as he failed to grant me entry into the city. I hadnt account for the fact that the security would be tightened as the ceremony date was approaching. As I turned back to the carriage, I saw Selene who began to approach the gate. At the same time, a second gatekeeper appeared behind the first. It was a man who seemed significantly older as he was out of breath just from running over. [Wait a moment. That man, is the person that holds the title of the weakest strongest knight. One of the heroes who saved the kingdom from danger and Princess Lutras knight, Yuuya-sama! You have to stop him from leaving!] (Old guard) This voice sounds familiar.. [Miruno is that you?] (Yuuya) [Ouhh I cant believe you actually remembered my name ] (Miruno) [Theres no way I would forget a brother-in-arms.] (Yuuya) Although us adventurers played a major party in saving the kingdom, the soldiers and knights of the kingdom had contributed to the battle greatly as well. And this man was one of them. [Thank you for your kind words. Although you were a brilliant forerunner on the battlefield, your feats on the stage were considered a legend. Especially in the finals! Until this day, people including I boast about having fought by your side.] (Miruno) Roused by the commotion, several knights at the rear began to notice us and started to gather as they started to mutter, The weakest strongest knight?, the man who taught the hero Leonard?, the man whose sword surpasses that of heroes?. Things along those lines were being said which was supposed to be flattery felt a lot more like harassment as I became uncomfortable with the situation. [ In any case, would I be able to cross the gate?] (Yuuya) [Of course you can! Is what I want to say but I lack the authority to do so. Could you please wait a moment while I go ahead to receive permission from my superiors.Having Yuuya-sama return to the capital brings tears to my eyes. There is no greater shame as the one who waited the most eagerly for your return, Princess Lutra isnt here with us anymore.] (Marino) [What happened to Princess Lutra?] (Yuuya) [She entered a dungeon in another city together with her personal bodyguard. However she went missing as well as her bodyguard. A search team was sent out but to no avail.] (Marino) As expected, Selenes whereabouts were unknown to the capital however I was extremely curious about the aforementioned knight. It sounded like the knight was forcefully eliminated to prevent any information from leaking. For the time being, I decided to wait patiently for the decision from the guards as Selene walked to my side and pulled onto my sleeve. She spoke at a volume where only I could hear it. [Are you fine with that Selene?] (Yuuya) [Yes I am. Regardless I was planning on making contact once we entered the city. In that case, wouldnt it be better to do it here?] (Selene) Selenes words were definitely correct as it would be much easier for us to do it here since itll make the higher ups decision much smoother. Selene walked to the front as some whispers could be heard. As expected of the royal capital, even without her signature hair there were many people who recognised Selenes I mean Princess Lutras face. [Is it possible, could you be?] [She was supposed to be missing.] [But the hair colour isnt right. Princess Lutras hair was supposed to be the same as Renoir-samas.] Selene let out a smile befitting of a princess that she didnt show around us. A soft and beautiful smile which radiated gentleness to everyone around her. This forcefully reminded me that Selene was truly a princess. While smiling, Selene gracefully removed her hair ornament responsible of changing her hair colour, revealing her beautiful silver hair. Even though she was a bonafide beauty with her black hair, her natural silver hair suited her much more. [Tell my father and my elder brother. With her personal knight, Princess Lutra has returned. With the intention of participating in the succession ceremony.] (Lutra) Selene had completely shed her disguise, returning to her original role as Princess Lutra. The gatekeepers reactions were all over the place as some of them were crying tears of joy knowing that she was safe and sound, several had their bodies turning stiff from shock and there were those who nodded in response and began running to fulfill their princesss orders. The die has been cast with this as the battle for the inheritance has begun. From this point on, there will be obstacles appearing in her way as her enemies attempt to prevent her from standing on the stage. And Ill be there to prevent that from happening. Volume 4 Chapter 13 - The old man goes out with the prince At daybreak, we finally arrived at Selenes hometown, the Laluzulu Kingdom. Right before entering the city, Selene had revealed her identity, causing a huge commotion to occur. We proceeded to leave the raptor carriage with the guardsmen and waited in the guest room. Since the guards were convinced by Selenes true identity, Princess Lutra, this became an even larger deal. As a result, their higher ups decided to bring someone capable of confirming her identity. However it seemed that it was a lot more trouble than we thought as it had already been two hours. [Uhn. Im glad. Selene finally returned to her home.] (Luna) Luna was talking to Selene as she accepted the sweets served to her by the guards. The guards were exceptionally considerate, going through the trouble of serving us light snacks as the preparation took a lot longer than expected. [Thats right. Although, I cant let my guard down.] (Lutra) [Selene.. Sorry, I guess you are Lutra now? As Lutra mentioned, we cant afford to be careless. We may even be in the most danger weve ever been. If our opponents was malicious enough, the battle may as well have already begun. They could insist that the Lutra that appeared was an imposter, or even outright attempt to erase any trace of this incident.] (Yuuya) Luna and Til, the glutton duo stiffened up at my words. In contrast, Phil was prepared for battle even before I said anything. Similarly, Selene was prepared for the situation as well. Both of them most likely knew from their own experiences, as a seasoned adventurer and a political figure how dirty the real world was. [Uhn. Understood. Selene can be relaxed. Luna will assassinate anyone who comes close to Selene.] (Luna) [Im here too you know.. Although, in a small room like this, my bow wont be as effective.] (Til) [Kyu!] The duo and Erik seemed to be filled with energy from our short exchange. [Luna, Til, Erik. Thank you. Im glad that you feel that way. ] (Selene) [Although its good to be motivated, the moment a battle is about to break out, I want everyone to use their Return Stones immediately. Starting a battle here is a fools errand.] (Yuuya) Even if a battle were to break out, Im confident that we would emerge from the battle in good condition, however in the event of the worst condition I decided that using our Return Stones was the best course of action. Although the item was used to escape dungeons, its actual ability was to return to its last recorded dungeon entrance. It could also be used outside of dungeons, meaning that we would be able to escape immediately to Grannel. We were already on the verge of reaching level 40. In both me and Phils case, with our special benefits from our reset we were closer to level 50 instead. The girls were similar in our levels however just the stats they gained from their natural levels was enough to show that they were blessed by the gods. Furthermore, they were also naturally talented. They were already well on their way to catching up to me and Phil. [Understood. Luna will do as Yuuya says.] (Luna) [Return Stones are really convenient huh.] (Til) [Thats why their so highly valued. If they werent so highly priced then people would be using them much more often Also, the two of you, were finally in the Laluzulu Kingdom. Her name is Lutra, not Selene.] (Yuuya) [Uhn. But it feels weird.] (Luna) [Right? Weve always been calling her Selene.] (Til) Lutra smiled at their responses. [I feel the same way. Ive gotten much more attached to Selene than Lutra recently. Especially since its a name given by Yuuya-ojisama. I prefer it much more to Lutra.] (Lutra) Lutra began to mention her liking for her alias, however it was time for her to be addressed properly as there were eyes all around us. [In that case, in the Laluzulu Kingdom you are Lutra! On the outside, you are Selene!] (Luna) [Sure, that sounds great.] (Lutra) At this time, the guards had brought over several cups of tea and served them to us. We ensured that there wasnt any poison in the tea using a magic item that was capable of doing so. It was an essential item as our opponents could fairly well be capable of drugging our tea with poison or sleeping pills. After we finished our tea, we heard a knock as the door slowly opened. There were several soldiers escorting a youth dressed in white. The youth seemed to radiate a feeling of warmth as there was nothing to dislike about him. Furthermore his body seemed well conditioned and tanned with muscles that werent unnecessarily large. Such a body filled with lean muscle was an efficient body for someone who specialised in swordsmanship providing the necessary strength without overcompensating. Furthermore there was a strong sense of charisma radiating from his well-featured and attractive face as he looked towards Lutra. [Without a doubt, shes my younger sister. Lutra, Im glad that you returned home safely. I felt my blood rush to my face when I heard the news about your disappearance Even after organizing the search team, there was no news about your rescue. After all this time, Im happy that youre back safe and sound. Truly.] Although I had trouble recalling his name, I finally remembered the name of Lutras elder brother, Prince Aleck. It seems that he had still retained some of his features from when he was young. [Its a pleasant surprise to have my elder brother going out of his way to visit me.] (Selene) [Isnt it a normal reaction for a brother to personally ensure his younger sisters safety? Now, lets return to the castle. Our father is worried about you.] (Aleck) Looking at the warm expression Lutra had in response to her brother, it seemed like this was his honest expression. This was her brother expressing his anxiety over her younger sister whom he thought was gone. [Youre being obtuse. Saying this although youve made countless attempts to harass and obstruct me Im saying this as Im not as good at playing games as you. It was you who threatened the knight into killing me, then proceeded to kill her and brush the incident off as an accident in the dungeon. I wonder if the knights sent on the search team met an unfortunate accident or were silenced instead. Putting myself aside, youre involving and underestimating everyone else around us. One wrong move, and youll be drown in contempt.] (Lutra) Lutra threw a straight punch towards her brother. Although I wouldnt necessarily call her actions correct here, the path ahead of her was going to be thorny regardless. There shouldnt be any particular problems with this. [What do you mean? How would I ever consider harming my own sister? I will admit to hindering your growth. I do have the power for that, after all my dear sisters mother is merely a concubine. However it is ridiculous to be furious just for that. Knowing how to use everything at your disposal effectively to create an advantageous situation before the ceremony and increasing the chance of success is a necessary ability for a king. That is how our inheritance ceremony is designed isnt it?] (Aleck) Suppressing her murderous intent towards her brother who readily admitted to his sabotage while denying his murderous actions, Lutra continued to clench her fists. [I have never once considered putting your life in jeopardy. Dont misunderstand me. Ive only done what I have to, to sabotage you in order to become the king. I still love my younger sister. Once the inheritance ceremony is over, I wholeheartedly wish to return to our former relationship of loving brothers and sisters as well as to compensate for my coldheartedness for our past.] (Aleck) [What are you saying. Ever since we were children until now, all youve done is get in my way while mocking me, not paying me any heed at all.] (Lutra) While Lutra firmly denied her brothers words, it was merely lip service as I felt that somewhere in her heart, she truly wished for her brothers words to be true. [There are two reasons. First, the moment I heard about your disappearance. I truly regretted having our relationship ending like this without having a chance to reconcile and decided that I would speak only the truth once you returned. The second was to solidify my conviction to becoming the king. Would the gentle Lutra from our childhood wholeheartedly dedicate herself to her craft if she knew about my intentions?] (Aleck) After saying his piece, his brother let out a hearty laugh as Luna and the other girls recoiled in shock. It felt like Lutras brother character was much more horrifying than we had heard. [It is far too difficult for me to believe any of your words right now. You arent the only person vying for the position of the king. Im sure that our sister has heard of your wrongdoings.] (Lutra) [Wrongdoings, me? Youre not wrong in saying that I would have to dirty my hands for our kingdom to strive.] (Aleck) [Thats not what Im referring to. Aniue has changed. You werent a person who would succumb to greed and inflict despair onto your people.] (Lutra) Prince Aleck covered his eyes with his hands before seemingly coming to a conclusion. [. I see. I understand now. It must be Aure. It definitely seems like something she would do. Despicable doesnt even describe her. Taking advantage of the fact that I intended to avoid a confrontation with you until the ceremony was over. It seems that I still have a long way to go. I was done in quite badly.] (Aleck) Despite saying such self-deprecating words, Prince Aleck seemed to have an extremely vicious smile. [Our story ends here. Theres a carriage waiting outside. Although its quite a simple carriage, at the very least its ready for a simple parade. Go and reassure the public by showing your face. You are the one who is loved by the public, more so than any of your siblings. This is another reason why I would never put your life in danger. You, known as the reincarnate of the legendary battle princess Renoir, would be the perfect tool to unify the public under our banner, the ultimate weapon of the Laluzulu Kingdom. Itll be a waste if anything were to happen to you.] (Aleck) In such a short amount of time, they worked surprisingly effectively, preparing a parade in this short timeframe. Although he was a prince, he knew perfectly well the limits of his power, grasping the power given by his position and was talented in using other peoples talents as well. He was definitely talented and popular. In the first place, he would had never prepared the parade if it wasnt known that the attention between the public and Lutra was mutual. Is this really the same person who was blinded by his ambition and greed? Something feels off here. Prince Aleck walked in front of me and lowered his head. [Its been a long time, Weakest Strongest Knight, Yuuya Grandwood. Not only have you saved our country in the past, but you have saved my younger sister. As the first prince of the Laluzulu Kingdom, thank you from the bottom of my heart.] (Aleck) His movements were refined, displaying his position as a prince even in the form of a bow. [ I only saved Lutra because I wanted to.] (Yuuya) [Even so, Im grateful. Im certain that if you werent around, then Lutra would most certainly be dead. As expected of her knight. If its possible, I hope that you can continue to be by her side.] (Aleck) [Ill think about it.] (Yuuya) [I look forward to a favourable response. Well prepare the appropriate honor as well as reward.] (Aleck) [Prince Aleck. You dont have to behave respectfully towards me. You are the prince of a country. If you dont behave so, Ill be in a bind on how I should behave towards you.] (Yuuya) [Isnt it natural for me to be respectful towards my sisters benefactor? However, if you say so, Ill refrain from it. Now then, shall we head towards the carriage? Ill be riding the carriage with you so Ill behave as your guide during the parade since itll be travelling around the town. Our castle has enough rooms and plenty of food so please enjoy your stay here until the inheritance ceremony.] (Aleck) And thus, without being able to come to a conclusion, we headed towards the carriage to begin the parade. The highways were secured by soldiers on both sides, whom illuminated the area with torches in their hands while controlling the crowds of people on the sidewalks. Whenever Lutra raised her hands, numerous cheers could be heard from the public, displaying how popular she was as the icon of the legendary Renoir. Even I, who was standing next to her was receiving a warm welcome. It seems that in this short amount of time, rumors were going about that I was one of the heroes who had saved the kingdom in the past and became a knight of the young Princess Lutra. The rumors were definitely not wrong, however as rumors often did, it also spread the wrong information around, causing people to think that we were also in love or other things along that setting. The parade continued until we arrived at a small hill covered with marble walls, the Laluzulu Castle. Although I had expected otherwise, the parade ended at the castle without any incidents. Afterwards, we were invited to dinner and Prince Aleck decided to join us as well. Although the prince tried to invite the King to dine with us, he refused the invitation due to his ill health and was unable to attend. However, he expressed that he wanted to see to Lutras well-being. As the sudden encounter with the vast public was unexpected, me and Lutra were completely drained as we just hung our heads down. As if everyone had noticed that, the meal started immediately as some idle talk began. After checking for any poison in the food, we received the highest form of hospitality at the dining table with Luna and Tils manners, or lack-of were being tolerated. In the midst of the casual chatting, Prince Aleck continued to inquire about the sword and listened attentively whenever I answered , which usually led to even more questions. He even went further as to ask for a sparring session after the ceremony was over. Throughout the conversation, I couldnt help but feel that the feeling he gave off felt similar to Lutra, raising this uncomfortable feeling in me even higher. Due to my profession, Ive seen several dozens to hundreds of people from different backgrounds especially aristocrats as Ive accepted numerous nominated quests in my previous parties. This in turn made me fairly confident in reading other peoples intentions, however I just couldnt believe that this prince was actually a malicious person. Although I didnt doubt Lutras judgement, it still felt something was off. Since Prince Aleck had taken steps to avoid encountering Lutra, Lutra had only heard of his antics through third parties Would everything be fine if she just defeated the evil prince? It certainly didnt feel that way to me, it was as if there was a conspiracy being concocted behind the scenes. . . . < ??? POV> It was in the middle of the night as a certain figure sat in one of the luxurious rooms available in the castle, holding a pile of documents. In front of it were people from an information agency. That person was reading the documents provided to it, spending several minutes before opening its mouth. [How could this be? Lutra is still alive? Didnt the report mention that she was eaten by the Starfish Larvae? Could it be that she had actually escaped instead?] (???) Infuriated by the report, the person began reprimanding the informant. [That isnt the case. The fact that she was eaten by the monster is the truth. As Princess Lutras personal knights from her mothers influence held her in high regard, it was difficult to trust them. We had someone from our department watch over Princess Lutra and witnessed the princess being eaten whole by the monster.] [Based on what youre saying, are you saying that Yuuya Greenwood cut open the monsters belly and rescued her?] [Exactly. If its that hero then its possible. According to our research, he was someone who had an extremely low status which was his only weakness. However he had discovered a way to overcome even that. On the other hand, his swordsmanship is first hand as he is speculated to be stronger than even the hero Leonard if he possessed an equally high status.] The Laluzulu information department was exceptional. Once they knew about the alias of Selene, then it was easy for them to investigate everything that had happened from the beginning. [ I have read their track record after Lutra changed her name to Selene. It looks like she has somehow obtained different abilities contrary to her disappearance.] The pile of documents in its hands were in fact a list of achievements and quests that were completed by Yuuyas party, Twilight Home that they received from the guild. Not just that, it also contained the estimates from the materials that their party had gathered from the dungeon. There were even testimonies from other adventurers. Just by looking at them, their abilities were left completely unnoticed. Of course this was due to the guilds policy, preventing any personal information from leaking. However it even had the power to bypass this as the man from the information agency opened his mouth. [Whats astounding isnt the level of skill that party possessed based on their achievements alone. From various witnesses, it seems that she was being trained by that Yuuya Greenwood.] [The Weakest Strongest Knight that trained the Hero Leonard. If she received his tutoring Is it safe to assume that she is currently a completely different person?] It instinctively turned to the pile of documents [Yes. Not only is he the teacher of the hero Leonard, but even other adventurers who received his tutelage went on to become top tier adventurers. However, half way through his career he decided to retire, becoming an exclusive adventurer at Rekusa and raising several exceptional adventurers. He is most likely, undisputed in his ability to raising students. Princess Lutra was already exceptionally talented. Its scary to think how powerful she has become, becoming a student of that person.] [Good grief. It feels just like a bad joke, having the dropout from the ceremony turned into its number one candidate. The genius meeting a master, could now stand toe to toe to someone who had exclusive access to the castles dungeon. We will most likely lose if we fought them head on.] It crushed the documents within its hands as it began to concoct a plan. It could not let the situation go on as Princess Lutra would be the king at this rate. It wasnt enough to just work behind the shadows, making their next course of actions simple. Elimination. This time itll be done so perfectly that even a miracle wont help. There wasnt time to wait as the ceremony was quickly approaching, they had to move fast however it was difficult to even hinder Princess Lutra right now. That Yuuya Greenwood was defending her. On the other hand, the castle was its garden. It alone was more than enough to control Princess Lutra. Now then, its time to begin. In order to become the countrys ruler, and to fulfill its goal. Hope you enjoy the start of Volume 4s main arc. Ill be releasing more chapters next week, most likely one chapter every two days or more if I can get them done in time. As always, do let me know if the chapters needs to be edited or if its sloppy. I do apologise for the sudden change in theme as I was fooling around with wordpresss settings and accidentally changed it. The site is long due for a revamp but Ive been kinda avoiding it since I have zero knowledge of web design. Itll probably happen sometime soon or I may just create a whole new site instead. Volume 4 Chapter 14 - The old man meets the princess. We were invited to dinner in the Laluzulu Castle and I was currently in my guest room. The guest room was large enough to allow any visitor or employee to invite their family in and spend their time comfortably. [Se Lutra, is it alright for you to be here? Shouldnt you be in your own room?] (Yuuya) In the spur of the moment, I nearly forgot to address her correctly. Although the castle was supposed to be her home, for some reason, she was currently in my room. [This is just a precaution. Its true that the castle is my home, but at the same time, it is also my brothers playing ground. Even the servants here cant be trusted.] (Lutra) [That is true. Sorry for asking such a redundant question.] (Yuuya) Lutra has been on edge ever since we returned to the castle. To her, this place was the lions den. [Shouldnt you be visiting your sister? You must be hoping to see her.] (Yuuya) She did mention that her intention was to win the ceremony and pass the crown to her sister. She held her sister in such a high regard that she trusted her enough with the crown. [Ive already contacted her. She intends to meet up tomorrow morning. Yuuya-ojisama why dont you come along with me? Ill introduce you to my sister. I wanted to invite the Luna and the rest along however itll likely become too loud.] (Lutra) [I look forward to that. Its your favourite person and a capable one too.] (Yuuya) [Yes. Shes physically weak unlike me and my brother, but in return she has a heart more caring than others and a mind sharper than a blade. I truly believe that she should become the ruler.] (Lutra) Lutra began boasting about her sister. However, I still couldnt get rid of the discomfort I felt around Lutras brother, Prince Aleck. If he was exactly as how Lutra mentioned, then why would he appear personally to confirm Lutras identity? In fact, he was the first person who went out of his way to do so. Since Lutras elder sister was a princess, Im sure that she must be busy, but is there anything more important than your own family? The moment you are able to, you should be rushing to your presumed dead sister to confirm her safety, especially since she was in the castle. Actually, isnt she speaking out too much against Prince Aleck in the first place since Lutra was extremely long trusting of her? Sigh this is turning into a bad habit. If I begin to suspect too much then there will never be an end to this. I should just relax and take a break for today. . . . It was currently in the middle of the night. Sensing a persons gaze and bloodlust, I immediately pulled myself out of the bed, grabbed the knife that I brought with me to sleep every night and began scanning my surroundings. Being an adventurer for several decades, I developed the ability to keep myself semi-conscious while sleeping, allowing me to react instantly to any changes in the surroundings. Only a handful number of people were capable of procuring a safe bed. Without this ability my life would had already been long gone. I threw my knife towards the ceiling without hesitation as I heard the sound of a muffled shriek. [He ran away huh] (Yuuya) Looks like Lutras conjecture was spot on, this place was indeed the enemys playground. Since this was a castle, you couldnt reliably send an assassin unless it was a top tier assassin. Thus, in order to confirm it, I threw my knife towards the ceiling, knowing that an expert assassin would dodge it. If the assassin couldnt dodge something at this level, then it certainly wouldnt be able to sneak into the castle unnoticed. In other words, the assassin received guidance from the inside. Even though Prince Aleck seems suspicious, he was without a doubt a first-class swordsman who could understand the extent of Phil and my abilities. He would had judged that an assassin of such level would not be effective. In other words, there was another existence in the castle that was trying to eliminate Lutra. [Im starting to get worried for her safety.] (Yuuya) Thanks to the sudden encounter, blood was rushing to my head causing me to be wide awake. Deciding to cool my head down, I grabbed my coat on the side of the bed and headed towards the veranda. . . . After entering the veranda, I immersed myself in the view from the castle. Although I was only on the third floor, the castle itself was situated on a hill, providing beautiful scenery as the sun rose from the horizon. [Yuuya, seems like we encountered some trouble right from the beginning.] (Phil) [Yeah.] (Yuuya) I wasnt the only one who was woken up by the bloodlust earlier as I looked back into the room. Luna and Til were still sleeping soundly with satisfied grins as Selene continued to sleep with a stiff expression. They were still far too inexperienced. [Who do you think is the mastermind behind this?] (Yuuya) [I cant draw any conclusions this early yet. I do think that it cant be the prince. I agree that the wind that he carried wasnt malicious in any way and I highly doubt he was lying when he said that he cared about Lutra.] (Phil) [I agree completely. good grief. It would be so much simpler if he was the mastermind behind this.] (Yuuya) Nothing is more troubling than not knowing the identity of your enemy. [I feel so too. Yuuya, lets head back in. Its getting chilly out here.] (Phil) [Youre right.] (Yuuya) As usual, Phil leaned over for a kiss as there were rarely moments when we were alone. Although my reaction was slightly cold, I couldnt deny that this was nice too. . . . The next morning, after enjoying my breakfast in the room, I headed towards the courtyard where I would be meeting Lutras elder sister, Aure. Princess Aure, just like Prince Aleck were the legitimate children of the king and queen which granted them significant influence in the kingdom. The number of princes and princesses were 6 in total. There were three legitimate children, Prince Aleck, Princess Aure and Prince Atra. However, the other three were children born and raised by the kings concubines, Princess Lutra, Prince Nakura and Prince Soruha with each child being born from a different mother. According to Lutra, both Prince Nakura and Prince Soruha have already withdrawn from the ceremony. Since they were illegitimate children, they had little to no support for the throne and without innate talent like Lutra, they had zero chance of vying for the throne in the first place, reducing the number of participants to 4, Princess Aure, Princess Lutra, Prince Aleck and Prince Atra. Just as we agreed on, only me and Lutra, would be meeting with Princess Aure. [This is a beautiful garden.] (Yuuya) [Thats what I think too. Our gardener tends to the garden every season, decorating it with the most beautiful flowers. This is my favourite place in the castle.] (Selene) Even without asking I could tell that Selene was proud of this garden. Even someone like me who had zero interest in flowers could recognize how beautiful this place was. It was a shame that we couldnt bring Luna and the other girls along with us. In the middle of the garden was a small shelter with a desk and several chairs for tea parties. Sitting on one of those chairs was a beautiful person with luscious golden hair and a smile as warm as the sun. Although she was in her late teens, she gave off the feeling of a loving mother. She was Princess Aure. This was my first time seeing her face, however judging from Lutas reaction I could tell that this was her. [You did well returning safely. I was relieved when I heard that you were still alive.] (Aure) [I managed to survive somehow. All thanks to Yuuya-ojisama. Let me introduce you. This person is Yuuya Grandwood. Hes my personal knight.] (Lutra) [Nice to meet you. I am Yuuya Grandwood.] (Yuuya) I barely remembered to perform the Laluzulu salute as I saluted Princess Aure. [I am Aure Laluzulu. Its an honour to be acquainted with a celebrity such as you.] (Aure) As a man, I was sure that anyone would be knocked out by Princess Aures smile as she smiled brightly towards me. However, her smile never entered my mind as it felt like nothing more than a mask. [Lutra, since we are enjoying a tea party, could you tell me about what happened ever since you set out? Im curious about how amazing my little sister has become.] (Aure) With this, the tea party officially started. Princess Aure listened attentively to every word as Lutra excitedly talked about her adventures. Occasionally pitching in and nodding in agreement while inquiring for more details, time flew by just like that. Lutras story was less of a natural recap of her adventures and more of a disciplined narration. Despite mentioning the gist of her situation, she made sure to omit specific details that need not be said. Was Princess Aure trying to fish out for information? [I never knew there was such a thing. I was worried about your well-being after being involved in the accident but looking at the results, it seems that it was a blessing instead.] (Aure) [If its the current me now then I might even defeat Aniue.] (Lutra) [Fufuu, if you became the ruler then this city will surely prosper.] (Lutra) When Lutra becomes the ruler? Did Lutra not mention about passing over the throne to her? Thinking that, I turned towards Lutra who nodded to me. [Aneue, theres something Ive been meaning to tell you.] (Lutra) [Please go ahead.] (Aure) [I intend to become the victor of the inheritance ceremony, and pass the crown over to you.] (Lutra) For an instant, Aures expression changed completely. [huh, why would you do such a thing?] (Aure) [I am talented at swinging my sword. However I am vastly inferior to aneue whose specialty is in politics and finance. I believe that this is most beneficial for the Laluzulu. I could not leave the kingdom in the hands of aniue, not after what he has done. I firmly believe that aneue should be the ruler.] (Aure) [Why now?] (Aure) [I intended to do this from the beginning. However I did not have the confidence to beat aniue so I couldnt say it. I did not want to raise your expectations and worry you. But I can say it confidently now. After receiving Yuuya-ojisamas guidance, I will defeat aniue and make aneue the queen.] (Lutra) That was a powerful declaration. Comparing their abilities right now, I would say that Lutra defeats her brother 7 in every 10 rounds. Although I wasnt as familiar with Prince Aleck as I was with Lutra, I could roughly gauge his capabilities. If it was Lutra from before, then she might not get that many wins. [I see, I hadnt realised how much thought you put into this. Now that I know about it, the fact that you felt so strongly about it makes me happy.] (Aure) Aure grabbed tightly onto Lutras hands as she thanked her for her consideration. [Aneue has always been kind to me even after aniue changed. You have even taught me a lot of things which helped me numerous times. I wish to become that sisters strength.] (Lutra) It was a beautiful display of sisterly love. I was sure that if the two of them joined their strengths and worked together, that the Laluzulu Kingdoms future would be extremely bright. [ Lutra, hypothetically. If your elder brother hadnt changed and continued to care for his people and his country, passionately wished the best for everybody and the rumors were being fabricated, continued to build up his repertoire and was about as skilled as I was in politics and economics, what would you do?] (Aure) [Although that sounds impossible, I would leave the crown to him.] (Lutra) [Fufu, so long as he had the ability you would have chosen oniisama over me who comforted you when he abandoned you.] (Aure) [. that is the case.] (Lutra) [Well you were always that kind of person. And your decisions were always right.] (Lutra) I could feel her genuine smile sneak through the masking smile she had. [But aneue, isnt that just a meaningless question. After all Ive heard all about what aniue has done and how he changed from you. Last night he even tried to deceive me but I had more faith in you than him.] (Lutra) I could hear Lutras voice trembling as she told her sister about her trust. [Youre right, it was a meaningless question. I said something a little excessive. Although I do think that your answer was correct. When thinking about the people and the country, it is more important to prioritize the persons abilities over your own feelings.] (Aure) Aure cut her sentence off before letting out the most perfect smile than she has ever did before opening her mouth. [That is the part I love the most about Lutra.] (Aure) She then continued to make tea as the conversation continued on. As it was about to approach lunchtime, Princess Aure clapped her hands. [Speaking of which, since oniisama had forced himself to make some time for you last night, he left as early as dawn today for work leaving me to take care of the house. If its now, I could try to get permission for you to use the exclusive dungeon if you like.] (Aure) [I would like to accept but it is impossible for me to raise my level anymore before the ceremony.] (Lutra) [Youre right, however if you manage to clear one of the dungeons, the Gate of Trials, then as a member of the royal family, youll gain a special ability. Both oniisama and I have already completed it, and you should be able to too.] (Aure) If it was the Gate of Trials, then I knew about it too as it was a dungeon I cleared in the past. It was a dungeon that came up in an event where you would team up with other players and work with the battle princess Renoir, and obtain her powers. [That is true. There is still time before the inheritance ceremony for me to obtain the power. If it gets too dangerous or take too long then I could use the Return Stone to return. Aneue, could you please lend me your power.] (Lutra) [It would be my pleasure.] (Aure) With that, our next course of action was decided. We were heading towards the Gate of Trials. And now, I was wholeheartedly convinced that Princess Aure was an enemy. Regardless, there is one thing Ive come to understand. Princess Aure has been putting on airs from the beginning, as if she did not want anyone to read her true thoughts. What sealed the deal was the matter about the Gate of Trials. There were special dungeons in the world where Return Stones couldnt be used. The Gate of Trials was one of them. Despite Lutras comment about the Return Stones, she decided not to advise her about it. Since it was the royal familys exclusive dungeon, the number of people who didnt know about this were few to none. There was zero possibility that Princess Aure didnt know about this. It only looks like she was supporting Lutra We have the option of not entering the dungeon until the ceremony, however Lutra firmly believes in her older sister. Even though I had to tell her, Princess Aure is an enemy, I couldnt do it. Furthermore, it was true that Lutra could become even stronger by clearing the Gate of Trials. Given the opportunity I would definitely choose to close it. Lets play on the palm of Princess Aures hand for the time being in order to determine our real enemy. Im sure that even if some problem shows up somewhere, well be able to deal with it. While thinking about this, I continued to enjoy the tea party until the end. Volume 4 Chapter 15 - The old man challenges the Gate of Trials I was a lil exhausted when editing this chapter. There were also several parts of the chapter I couldnt understand clearly so do let me know if there were any awkward sections in this chapter. Hope you enjoy this chapter! We began heading towards the Gate of Trials. Due to the lack of time, Princess Aure began her arrangements immediately and thus we set out for the dungeon before sunset. Originally, Lutra wouldnt be able to gain access to the dungeon due to her brother, Prince Alecks influence. However we managed to gain permission due to Princess Aure pulling some strings behind the scenes. Although we wouldnt be able to raise our levels before the inheritance ceremony, members of the royal family gained a special bonus whenever they cleared the Gate of Trials for the first time, meaning that this was the only way Lutra could become stronger in time for the ceremony. however there were also several troubling points. When Lutra brought up the point about using the Return Stone to return to the castle for the inheritance ceremony, she failed to notice that Princess Aure was genuinely smiling brightly. [Yuuya, its a castles dungeon.This is exciting!] (Luna) [Uhn uhn, if we dont seize this opportunity we may never get to enter again.] (Til) The bright voices that came to me felt like they were blowing my troubles away as Luna and Til were both full of energy as usual. [Its an interesting dungeon. It looks exactly like a castle.] (Lutra) This dungeon was exactly as Lutra described, a castle. [Considering the dungeon looks like the same castle which the battle princess Renoir stayed in, its a given that the castle looks similar to the dungeon.] (Yuuya) During the game, the dungeon had looked exactly like the castle back then. However the castle had gradually changed over the course of several centuries. [Everyone listen up for now. Since there wasnt enough time and too many people around us, there is something that I have to say. Itll be great if we could explore the dungeon to our hearts content, however there are most likely traps placed around the dungeon by Princess Aure. There could be assailants waiting to ambush us or assassins that are going to be sent after us while we are exploring.] (Yuuya) Aside from Phil, everyones expressions darkened drastically, especially Lutra who was dealt the largest blow. [That is impossible! The Gate of Trials is restricted to the party members of the royal family. The only person capable of doing something like this at this timing would be my sister. There is no way she would do such a thing!] (Lutra) Lutras response wasnt baseless. In fact it was exactly as she said. The only person in the royal family who knew about our entry into the dungeon was her, which meant that if something were to happen to us in the dungeon, the first suspect would be her. [I have my reasons for doubting her. Why didnt she warn you about using the Return Stone in the dungeon? The Gate of Trials is a special dungeon, rendering Return Stones useless. Why didnt she warn you about it? If she was truly worried about you then she would have cautioned you about this matter when you brought it up.] (Yuuya) [That, what if aneue didnt know about that too] (Lutra) [She cleared the dungeon too didnt she? She should have received a proper explanation about the dungeon.] (Yuuya) [Couldnt she had just forgotten about it?] (Lutra) [This is something that could cost her sisters life. Forgetting something as important as this, does that really sound plausible? Especially when the person is you, someone who is widely known for her innate combat talents?] (Yuuya) I warned Lutra with a rather strict tone however it seems that my words werent being registered in her mind. I cant believe this , Lutras feelings were being transmitted to me through her words. [Even so, I believe in my sister. When my brother began treating me coldly, sabotaging me and ignored me no matter how much I reached out, I had no choice but to keep my distance as I was afraid of making the person I respected the most from disliking me. In such a dark time, it was my sister who reached out to me.. That is why. She had so many opportunities to kill me back then. What reason does she have to put me in a trap now of all times, when I was going to pass the crown if I won regardless.] (Lutra) Prince Aleck was also a favourite in the battle for the throne. If he were to seriously view Lutra as an enemy and began sabotaging her even further, the friendly version of him that Lutra knew, would likely disappear. Lutra was already an illegitimate child of a concubine. Lutra who was just a child back then must have been extremely lonely. [Which is why she took advantage of Lutra who had been left all alone knowing fully well that if done right, she would have an important piece in the battle Its also easy to imagine why she changed her mind about killing you. Lutra before meeting me was weak. Realizing that you werent useful to her cause, she decided to eliminate you. Or perhaps she has obtained a different trump card, one that could defeat Prince Aleck.] (Yuuya) This was the most reasonable conclusion I could draw. I wasnt just idling around until daybreak. [There were still several suspicious points. I went out and gather information from the knights and soldiers that I had fought together with. Prince Aleck never had a change in personality. He was a prince who continued loving his country and people, doing everything he could to his countrys benefit. Its always possible to manipulate a persons impression of you, but his achievements were written in black and white. I heard that he was working harder than anyone for the sake of his country. Then what reason did Princess Aure have, spreading negative information about Prince Aleck behind his back?] (Yuuya) [Yuuya-ojisama!] (Lutra) This was my first time ever seeing her shout. [Yuuya-ojisamas words arent mistaken. I am definitely suspicious about the situation with my sister. But it is also possible for those people who were supportive of my brother to be ignorant of his actions. Above all, my sister was always supportive of me unlike my brother.] (Lutra) Persuading her is only going to get harder from this point on. Their bond was something that was cultivated over several years. [In that case you dont have to believe whatever I say. This dungeon is the perfect location for setting up a trap. Itll be better for us to be on guard for any surprise attacks.] (Yuuya) [My sentiments as well.] (Lutra) I ended the conversation there as I continued to explain the countermeasure against any possible ambush. If we were being chased by any assailants then well be utilizing Lunas Presence Detection to avoid the monsters as much as possible while progressing into the dungeon at top speed. Our party was quick and its highly unlikely for the assailants to keep up with us with the monsters in the vicinity. The only problem was if the assailants were waiting in ambush. The only thing I could do was to warn everyone to keep an eye out for any possible ambushes. Lets overcome this dungeon as quickly as possible. . . . The Gate of Trial was a dungeon which tested the royal familys ability to lead. The monsters which appeared here were strong and required power to defeat. Wisdom was required to clear the numerous puzzles that were present as well as courage to cross the unstable wooden bridge that hung over a mountain of weapons. With power, wisdom and courage, overcoming every obstacle in your way and arriving at the depths will grant you a special ability befitting a king. After defeating several monsters, we arrived at a dead end. [Yuuya-niisan, there are three doors in front of us.] (Til) Just as Til said, there were three doors presented with a picture propped against the wall. There was only one correct door, and entering the wrong door means death. 33334466 2211222255 Please enter the correct two digits. Luna and Til began talking as they noticed the question. [Uhn. No clue.] (Luna) [I dont understand what it means. Is it 33? 33 looks correct.] (Til) It looks like this problem was too difficult for the two of them as the three doors had the numbers 77, 88, and 33 engraved into each of them. [Its 77.] (Yuuya) [Yuuya is amazing!] (Luna) [How do you know that?] (No idea who this is) [The hint is addition and subtraction. Now, lets go on ahead.] (Yuuya) If we had enough time, I would have allowed Lutra to solve it alone however Im hoping to clear the dungeon as soon as possible. There were a total of three puzzles to solve in the Gate of Trials. Although the questions may seem random, the three questions were selected from a pool of seventy two questions. Regarding the pool of questions, I had memorized all of them which meant that I wouldnt be able to get any of them wrong. Although the question we got this time was simple, there were several very difficult problems. [I understand now. Although I heard the answer, the next number is 11.] (Lutra) [Correct. It seems that you would had got it even without me.] (Yuuya) Lutras expression seemed stiffer than usual ever since I mentioned about the assailants possibly being sent by Princess Aure. [Muu, Luna will solve it too.] (Luna) [Ill work hard too. However if I dont understand then please tell me the answer.] (Til) Sometimes whats important isnt your body but your head. Ill continue to let the two think about the problem. . . . It has been about two hours since we entered the dungeon. Weve been running about the dungeon at a speed where we wouldnt be exhausted. Thanks to that, our exploration has been going smoothly. [Ah! Understand.. Luna understands now!] (Luna) [Truth is I already got the answer awhile ago.] (Til) [Eh, lies!? Was Luna the only one who didnt know? Luna definitely solved !] (Luna) Although it was bad to be distracted during an exploration, it looked like they are properly paying attention to their surroundings so it was fine to let them be. Although we were prioritizing our clear speed over unnecessary battles, there were several battles that couldnt be avoided. Just like now. There was a new enemy awaiting for us, a Shadow Cat. Just as its name implies, its a black cat monster which was capable of diving into the shadows which allowed it to hide even from Lunas Presence Detection. The monster was currently hiding in the shadow of a pillar, waiting to launch a surprise attack. Since it was a cat, it had large and sharp fangs and claws and often targeted a persons vital spots, however it didnt mean that its prey were just sitting ducks. Although Presence Detection was a convenient ability, if you relied on it too much and lowered your guard, you would be eventually fall prey to this type of monsters. As if to prove my point, it attacked Luna. However Luna responded immediately as she launched a counter towards the beast. [Uhn. Luna was prepared.] (Luna) A short dagger was penetrated into the mouth which was wide open, attempting to rip into Lunas neck. Lunas growth was progressing smoothly as she was properly watching her surroundings even while utilizing her abilities. Even if that wasnt the case, at this short of a distance the rest of us would be able to react accordingly. An arrow pierced the Shadow Cat which was on the verge of death, sticking its body onto the pillar as its body slowly turned into blue particles. [This is my first time seeing such a monster. As expected of the royal dungeon.] (Phil) [I know right. There are many monsters here that you cant find anywhere else. If its possible I hope to collect some materials here, however our priority is to clear the dungeon as soon as possible.] (Yuuya) The Gate of Trials contained monsters and materials which I hoped to obtain however in this situation we didnt have the time for it. [Ahh, Yuuya-niisan. It dropped something over there.] (Til) [Its a rare drop, Chrysobell. Its a jewel thats used for staff. Itll sell for a large price.] (Yuuya) Chrysobell was also known as the Cats Eye Jewel. This jewel would fetch a large price from anyone who required a magical staff. [Hurray, this is a huge haul!] (Luna) [We have to go and search for a good restaurant in Laluzulu.] (Til) Since we were in a rush, we continued to run as soon as the battle ended. However Luna and Til began to dance even while we were running. They were just wasting their energy. . . . We had finally solved the third puzzle as well as the test of courage. We entered finally arrived at our goal as we exited a corridor. [Once we reach the end of this road and enter the audience chamber, well be done with the dungeon.] (Yuuya) Our exploration went extremely smoothly as we took full advantage of my prior knowledge. The final riddle was extremely brutal as we would have been hard pressed if we couldnt answer it. We had to distribute eleven horses according to a will. The eldest son is to receive one third. The second son is to receive one quarter The eldest daughter and second daughter receives one sixth. Is it possible to follow the will? That was the question. [The previous question, I understand it. Its impossible because it was eleven. If you assumed there was an additional horse from the beginning then there wouldnt be a problem.] (Lutra) [Thats amazing. Even I couldnt solve it the first time I saw it.] (Yuuya) After reading how the will was designed, you would assume that it was impossible with eleven horses but as Lutra mentioned, you had to assume the number of horses to be twelve instead of eleven. Solving the question with twelve horses, the eldest son receives four horses, the second son receives three and the two daughters receives two horses each, totalling eleven horses. If you knew the answer then itll be easy to notice, however the difficult part was thinking of dividing according to twelve horses instead of eleven. [However Im relieved. We made it to the goal unscathed.] (Lutra) [Thats true.] (Yuuya) She was relieved due to the fact that our suspicion towards her sister was cleared as we had reached the goal without any troubles. Contrary to my expectation, we did end up arriving at the goal without any assailants. Lunas fox ears began to jerk. [Ahead of us, two monsters. Eh.. Its a gorilla and a goblin.] (Luna) A gorilla and goblin? Thats weird, there shouldnt be any in the Gate of Trials. [Fufun, I can see it. I dont even have to get closer!] (Til) Til fired an arrow towards the heart of the two monsters more than a hundred metres away, inflicting a lethal wound as the two monsters turned into blue particles. At that moment, I was sure of it. The moment the gorilla and goblin received their lethal wounds, they continued to run towards us as their muscles began to swell, pushing the arrows out of their body and closing the wounds. Not only that, their magical power jumps drastically as they seem to enter a frenzy. Their body became bigger, their colour changed and their expressions became excessively aggressive. Til fired a second arrow as Phil supported her attack with her own arrows, however the monsters merely grabbed the arrows with their hands. [I cant believe it!? How did that monster!?] (Til) [If its able to stop an attack at this level, It must be a high-rank monster.] (Phil) When Til struck their hearts with her arrows, they were definitely upper level thirties monster corresponding to the dungeon. However, it grew into a level 50ish monster No, it evolved. This was something we had experience before, similar to the Killer Ape which I fought back in Rumberg. After looking at this phenomenon, everything began to make sense. Princess Aure had tried to control Lutra back then because she needed an important tool to defeat Prince Aleck. The reason she tried to eliminate Lutra back in Greenwood, was because she didnt need a useless piece that couldnt achieve her goal. If she was confident of defeating Prince Aleck on her own, then the popular Lutra would merely be a nuisance. Her new trump card must have been the evolving monsters. The moment Lutra entered the dungeon, two evolving monsters coincidentally appeared at the end of the dungeon. Although Prince Aleck was strong, he wasnt strong enough to defeat even a single one of these monsters. Furthermore, the presence of these monsters answered another major question. Nobody could enter this dungeon unless you possessed the royal blood. Which meant that someone from the royal family came along with these monsters. Since Prince Aleck wasnt around nor did he condone allowing Lutra into the dungeon, he was innocent. On the contrary, my suspicion towards Princess Aure who was encouraging Lutra to enter the dungeon grew even stronger. Lutra is a smart person, after witnessing this situation there is too much evidence supporting this no matter how much her heart rejected this. [Firstly, lets put these monsters down.] (Yuuya) [Uhn. Well defeat them.] (Luna) [Its a chance to show off my triple shoot that oneechan taught me!] (Til) [Til, they are dangerous opponents. This isnt the time for jokes.] (Phil) [.Anueue, this isnt the case right.] (Lutra) If the five of us are here, then we wont lose. No matter how strong these monsters are, well show you how naive you are, thinking that these two were enough to kill us. Volume 4 Chapter 16 - The old man is sure. Two monsters which didnt belong here, appeared in the Gate of Trials. The Great Kong which was a higher-rank species of gorilla-type monsters that possessed unusually developed muscles and thicker hair and the Goblin Knight, another higher-ranked species of goblins which possessed higher intelligence and the ability to wield a sword. They were both monsters that belonged in the upper level thirties and wasnt supposed to be strong enough to match us in battle. However they had evolved and became equivalent to a monster around level 50. It was a level where even top tier parties would had problems defeating them. At our levels, encountering them was a death sentence. However we were stronger than our level implies. Even if they were both evolved, they can be defeated if we dealt with them properly. [Lutra!] (Yuuya) I raised my voice towards Lutra who seemed absentminded in this battle. Lutra who had a shocked expression prepared her stance as she held her shield. She too, suspected that it was Princess Aure who brought them into the dungeon, making it impossible for her to stay rational in the battle. Even in such a state, I wanted to praise her for keeping up her role as the frontline. [Everyone, well be acting as one to four.] (Yuuya) [Uhn. Understood!] (Luna) [Ok~ leave it to me!] (Til) [Roger that.] (Phil) [That is reasonable.] (Lutra) Since we were a five-man party, we were able to perform several different formations. This was one of them. The evolved Great Kong and Goblin Knight were running towards us. The Great Kong was slightly quicker as it ran ahead of the Goblin Knight. Lutra then used War Cry to attract its attention, causing the Great Kong to charge straight towards her instead. Meanwhile Phil and Til focused on drawing the Goblin Knights attention by concentrating their attacks onto it. The one to four strategy was simple. Whenever we encountered two powerful enemies, Lutra who was the sturdiest among us would take on one of them while the four of us focused on bringing down the other enemy as quickly as possible. No matter how we tried, it was impossible for us to take out two evolved monsters simultaneously. [. If possible please wrap up that side as soon as possible. I dont think Ill be able to last long.] (Selene) [Leave it to me.] (Til) [Uhn. Luna will assassin it!] (Luna) Luna and I began running towards the Goblin Knight, rushing right past the Great Kong who seemed to ignore our existence. As expected, War Cry was an amazing skill. Despite the close distance, Til and Phil continued to rain arrows onto the Goblin Knight without any misfires, a feat not many archers were capable of as the fear of accidentally attacking your allies was crippling, causing their accuracy to decrease. [Uohh. If I worked together with onee chan then I wont even need to use triple shot.] (Til) [Til, just focus on bringing down the monster even a second faster.] (Phil) The Goblin Knights swordsmanship was impressive as it was able to cut down the arrows fired by Phil and Til. However it was impossible for it to cut down every single arrow as it slowly accumulated damage from the constant barrage. Furthermore, it was full of openings as it was completely preoccupied with our archers. In this situation, well finish it off with our strongest combination. While I was running, I glanced towards Luna, synchronizing our strides as I began my chant. It was my spell that focused on increasing the targets attack power. [Gods Strength!] (Yuuya) [Assassinate!] (Luna) Luna perfectly landed her attack with Assassinate boosted by Gods Strength as the sound of ringing could be heard. This would be a pointless combination if Luna couldnt land a critical hit, however me and Luna were perfectly in sync down to our breaths. Furthermore against an opponent full of openings, there was zero chance of Luna missing her critical attack. However, as expected of a monster equivalent to level fifty, even after that attack it hadnt fallen yet. This was still within our expectations as I had activated a second chant after Gods Strength. I chased after the sliding Goblin Knight, rapidly closing the distance between us. Even though it was in such an awkward position, it proceeded to swing its blade upwards towards me. It was an amazing display of swordsmanship as it managed to put strength into its blade in its weakened state. Unfortunately, that level of swords play wasnt enough to defeat me as I used the blade in my right hand to deflect the attack while twisting my body before stepping forward and closing the distance between us. Then I stuck out my left palm. [Napalm Strike!] (Yuuya) My left hand cloaked in extreme heat pierced through the Goblin Knight. The smell of charred meat spread through the air as a large gaping hole appeared in its chest. Its body then finally began turning into blue particles for good. Compared to the battle against the Killer Ape, the abilitys skill level was significantly higher and its firepower couldnt even compare to before. [I knew it, we are definitely stronger.] (Yuuya) If we worked together, then even level fifty monsters werent a problem for us. This was significant for us although it didnt mean that we could immediately set out for the most difficult dungeon since monsters at this level appeared in groups or frequently. [Everyone, hurry up and finish up! Im about to reach my limit!] (Lutra) Lutra shouted at a volume that closely resembled a scream. She had been taking on the Great Kong this entire time which was a heavy task. There wasnt any time to be idling around as everyone immediately rushed to Lutra. . . . Several minutes later, the Great Kong was defeated. Unlike the Goblin Knight which possessed both toughness and ability, the Great Kong was a monster which emphasized its toughness, making it harder for us to defeat. Although it wasnt dangerous for us regardless. Our party Twilight Home already possessed combat prowess rivaling the top parties. After completing the battles, Phil began recovering Lutras wounds using her Heal. [Surprisingly, the battle wasnt dangerous at all. This was the first time I had to repeat the same skill this much.] (Lutra) [Being able to take on a monster at this level alone, is something to take pride in. This was a feat only first tier tanks were capable of performing.] (Yuuya) [I humbly accept your praises.] (Lutra) Lutras smile felt unnatural. [Lutra.] (Yuuya) [I know. Once we leave the dungeon, Ill listen to whatever she has to say.] (Lutra) [When that time comes, Ill be by your side.] (Yuuya) If these monsters were indeed sent by Princess Aure, then there should be more of them. At the very least, there should be at least two more of them around. If she sent two or more of them against Lutra, then she will have no options against them. [Yes, please do so.] (Lutra) [Luna will go together too! Even if you say no, Luna will hide somewhere and watch. Luna is a fox after all and she is good at hiding!] (Luna) [And since Im an elf, Ill be hanging off a tree and prepared with my bow!] (Til) [Kyu!] (Erik) The two girls and Eriks support were overwhelming. I couldnt understand the reasoning behind being a fox however it seems that Luna was good at hiding her presence, making it possible for her to hide somewhere although Tils comment was rather realistic. [Well, lets think about it once we leave the dungeon. Lets exit the dungeon first.] (Yuuya) More importantly, we came here to have Lutra obtain the special abilities for a ruler. That was our main objective. . . . After exiting the large corridor, we entered the audience chamber of the dungeon as the throne at the end of the chamber was glowing brightly. .. It was said that practically everyone who challenged the Gate of Trials would never make it back. However this time we had the answer to practically every single one of the seventy two questions and we had made preparations for everyone excluding Lutra. Furthermore since Lutra had strong escorts, there wasnt any risk involved. The reason I hadnt informed Lutra about it was due to my suspicion towards Princess Aure. This time, we were able to overcome the dungeon this quickly was due to us although it was likely that Lutra would have been able to overcome the dungeon on her own given enough time. In any case, we werent escorts prepared by the royal family but her friends who she acquired through her own power. [Yuuya-ojisama, what should I be doing right now?] (Lutra) [Youll sit on the throne.] (Yuuya) Lutra really seemed to know nothing about the Gate of Trials She seemed to only know about the condition of having royalty in the party to get access to the dungeon however she hadnt known about the puzzles set in the dungeon as well as the method to receiving the power in the first place. [Im a little nervous. Isnt it disrespectful to go ahead and sit on the throne?] (Lutra) I couldnt help but laugh as it does sound like something Lutra would say. [Its okay. Youre going to win the inheritance ceremony arent you. Youre qualified to sit on the throne.] (Yuuya) After pushing her back slightly, she slowly approached the throne and sat on it. At that instant, the brightly shining light began to turn red, turning into red particles before entering Lutras body. [Strange, power seems to be flowing through me It was the same as when we defeated the Coronoa Dragon.] (Lutra) [In reality their the same thing. Attaining a title is equivalent to getting stronger, although this is only valid for the royalty of the Laluzulu.] (Yuuya) By overcoming the Gate of Trials, the royal family could obtain the title Rightful Ruler. [Envious! Luna wants it too.] (Luna) [Me too me too!] (Til) [You two, thats impossible since the two of you arent royalty.] (Yuuya) [Muu, thats unfair!] (Luna) [Thats right thats right!] (Til) [If you continue behaving like this, Lunas fox ears and Tils ears will both be pulled along. Everyone has their own advantages.] (Yuuya) The two girls gave in immediately after my warning as Lutra descended from the throne. [Hey, Yuuya-ojisama. What if, I confronted my elder sister.. And she said that she wants to kill me, what should I do then? Ive always thought that I should leave the country to her.] (Lutra) [I dont have the answer for that. Its something youll have to think about yourself. The reason why Lutra thought of making Princess Aure the queen is because you thought that the people would be happier if she was made the ruler. If that is the case, then face reality and find the answer yourself.] (Yuuya) Purely based on reason, if the country were to prosper under Lutras rule then there shouldnt be any worry for her life. [Youre right. I just made a mistake in my judgement. Then Ill just have to properly talk to them once more. My sister, and my brother too.] (Lutra) [Please do so.] (Yuuya) [Then afterwards, I hope to talk to the people that Yuuya-ojisama was talking about. I wish to hear the details from them personally. Its embarrassing but in the castle, both my eyes and ears were practically nonexistent as I hadnt received any information. In hindsight, it could be that both aniue and aneue were trying to keep information from reaching me in the castle.] (Lutra) A young and supportless Lutra was an easy target, making it easy to manipulate the information being fed to her. [I understand. Then lets do that For now, lets head back.] (Yuuya) This audience chamber was our objective. As proof of that, there was a magical vortex waiting in the back of the room. After dragging Luna and Til who were playing with the Throne, then Erik, we finally decided to return to the castle. . . . After returning to the castle, we immediately set out to pay a visit to Princess Aure. However, it seemed that she had been busy ever since we entered the dungeon. It was probably her insurance plan should her ambush failed. Since it would likely take a long time, I decided to arrange a visit for Lutra with my old allies. Although all of them were paid a visit by Princess Aure, they decided to reveal everything to Lutra after they heard that it was a personal request by me. After realizing how much information was hidden from her, Lutra continued to ask questions. Afterwards, she once again reinstated her decision to visit her elder brother, Prince Aleck. If it was the current Lutra, he would be unable to continue avoiding her. Lutra was already in a desperate state as she needed to confirm all of the new information being pumped into her, hence this meeting was something she definitely needed. . . . Currently, it was finally the day of the Inheritance Ceremony. Even after all this time, Princess Aure did not return to the castle. Meanwhile, Lutra was having an honest discussion with Prince Aleck with open minds. [Lutra, did you come up with an answer?] (Aleck) [Of course. The answer is already out. The only thing left is its execution.] (Lutra) [In that case, move forward without any regrets. Ill be watching over you.] (Aleck) That was without a doubt the brightest expression I have ever seen. She had zero uncertainty about her decision. If its like this, then Ill show her my full support. We began heading towards the venue for the Inheritance Ceremony. It was a dome-shaped Coliseum which was also used to determine the strongest knight in the country. The seats in the stadium was already filled to the brim,. There was no grander stage than this as Lutra headed to her waiting room while we headed towards the VIP seats. I hadnt heard Lutras answer nor have I given here any advice since the dungeon. However, Ill be sure to watch my dazzling disciples appearance as her master. That Was all I could right now. Volume 4 Chapter 17 - The old man begins to move. TL: Long note at the end. The Inheritance Ceremony has finally begun as we headed to the specially prepared seats at the coliseum. Even though the colosseum was large, the event appears to be extremely popular as the general seats were completely filled with people who were looking towards the arena expectedly. [Yuuya, will Lutra win?] (Luna) [In direct combat, she wouldnt lose. Although Prince Aleck is a first-class warrior, he is still directly inferior to Lutra. Princess Aure has received combat training too, although she was only ordinary in that aspect. I havent met Prince Atla however Ive heard that he was objectively better than Princess Aure as well.] (Yuuya) Note: Atla (Previously Atra) is the third legitimate child of the queen. Based on just their physical capabilities, this would be their ranking. Officially, if their rankings were just based on their physical capabilities, Princess Aure would had have to end the battle before the ceremony began as she would be in a bind during the battle. [Uhn. Then were safe.] (Luna) [You cant be sure of that We cant be sure that everything will be proceed as it is when Princess Aure is likely preparing something for her comeback.] (Yuuya) Rather than suspect, I was sure of it. Approaching the young Lutra and manipulating the information given to her for her own benefits, preventing any information from reaching Lutra while slowly and surely feeding negative news about Prince Aleck. It was something that required immense patience, quick decision-making and most importantly, the ability to main it for years. This was something that was easier said than done. For a human to be capable of doing such a thing, its practically impossible for her to give up just because her assassination attempt had failed. [I agree with that sentiment. I think that the best time to execute her plans would be right before the succession ceremony begins.] (Phil) Princess Aure possessed a powerful trump card which was her evolving monsters. As a result, her previous combat piece, Lutra became redundant and was deemed an obstacle which was immediately disposed of. However, for the inheritance ceremony, she wouldnt be able to utilise her monsters since it was a one versus one battle. Somewhere and somehow, Phil and I were ready for battle, expecting Princess Aure to launch an attacking with her evolving monsters [If anything happens, well jump out immediately.] (Yuuya) [Yes, Lutra-chan is our friend after all.] (Phil) Even if she wasnt going to be with us once everything is over, I intend to do everything I can for my friend. [But, our weapons were seized earlier you know. Even our magic bags.] (Til) For the spectator seats, magic bags and dangerous objects were not allowed. For our VIP seats, such objects were to be confiscated instead. [Well even without a sword, a Magic Knight is still strong barehanded.] (Yuuya) [In my case, I do have a bow though?] (Phil) [Ahh, Yuuya-niisan and oneechan are cheaters. Wait a minute, how did you even bring one in!?] (Til) [Its a secret.] (Phil) No matter how you see it, Phil had neither her weapon nor her magic bag. However, there were many ways for you to hide and carry your weapon with you at all times. Til continued to pester her heavily as her curiosity was piqued by Phil. Meanwhile, Luna began to murmur with a satisfied look as she sat on my lap while waving her tail back and forth. [Truth is Luna has her dagger too. Its hidden in her tail. When she finds a bad guy she will assassin!] (Luna) I let out a smile as it was definitely possible for her to hide a short dagger in her fluffy tail since tails were left out from the body checks. [Looks like its about to begin.] (Yuuya) The inheritance ceremony was about to begin. Firstly, the king entered the ring of the coliseum as he initiated the opening ceremony while explaining the rules of the tournament. Using an amplification magic tool in the ring, his words rang throughout the coliseum using several loudspeakers. Despite portraying himself with dignity, the kings body still looked frail. This was probably going to be his final event as the king. It was the typical one-on-one tournament battle system with the final victor succeeding the throne without any restrictions on weapons and tools present. The victory conditions were to knock your opponent out of the ring, rendering them unable to battle, death, surrendering as well as the referees decision. Surrounding the ring were several healers and doctors who were capable of casting healing magic, making it possible to rescue the contestants so long as they werent dead. After the opening ceremony, it was finally time for the contestants to enter the stage as the first one to appear was Prince Aleck. The moment he appeared onto the stage, the entire crowd let out a passionate cheer, especially the female crowd. The military personnel in the ring were also cheering although they were supposed to be impartial to the tournament. Since the military judged everybody by their physical capabilities and talents, this showed how recognized he was for his ability and personality. Next was Prince Atla who wasnt very popular as he merely received a light applause. He himself appeared timid as if he didnt intend to win. In fact it was a miracle that he refused to back out of the tournament. Its probably that. Since he wasnt going to defeat Prince Aleck, he was probably a pawn for Princess Aure who wanted to save her strength in her battle against Prince Aleck. This was the most probable outcome. [Its finally Lutras turn to appear.] (Yuuya) [Uhn. Luna will be looking for her.] (Luna) [Ill have to be louder than everyone else!] (Til) Lutra entered the stage as Luna and Til began cheering at the top of their voices however it was still drowned out by the immense volume of the crowd. As the second coming of the legendary Renoir, her popularity was through the roof. Conversely, the reactions from the nobles were cold as they were either supporting Prince Aleck or Princess Aure. The military personnels reactions werent as vibrant to her as they were to Prince Aleck as well. They looked like their impression of Lutra was merely a girl who happened to take over the looks of the battle princess Renoir. [Now then, its time for Princess Aure to appear.] (Yuuya) After sending Lutra off to the dungeon, Princess Aure had yet to appear in the castle. If she chose not to appear at this moment, then it would be decided that she has withdrawn from the tournament. The king asked. [Umu, has Aure withdrawn? In that case, itll be decided.] (King) Just as the king declared, Princess Aure appeared along with glowing particles. [No. Im participating as well, and I will be the ruler.] (Aure) Said Aure in a confident tone as all of the audience sprang up from their seats. It appears to be a play for her to raise her popularity. She had displayed Teleportation that none of them have seen before. It was a skill that allowed its user to move to another location within ten metres. It was a skill that wasnt attainable by humans, however it was possible to use the skill through magic items. It was a rare item with limited uses that was so rare that even in the game, I hadnt managed to obtain an item capable of using it I highly doubt that she would use such an item just to garner popularity for herself. It feels like it could be a hint for something, however I couldnt come up with anything. Just as this happened, the majority of the nobles began to cheer as her faction seemed to outnumber Prince Alecks. [Aure. Im impressed that you managed to make it at the very last minute. Now then, well begin the tournament with this four participants. Each of you will wear this hat one at a time.] (King) The king handed out something that looked like a Top hat Is it still being passed down? That was something that I saw during the event in the game. Firstly, Prince aleck put on the hat as the hat opened up, releasing a spring as well as a stuffed pigeon. [Red lion, red lion!] The pigeon from the hat began shouting a red lion. From my point of view, it looked extremely comical however the audience including the nobles seemed to look at it with serious expressions. Above all, the princes and princesses looked like they were in pain. Was it an item that was that divine? The only thing I felt from that was its creators bad taste. Afterwards, the pigeon announced Blue Dragon for both Lutra and Prince Atla while Princess Aure was a red lion. Although it looked quite special, it was just a normal lot-drawing device. The first battle was between Prince Aleck and Princess Aure while Lutra would be battling Prince Atla. According to the schedule, the blue dragon contestants would be battling first. Lutra and Prince Atra would be fighting in the first round while Prince Aleck and Princess Aure would be fighting in the second round. The final winner between the two victors would be the ultimate victor of the tournament. This was the best outcome for Lutra who would be able to reserve her strength for the final battle with an easier first battle while getting a longer break before the finals. [The match-ups have been decided. Looks like Lutra and Prince Atlas battle will begin in fifteen minutes.] (Yuuya) The princes and princesses bowed their heads as Prince Aleck seemed to ask the King for permission. Surprisingly the King allowed it as it was something the Prince wanted to tell the public and his siblings. He walked to the center of the ring as he faced the audience. [I will make the Laluzulu Kingdom stronger. Not only its military power but also its economy as well as manpower by placing emphasis on nurturing our children. The first step is for me to prove that Ill be a strong king in this inheritance ceremony And to my beloved siblings. For the ideal Laluzulu Kingdom, you are required as well. If I became the ruler, I wish that Aure would lend me your wisdom while Lutra would lend me your shield and aspirations as well.] (Prince Aleck) As expected of the number one candidate. He possessed the qualities of a ruler as he quickly grabbed the hearts of his people with a much more open mind than I thought as he publicly acknowledged the abilities of his fellow siblings. Princess Aure then walked beside him. [In that case, I shall declare something as well. My dream is the exact same as my older brother. However for that to happen, an even greater king is needed. That king isnt my elder brother but me. Frankly speaking direct battling isnt my forte, however Ill show that I surpass my brother even in my weak points.] (Aure) She sounded full of confidence that made me wonder, just what kind of trump card did she bring to a battle where she couldnt bring her monsters along? Lutra walked up beside them. This was a good move as she wouldnt be acknowledged if remained silent here. [I simply wish the best for my country and the people in it. Which is why I will win the ceremony to choose the best candidate for succession. Which is why, aniue. If I win, I hope to borrow your power as well. However there are conditions to this.Lets make a bet. If I win, you will lend me your power in the future. ] (Lutra) [I accept. If you win, then Ill do everything in my power to support you. And if I win, youll be the one supporting me. Lutra, lets meet in the finals.] (Prince Aleck) [Yes, Ill see you in the final.] (Lutra) Prince Aleck put his hand out for a handshake as Lutra responded to him. It was an incredibly bold move as well as her message to Princess Aure and Prince Atla that they werent her enemies. On the other hand, Prince Atla and Princess Aures reactions were strange. Prince Atla seemed depressed and full of regrets while Princess Aure was laughing from the bottom of her heart and not her usual charade. . . . The first round has begun. Judging from his skillset, Prince Atlas class appeared to be a warrior and his level surpassed Lutras as he was able to enter the exclusive dungeon. However, his movements were second-class compared to Lutras. It was obvious that he had received proper tutoring in using the sword, however it was evident that his talent was nothing special nor did he have any experience in swinging a real sword. Lutra easily deflected Prince Atlas sword, causing him to lose his balance. Taking advantage of his unstable balance, Lutra threw Prince Atlas body onto the ground and pinned him to the ground before putting a sword to his throat. [If you dont surrender, Ill have no choice but to stab your throat.] (Lutra) [Ill surrender. Its my loss.] (Atla) The battle was decided in less than a minute. The audience sprang up from their seats as many of them likely thought that Lutra had merely inherited the famous Senki Renoirs appearance but were now convinced she was her reincarnate instead. Lutra gracefully greeted the audience before exiting the stage and lending her shoulder to Prince Atla who was completely overwhelmed. [Luta, nice win!] (Luna) [Uhn uhn. Especially as a spectator, that was mesmerizing.] (Til) There was no way I wouldnt understand why the two girls felt. The second round began ten minutes later. Prince Aleck had encouraged Princess Aure to surrender the battle, however she had refused his offer. Princess Aures class was likely a Magician as she held a cane in one of her hand, making this small ring a major disadvantage. In the first place, Magicians had weak defenses and their long chants made them ill-suited for duels. Which just made me wonder how could she win the battle? The answer came immediately after. As soon as the battle began, light particles began to appear forming the shape of monsters, producing a total of three monsters. A silver living armour, a werewolf and a gigantic high-class Orc with a club. Prince Aleck cried out. [I dont know how you brought them into the battle, however this is a one versus one battle! Its part of the rules.] (Aleck) [I dont understand what you are trying to say. This is the power of my Summoning magic. Isnt it natural for a magician to use her spells?] (Aure) Princess Aure had made proper preparations as the referee didnt call out her foul play. I finally understood the reason behind her flashy entrance from earlier. If she showed everyone that she was capable of casting teleportation magic then it wouldnt be far off to claim that she could cast summoning magic. However, that concept of summoning magic is a hoax. There should be a collaborator working with her nearby, using teleportation to send the monsters into the arena from another location. Since there wasnt any evidence of foul play, it wasnt considered a violation of the rules as Prince Aleck continued to retreat from the onslaught from the three monsters, jumping backwards as his breathing became heavier and heavier. Eventually, he began to overwhelm the three monsters as loud cheers could be heard from the female public. Based on their appearances, they were likely monsters in the upper thirties. Furthermore they were each special monsters that were stronger than an average monster in their level range. However there was a ray of hope in the battle. [Aure, shouldnt you use your summoning magic to call for reinforcements? If that was impossible then I wish for you to surrender. I dont have the desire to cut down my own sister.] (Aleck) [That naiveness will be aniues downfall. If I were aniue, then I would have already surrendered.] (Aure) [ It isnt naivety. It just isnt necessary.] (Aleck) [Although it is necessary? Even in the case with Lutra. Aniues actions are too kind. Which is why you are being dragged down. Aniue is no king.] (Aure) Prince Aleck was blown away by the werewolf as his magic chestplate was destroyed in the impact. It was an attack befitting a monster in the fifties as the three monsters had all evolved. Prince Aleck fainted on the spot. [I always do whatever is necessary. Unlike aniue.] (Aure) Under Princess Aures order, the orc walked over to Prince Alecks lifeless body, swinging down its large club. Everyone in the venue turned away. Taking a direct hit like that, even if its Prince Aleck [Ara, what are you trying to do? Lutra.] (Aure) Between the large club and Prince Aleck was Lutra as she deflected the club, causing the flimsy club to shatter along with the colosseum wall. All three monsters began to collapse onto Lutra but they stopped the moment Princess Aure clapped her hands. [Isnt it against the rules to interfere in another persons battle? Referee, please disqualify Lutra from the tournament.] (Aure) [No, aneue. Aniue has already lost consciousness. The match was already over the moment he fainted. I am just aiding the recovery process.] (Lutra) [Ara, so thats the case. I hadnt noticed. Thank you Lutra, I was close to killing my own brother without realizing it.] (Aure) Aure spoke in a volume large enough for the audience to hear. [I look forward to the finals.. Ara, didnt aniue say the same thing? Fufu, aniue looks so pathetic.] (Aure) After erasing the three monsters, Princess Aure walked off the stage as the referee announced the victor. The battle begins in two minutes. However, it wasnt a situation for us to relax. [Everyone, lets begin moving. That isnt summoning magic, but rather teleportation magic. Princess Aure is violating the rules. She is hiding the monsters somewhere nearby, in the vicinity of the coliseum. Well defeat them right now.] (Yuuya) If my guess was correct, then what she just did wasnt summoning magic but teleportation magic. In that case, we could just find where she was hiding the monsters and defeat them. Even for Lutra, it was impossible to win against three level fifty monsters. [Understood! Lunas Presence Detection will find the enemy!] (Luna) [Ill search from a higher vantage point then.] (Til) [Luna-chan, Til. If you find any of them be sure to tell me or Yuuya. You wont survive if you challenge them on your own.] (Phil) [Lets hurry.] (Yuuya) We began to move. Originally, we wouldnt be able to interfere with the battles once the inheritance ceremony began. However, the story was different now that we knew our opponent was violating the rules. I will tidy up the story, and give Lutra the fair fight she deserves. Hope you guys enjoyed this chapter. Regarding this novel, I have several thoughts about what Ive been doing regarding the translation. Instead of directly translating the words and editing them to form a proper sentence, Ive been trying to do a translate the japanese words into an english context.Though please understand that my english isnt great since in Singapore we speak more of a dialect than proper english. An example of this would be the speech scene. Although prince Alecks speech could be directly translated into a proper speech as if he was speaking to the public, princess aure and lutras speeches contained words like aniue and aneue which normally referred to their elder brother and sisters based on the context. However for an english equivalent word, it would be saying elder brother and elder sister and it would sound somewhat weird when used in a formal speech to the public. Do let me know if you would rather me directly translate this sort of words which doesnt have an english equivalent or change it to fit the english language or as Ive been on the fence about doing this, causing a lot of inconsistencies in my wordings for the novel. This is also the case for names and several other things that I cant think of right now but Im sure is there. I tried to change the names in the story to actual english words that exists. Eg: Atra C> Atla(s), and Yuuyas skill, Napalm strike. In actual fact, the name of the ability is Exploding heat god palm (?) if I were to direct translate it. Since the original name seems slightly weird for english, I decided to change it to napalm strike (admittedly the name had randomly came up in my head at the beginning). Now that the series has progressed this far Im feeling slightly guilty at changing things in the novel based on my own views. Again, Im stating this as this has even confused me since Im feeling guilty at changing the novel on my own discretion, wavering between directly translating the words and adding in my own. Do let me know which you guys prefer and Ill adjust accordingly. Also, thanks for the concern and Im sorry(?) for the fast release of chapters. Ever since I started translating again after the long hiatus Ive kinda gotten hooked on novels again. Unlike the past where I did all the translations during the weekends, I have been able to work on chapters during the weekdays using my phone as I am currently done with my training phase. Honestly I did think of just posting one chapter a week like I used to do but I kind of dislike the idea of restricting chapters that I have already completed so I decided to just post chapters as I completed them. I would usually either complete somewhere between half to an entire chapter during the day or none at all if I was busy, which meant that I could go home and edit the chapter before releasing it. As to monetary support, there arent any plans to open the patreon again since I dont intend to restrict chapters so I dont really have any benefits for patrons. Although I do hope that everyone will turn off adblock since it helps me. Volume 4 Chapter 18 - The old man discovers it. Following what I said in the previous chapter, Ill continue to translate the novel while leaving honourifics such as -dono, oneechan, aniue etc etc since I couldnt find any way to translate them into english comfortable. This chapter is much shorter than usual but I hope you enjoy it. That Prince Aleck who was known for his leadership and his ability in combat was defeated. The person whom everyone thought was the strongest in the kingdom was defeated in a duel. Nobody could accept that fact as the audience received a shock and people started to murmur. I was surprised at the outcome as well, however there wasnt any time for me to waste. What was important was that Princess Aure managed to obtain a super rare item capable of casting Teleport, and called it Summoning Magic as she teleported several evolving monsters as her minions. If I dont stop her before the match, then Lutra will suffer defeat as well. Although she gave a ridiculous reason to her actions, the referee was likely one of her underlings as he did not voice out against her actions. This also made persuasion meaningless. Due to the lack of time, we began acting separately. Luna searched the area using her Presence Detection while Til with her special visual acuity began searching the vicinity while I went to meet a certain man. In all honesty, there are only so many places where you could hide gigantic monsters in the area. Especially since the range of Teleport was only ten metres and stretching to thirty metres at the expense of inaccurate teleportation, reducing the possible hiding spots to several locations. It was impossible for the monsters to be hidden within the audience, hence they were likely within the coliseum or underground. But this wasnt all. They were likely hidden in a secret room that wasnt open to the public. While Luna and Til continued to search above ground, me and Phil entered a room. . . . Surprisingly my title of a Hero was useful in this situation. Originally, it would be difficult to arrange a meeting with him as we entered his room, watching his subordinates carry him and place him down in his resting room. [Could you be here to comfort me? Or are you here to enjoy the view?] (Aleck) This person was Prince Aleck. His complexion appeared much better as he had an excellent healer as a subordinate. His wounds would most likely recover in a matter of minutes. However, the body worked differently from the mind as his psyche was probably still in shambles. [Why would I do that. Im sure that the Prince Aleck would never want that.] (Yuuya) Weve spoken with each other several times and although Ive requested to speak on friendlier terms, he continued to speak in the polite tone of a noble. [I expected as suchIf Yuuya-dono came all the way here, is it for Lutra?] (Aleck) [Thats right. Ill start with my observations. Princess Aures summoning magic is a hoax. She isnt summoning them, shes teleporting them in from somewhere else with the help of her collaborators using a special item. However, her teleportation has a maximum range of thirty metres. There are only so many places to hide monsters from the publics eyes in this area. I was hoping you could help us with this.] (Yuuya) This coliseum wasnt a private facility, in fact it was used extremely often by the royal family. In addition to the inheritance ceremony, there were many events held here were attended by royalty and other important guests. Taking their safety into consideration, there were hidden rooms and spaces throughout the vicinity to keep them safe in the event of an emergency. If Princess Aure was indeed concealing her monsters, then this should be where shes hiding the. This was why it was important to consult Prince Aleck as he was the most likely person to know its possible location. There were twenty minutes left until the final match begins. There wasnt enough time for us to search for the hidden rooms and fight the soldiers protecting the rooms. This was the fastest action plan we could take, requesting Prince Aleck to find the hidden room while silencing the soldiers using his authority. [Did you really expect me to cooperate with you? Even after being kicked out of contention for the throne?] (Aleck) [No. I know that Prince Aleck would cooperate.] (Yuuya) [Ill like to hear the reason behind your confidence.] (Aleck) [Youre a wise person. Currently, between Lutra and Princess Aure its easy to tell who will win the finals. You arent a merciful person either. The Prince Aleck I know, is an opportunistic person. Facing against those monsters with your own body, having your life saved by Lutra. It wouldnt be enough for you to return the favor to Lutra for saving your life. Youll have to return the favor to Princess Aure as well.] (Yuuya) Prince Aleck began to laugh heartily, as if he found something extremely funny. [If you say it out loud, then I have no choice but to cooperate. Yuuya-dono, follow me.] (Aleck) Prince Aleck stood up, showing that he wasnt a cowardly person that everyone knew he wasnt. Rather than refusing to cooperate, he knew that it would be much more favourable for him to support Lutras cause and guide her to the throne, then requesting for her favor. However, Im sure that he would have supported Lutra regardless. At the end of the day, he was still a good man. . . . While we were on the move I used a magical tool to contact Luna and Til to our location. It was an item that we got in the royal dungeon which allowed us to send an alarm to everyone in the party within one kilometer. Although it wasnt possible to send a message, it was still useful as it also shows our location. [Yuuya-dono, I never would have thought that such monsters existed. Above all, I am ashamed from being defeated by a monster. I still have a long way to go before youre within reach.. I wasnt surprised by their attacks, I noticed that they hadnt been defeated yet. However, their strength was so overwhelming that my body couldnt stop trembling. Fear and despair made my body stiff. And that solidified the results.] (Aleck) [When I fought, there was only a single monster. If there were three, then I wouldnt have won. Much less survive.] (Yuuya) While walking down the hidden passage within the coliseum, we began to discuss the incident in Rumberg, from the evolving monster to the bribery of the guild chief. [Just how did Aure get her hand on such a thing Is there really an organization capable of controlling such powerful monsters? There is more evidence being piled against Aure being king. Even if she lost, it is dangerous to have such an organization exist. No matter what well have to catch them by their tails. Ill be sure to check with my subordinates afterwards.] (Aleck) Even without me saying anything, Prince Aleck knew what I was hoping he would do. Back in Rumberg, we were unable to catch any clues about the organization. This time, I hope that we would be able to catch some hint about our opponents will become increasingly dangerous when left alone. If Princess Aure became King, then who knows what kind of requests the organization would make of her. This would grant them the ability to manipulate the Laluzulu kingdom at will, with her secret deal with them being held against her. While I was preoccupied with my thoughts, we met up with the two children. They were talking to several soldiers ahead of us. [Yuuya, Luna found a monster! Under the ring, theres a monster hiding in this direction!] (Luna) [Said Luna but these people arent letting us through!] (Til) It was a rough explanation but it was enough for us to understand the situation. Not just for me, but for Prince Aleck. [I am the first prince of the Laluzulu Kingdom, Prince Aleck. I order you to let us pass.] (Aleck) [ Thats not possible. I cant allow anyone to pass through here.] (Soldier) [Is it Aures orders?] (Aleck) The soldiers didnt answer Prince Alecks question but their silence proved him right as Prince Aleck continued forward. [Regardless if Aure becomes the queen. Until the inheritance ceremony is over, my orders precedes hers. Furthermore, my actions are required to prevent a crisis from approaching the Laluzulu Kingdom. Obstruct us any further and you will be charged with treason against the kingdom. Will you continue to follow your duty?] (Aleck) [Hiie. Thats impossible. I-,.. I dont mean to go that far.] (Soldier) [Then let us pass.] (Aleck) As expected of Prince Aleck. If we were alone then we wouldnt have been able to fight through the soldiers who were trained in combat easily. We proceeded past the corridor the soldiers were protecting and found a hidden device which opened a hidden staircase. The device was incredibly well-hidden to the point that I dont know if I could have found it in time. I was extremely relieved that I decided to look for Prince Aleck as he began to explain. [Yuuya-dono. Ill be honest as were both men here. If I had won the inheritance ceremony, then I would have requested Lutra to be my queen. I wasnt able to find a method to get her to agree, however when Lutra mentioned the bet earlier, I couldnt help but smile.] (Aleck) My words were caught in my throat as a huge bombshell was dropped onto me. [.Arent the two of you siblings.] (Yuuya) [Our mothers are different. Besides, that isnt relevant to us royals. On the contrary, its common for royals to marry within the family to prevent our blood from diluting. Ive been enchanted by her strength and beauty for the longest time, which was why I wanted to exclude her from the battle. Although thats all in the past.] (Aleck) [Is this because you lost the throne?] (Yuuya) [Theres that, but also because there was a man stronger than me that she has found. I have a question for you, Yuuya-dono.] (Aleck) The conversation ended there as we reached the end of the hidden staircase where a cage was kept. The monsters were kept within the cage as three men were standing guard around it. The worst case scenario has occurred just as I thought. All three monsters werent here. That wasnt the worst of it all. The three men who were keeping guard, I couldnt see their levels. Meaning they were higher levelled than me, above the forty mark. I turned to my watch as the match was three minutes and twenty seconds away. Three mercenaries above level forty and three monsters around level fifty. These were the foes we had to defeat within three minutes. My bones are going to shatter from the pressure. [Yuuya-dono, well leave the conversation for later.] (Aleck) [I agree. Lets get these people out of the picture first.] (Yuuya) [Uhn. Luna will assasin them!] (Luna) When Luna flicked her fluffy tail, Bazerato which was tied to her tail flew through the air as she grabbed it. As well as several toys and sweets which fell onto the ground. It seems that there is a lot more to her tail than I thought. This was something that warrants an investigation. [Til, youll be using this bow.] (Phil) [Eh, oneechans earrings are bows?] (Til) [These too are magical items. Please generate the arrows yourself.] (Phil) One of the mercenaires seemed to be a magician as he began a chant. This was the start of the battle. Prince Aleck, Luna and I started running toward them as Phil and Til began to pull their arrows. Its a steep task to complete in three minutes, but well do it somehow. Volume 4 Chapter 19 - The old man creates the key for victory We finally found where the monsters were hidden based on my theory behind Princess Aures Summoning Magic. If my guess behind the summoned monsters was correct, then defeating this monster here would help Lutras odds of victory as I ran at full speed while preparing a chant. I told everyone else to focus on the human guards as our goal would also be achieved if the person activating teleport was incapicitated as well. Among the three mercenaries, one of them wore a robe which covered his entire body whom began chanting as another mercenary equipped with powerful enchanted metal armour stood as his guard. In an attempt to interrupt the magician, Phil and Til fired their arrows to him but the guards armour was extremely sturdy as their arrows couldnt put a dent into it. Although we began chanting nearly simultaneously, the magicians spell was completed before me as it began to cast the advanced magic Purgatory. Its main feature was its explosive power and wide radius as flames began to fill our surroundings turning it into a fiery hell, making it impossible to dodge in this narrow corridor. It was an ability strong enough to eliminate us in a single blow. However there was no need to panic. I had reliable teammates. [Icy Veil] (Phil) [Kyu!] Phil activated her spell which reduced fire damage while Erik granted flame and ice resistance to our entire party with his Blessing of the Dragon. With these, we wouldnt receive fatal damage from the flames as I continued to run through the sea of flames. My skin continued to burn as I continued suffering damage to my body, however I could still fight. This was the specialty of the Magic Knight. Despite having low defense, magic knights had exceptional magical defense. Along with my dragon leather armour, I was confident I would be able to endure Purgatory without any buffs but with Erik and Phils support, then Im extremely confident. Luna began smiling from behind me. Since day one, Ive always instructed Luna to hide behind me or Lutra if we were attacked by a wide area spell since Thieves had extremely low physical strength, physical and magical defense. [Now its my turn.] (Yuuya) My chant completed at a good moment as I casted my customized version of Lightning storm made into a sniper-type spell. [Superconductive Bullet!] (Yuuya) Lightning storm which was compressed into a single bullet penetrated the wizard at light speed. Furthermore the paralysis effect of the lightning affected his consciousness as he fell to the ground. The other two consisted of a large man and a thin man as the both of them came within my swords range. The thin man was rushing to open the door of the cage which pushed me to target him first. In order to defeat him, I turned towards the thin man. [War Cry!] The moment I raised my blade, the large man used War Cry which had a small effect onto other humans. However it still had an effect as my movements came to a halt while my mind was struggling to fight against the rage I felt towards the large man. Taking advantage of that moment, he swung his blade towards me. As if he was used to being in combat with other people He knew how to take advantage of his skills. Although my judgement was halted in that moment, I had the technique to compensate as the large man screamed. [OUHHHHHH! BASH!] (Yuuya) Since there wasnt a timing for me to dodge, I twisted my body to receive the blade on the hardest part of my body, the leather armour covering my shoulder. Since the armour covering my shoulder was round, by adjusting my body at a specific angle I deflected the slash by jumping up at the moment of impact, reducing the slash to a dull impact. My Deflect wasnt limited to my blade. It was my special technique derived from utilizing my body movements, making it possible to deflect so long as I had my body. Being guided by my sudden jump, the blade was guided down to the ground as the large mans face distorts in pain while grabbing his wrist. From the range of a blade, I took one step in reducing the distance to an arms length. I didnt have my sword in my hands, however there was no problem as I channeled my power from my feet up all the way to my palms, shoving his chin upwards in an instant. The large man fell to the ground in an instant as his body began conversing. This wasnt a skill but a martial art which had significantly weaker power compared to skills. However this meant that it could be utilized even without dealing any damage by rattling your opponents brain and cutting their consciousness. This was another way I utilised to close my status gap in the past as it allowed me to defeat stronger warriors with a single blow with the exception of exclusive classes depending on their ability. [Assassinate!] (Luna) The sound of ringing resonated in the room as Lunas voice could be heard. The thin man shifted Lunas point of impact from his chest to his shoulder similar to how I did but with his back facing Luna. As expected, these men were experienced in man-to-man combat. However, as a result of the dull impact he was pushed onto the cage and dropped the key onto the ground. Following the small stream of blood from his shoulder to his hands was a ring. It was the Eternal Ring which was capable of casting Teleportation. This is bad, hes intending to open the door and teleport the monster away. It would be dangerous if the monster was transferred into the coliseum before the battle between Princess Aure and Lutra begins. Luna was hesitant on attacking an incapcitated opponent to death as he began casting Teleportation. The moment he was going to succeed, a blade flew towards him as it penetrated his head. It was a brilliant display of accurate sword throwing, however it wasnt me.. [Prince Aleck, Im sorry.] (Yuuya) [No, it seems the best was saved for last just for me.] (Aleck) He took the Eternal ring from the dead mans body, throwing it to me while letting out a laugh. In contrast, Luna was depressed as her tail deflate down to the ground. I walked up to her and patted her head. [Yuuya, Luna could have killed him, but Luna couldnt do it. Luna expected that he shifted the impact But Lunas body couldnt move. When he reached out for the ring, Luna still couldnt move. Sorry, the plan nearly failed because of Luna.] (Luna) [Killing monsters is different from killing people. Hesitation is a real thing.] (Yuuya) Luna was hesitant about taking other peoples lives even though the other party was definitely a villian. From a different perspective, it may seem weird to hesitate against a villain but killing was still something you had to get used to. But it was something you shouldnt be used to. Luna began to cling onto me as I hugged her on her shoulders. Its been awhile since we slept together but we might have to tonight. She may be feeling depressed, but it just goes to show how good-natured she was. [Yuuya, its great that we managed to neutralize them without killing excessively.] (Phil) [That palm technique is so cool, teach it to me next time! I want to try it.] (Til) Phil and Til came over as Phil had already tied up the magician and the fainted man while she began performing first aid onto the big man. We have already recovered the Eternal ring making it impossible for the monsters to escape the cage and with two minutes to spare.. With this, Princess Aure has lost her hand. [Prince Aleck, what will you do with that monster? Are you going to kill it. It shouldnt be able to escape the cage without the ring.] (Yuuya) [If possible, I hope to keep it alive. If I have my alchemists perform research on it then we might be able to discover something.] (Aleck) [I understand. Then Ill leave this to you.] (Yuuya) Since my job is done and I want to support Lutra, we might be able to make it to the beginning of the match. In that case, lets do what we have to do. At the moment, the large man whom Phil tied up woke up. He started grinning as he laughed out loud. In this situation where his ally died, he and his remaining ally was tied up and both the key and Eternal ring was taken away from him. [Whats so funny?] (Yuuya) [Haa, you really think Ill answer?] [. Then would you rather have it beat out of you?] (Yuuya) That wasnt an empty threat. It was something I would do if necessary. [No, thats unnecessary. Prince Aleck, how about a deal? Princess Aure told us that youre a siscon. Ill give you the information on how to save your cute sister. In exchange, release me. Even if you were to torture me, I would never open my mouth. Furthermore, this information is something that you should never know.] Prince Aleck placed his hand to his chin as he immediately came to a decision. [Sure. I guarantee your life as the first prince of the Laluzulu Kingdom, Prince Aleck Lazule. My conditions are for you to be restraint for a week and for you to answer my questions. Also, Ill have you reveal your organizations goals and forbid you from returning to your base and have you monitored for several years.] (Aleck) [Your decision was quick. I admire your additional conditions.. Oi oi.Dont look at me with such suspicious eyes. I would never tell a lie in front of such a scary uncle. Im not hoping for a death wish this early. If I dont meet the conditions, I can tell from his eyes that I would be lucky to be killed in the future.] He was talking as if I was a madman or a psychopath. Although I dont deny his assumption since I would do it if necessary. And I was confident in spotting a lie when I see one. I turned to the prince. [Lets believe him.] (Yuuya) [Then, lets talk about what you hope to hear the most. There is another location where monsters are being held as well as another person capable of using teleportation. They would teleport the monsters once Princess Aure sends a signal using an alarm. If no monsters were sent once she activated the alarm, then she would sound the alarm a second time which the guys in the other location will teleport monsters.] We were done in. Princess Aure was one step ahead of us as she had not just one group but two group of monsters. [Where is that location!] (Yuuya) [I dont know. Princess Aure is more paranoid than anyone else. She doesnt trust her organization. Heck she doesnt even trust her own brothers and sisters. Ahahahaha. Just how was she raised as a child. Was that castle a hell?] I began to think as if my life depended on it. It was impossible for us to find another hidden room when we had one minute left before the match started to prevent teleportation. In that case, there is only one thing left to do. [Everyone, Ill begin heading towards Lutra. Even if she loses the battle, I cant allow her to lose her life.] (Yuuya) I strongly asserted that fact as Lutra would most certainly die if she faced up against several levels fifty monsters alone. I hope that if that happens, that she would surrender but the Lutra I knew would never surrender. And even if she did, Princess Aure might attempt to kill her in the guise of an accident just like what happened with PRince Aleck. .. In fact, it looks like Princess Aure planned to begin her rule by killing her other brothers and sisters. [But Yuuya, how are you going to get there in time? Theres only thirty seconds left.] (Luna) [I have this.] (Yuuya) The Eternal Ring which allows a limited number of teleportations. Im sure that the thin man hesitated using the ring immediately due to its limited uses however there should at least be one use left for a monster. [Uhn. Please take care of Lutra!] (Luna) [Well join up with you as soon as possible.] (Phil) [Yuuya-niisan, hold out until we get there!] (Til) [Kyu!] I had reliable friends as I whispered before activating the ring. [Yuuya-dono. I leave my sister to you.] (Aleck) [I intended that from the beginning. Although, it may not be my time to shine. We may have created a situation for Lutra to win. Princess Aure may have outsmarted us, but our trip here wasnt a waste. The key to victory has been set.] (Yuuya) It was definitely not a waste for us to come here. We were able to create a situation for Lutra to win if she chose correctly without hesitation. The rest depends on her shoulders now. If she was right, then she deserves the praise. However, if she fails, then Ill save her as her knight. The moment Princess Aure becomes the queen, then she will definitely attempt to kill Lutra. In that case, it might really be better for us to take Lutra with us on our journey. The teleportation was completed five seconds later after my chant as I began teleporting towards Lutra. Volume 4 Chapter 20 - The old man becomes a knight. Thanks to the effect of the Eternal Ring, I teleported towards the surface as I landed not in the ring, but in the middle of the audience. The ideal situation would be if Lutra managed to defeat Princess Aure, however I fully intend to interfere with the battle even at the cost of her victory if it meant saving her life. In order for Lutra to have a chance of victory, Princess Aure had to be in the dark about our activities. [Such a waste of an amazing item.] (Yuuya) It seems that the item only had a single charge left as the moment my Teleportation ended, the ring shattered. This answered my question about the mans hesitation in using the ring as he wouldnt be able to teleport the monster to Princess Aure if he had used it against us. A nearby spectator was surprised by my sudden appearance as I continued to inch towards the ring. Meanwhile, an attendant who was nearby noticed my presence and began approaching me. However I kept him away by informing him that I was under orders from Prince Aleck, as a hero of the kingdom was conducting a secret investigation. He was clearly one of Princess Aures underlings, but Lutras safety came first. When the ring came into view, Lutra and Princess Aure were already facing each other as the referee gave the signal. I prepared myself to jump out at anytime while carefully observing the ring. . . . (Ten minutes earlier, Lutras waiting room) Princess Aure and her escorts entered the room. Immediately after noticing her sister, Lutra got into her battle stance as she grabbed her shield, suspecting that she came to finish the job before the match started. [Lutra, you dont have to be so alarmed by me.] (Aure) [Ive already decided to be vigilant against you. Aneue, I trusted you. Yet why?] (Lutra) Rather than hostility, Lutras tone was filled with sadness and loneliness. Even after being eaten by the Starfish Larvae, even after she knew that her own bodyguard tried to kill her. Even after encountering the trap placed for her in the royal dungeon, she had a glimmer of hope as she tried to find evidence against her sisters motive. Previously, her siblings had prevented Lutra from obtaining any information about her surroundings. However thanks to her sisters absence and her brother ceasing his obstruction, she was able to finally understand the situation with the help of a certain hero. Although she set out to prove her sisters innocence, she managed to justify her murderous intentions instead. [Since youve discovered the truth, I will not make any excuses. It was all done for me to become the queen. If nothing was done, aniue would be the king with you by his side. Then there would be no place in the Laluzulu Kingdom for me. For my own sake, I had to eliminate you and aniue.] (Aure) Aures face remained calm with a smile as bright as the sun. [Aniue, and I, we both needed you. Aniue even said it, he would have needed your power if he became the king. And I told you that I would have placed you on the throne if I had won!] (Lutra) [Its a sad turn of events isnt it. Before the incident with the Starfish Larvae you didnt tell me that you were going to push me to the throne. The incident in the royal dungeon, was also your doing wasnt it? If aniue was his old self and better than me in all aspects, you would put him on the throne over me. You said it yourself. Its a shame but he hasnt changed at all nor am I on his level in any aspect. Which means that both of you must be erased.] (Aure) [. how did you come to such a conclusion.] (Lutra) [Lutra. All I am doing is answering your question. Abstain from the tournament. You dont have any hope of winning.] (Aure) Lutra knew. She had seen them begin to move when Prince Alecks battle had ended. She trusted her reliable allies to change the situation somehow. [I might not be able to defeat you. But that doesnt mean that Ill lose to you.] (Lutra) [No. There is no hope left for you to win. If you dont withdraw right now, the situation will be worse. Remember how I wasnt in the castle recently at all? Well Ive managed to find a suitable marriage partner for you. If youll remain outside of the kingdom, then Ill revert to the kind and loving sister anytime.] (Aure) Even though she wasnt bright when it comes to politics, Lutra knew that she would just be used to reap profits for others. [Thanks to this, my mind has never been clearer. Ill win. The reason why youre here, is because youre not confident in your victory. You would never waste time performing meaningless actions, this is enough for me to know that I will not lose.] (Lutra) [I cant believe that my Lutra has become this twisted. Im incredibly saddened by this.] (Aure) [Then you can continue doing so. Aneue, its about time for you to return. The match is about to begin. I wont be misguided anymore and I will beat you in the match.] (Lutra) I wont be misguided anymore. Her words were filled with conviction but unknown to her, Yuuya had already created the key to her victory. In order for her to win, then she couldnt hesitate and move forward. [Im sad that Ill have to lose my sister this way.] (Aure) [And so do I Theres just one thing I have left for you. Thank you for everything until now. Even if it was just a lie, I would never had survived and stand up on my own two feet, if it wasnt for the kindness you showed me.] (Lutra) Looking at Lutras face, Aure turned back without saying anything as the conversation she intended went completely awry. She intended to ask Lutra to repay her graciousness at the beginning by surrendering or take advantage of Lutras naivety and disrupt her thoughts right before the match. All to gain benefits for herself. However, there was something in her heart that couldnt let her say so. She felt that if she said that, then that important thing she had left, would break into a million pieces. Her battle with her sister was inevitable, and in a few minutes, one will be the winner who has everything. And the loser will be left with nothing. . . . [It is time for the final round of the succession ceremony! Competitors, enter the ring!] (Referee) Lutra and Princess Aure were facing each other in the center of the ring. The distance between them was only two metres as both of them waited for the referees signal. The moment the signal was given, the two fighters began moving. Princess Aure took a leap backwards while Lutra charged towards her at full power. Both parties knew that this was the deciding moment in the battle. Lutras only chance of winning was to defeat Princess Aure before she activated her *Summoning Magic* while Princess Aure jumped back to gain as much distance as possible. Although Lutras exclusive class, Crusader didnt have any increase in speed when compared to an average person, her fully charged rush forward was still fast enough to mistake her as a Thief. It was the movement technique called Shukuchi which was thoroughly beat into her by Yuuya. It was a movement technique which converts the users potential energy into kinetic energy for an instant, allowing them to travel at a higher speed than they normally could. While using Shukuchi, a sword was simultaneously being quickdrawn as her sword was pulled out of its scabbard and stuck out with all of her strength, erasing the two metres as well as the distance gained by Princess Aures leap. However, Princess Aure was still calm. Note: Shukuchi is called Ground Shrink or something similar to the sort in other novels. Im unsure on what to name it so Im leaving it as it is for now. She had expected this the moment her magic was exposed as it was a crucial weakness to a magic user, which allowed her preparations to bear fruit. Her battle dress wasnt particularly strong in defense, but it provided an additional effect that was crucial to magicians. The defense of a magic user was so ridiculously weak that it didnt make any sense to reinforce that tiny amount, but it was possible to supplement it with something else. Which is why they had this special ability. It was a passive ability that nullifies any attack inflicted on an hourly basis and attacks the source of the damage. The moment Lutras blade touched her dress, the sword began to crack and shattered, nullifying her sword thrust. It was a legendary equipment hidden in the castles vault, the Siren Dress. The armour was capable of rendering other legendary equipment unless for a period of time, and if the weapon used wasnt on a similar level, then it would be destroyed instead. [Looks like its my victory.] (Aure) Princess Aure said with confidence as she completed her summoning magic while Lutra lost her weapon. Although her alarm was instantaneous, Teleportation took five seconds to cast and one second to take effect. Taking into account the guards reaction and other possible human errors, it took a total of eight seconds. In other words, it would be her victory once eight seconds was over. However, nothing happened after eight seconds. Instead of panicking, Princess Aure immediately assessed the situation and assumed that something happened to the monsters. She had expected that Yuuya or Prince Aleck would be able to see through her plan and immediately activated her second alarm, extending Lutras time limit by another eight seconds. Another set of monsters would be summoned in eight seconds whereas it was impossible for Lutra to get a replacement weapon and strike at that time which meant that her victory was just delayed by another eight seconds. All she had to do was to endure the attacks of the Crusader class which had weak offensive power for eight seconds. She looked into Lutras eyes which were filled with even more vigor than before as Lutra threw her broken sword aside, continuing to rush forward while thrusting her shield forward. Princess Aure was taken by surprised by her sudden actions as she couldnt understand her thought process. Shields arent meant for attacking, even if it was used for that it wouldnt be lethal. [Are you that desperate to resort to a shield? Clear Wall.] (Aure) As a precaution, Princess Aure casted a barrier-spell which blocked physical attacks. However, Princess Aure didnt know. The trump card Lutra had, was being trained by Yuuya. The legendary battle princess, Senki Renoirs battle style was forgotten over the years and revived in her. [Shield Bash!] (Lutra) Her cold voice resonated throughout the ring. Lutras flawless movements was mesmerizing even though it was refined purely to strike others. Placing her entire bodys strength while amplifying her body further with a rotation, she thrust her shield forward. It was the thrust that Lutra was forcefully learnt, her speciality that was refined by the one and only Yuuya Grandwood. The shield which moved forward at an extraordinary speed continued to pursue Princess Aure who was trying to escape. Princess Aure smiled as the shield was going to miss by just an inch. Even if she miscalculated and the shield was going to land cleanly, it was just an attack by a crusader. The Clear Wall let out a screeching sound as it got struck by Lutras shield. So long as the shield held up, then her monsters would arrive. In otherwords, it would be her victory. However, her delusions were shattered. Right as Lutra arm extended forward, Princess Aure saw the tip of the spike in Renoirs shield appear out of the shield as the spike was forcefully pushed out of the shield at a speed exceeding the speed of sound due to its activation as well as Lutras speed and rotation on top of it. Clear Wall was struck down as if it were made of paper as Princess Aure couldnt even catch what happened next as she flew out of the ring, landing onto the wall next to the audience seats. [Aneue, you arent the only one with a trump card. In the past, I would have told you about it. But this time, it would have been my loss if I did. Thats why I kept the spikes hidden while I was in the castle. Just for this moment.] (Lutra) Although she was the winner of the battle, Lutras voice sounded somber as the audience began to confirm Princess Aures condition, who had let out a huge gasp. [This is-, the winner is, Princess Lutra!] (Referee) The referee declared Lutras victory as two monsters appeared in the ring, as the audience began to panic in confusion. The supposed summoner was unconscious, which meant that her chanting should had been interrupted. [I may have won, I wonder if Ill survive this.] (Lutra) Lutra said with a weak voice. Two monsters in their fifties, was far too difficult for Lutra. But retreating would expose the audience to them instead. The bipedal giant rhinoceros and giant cyclops was rushing towards Lutra as Lutra already had one foot into despair. It was that moment [You will survive, I am here.] (Yuuya) The back of the most reliable person in the world appeared in front of her, as the battle was practically over. With this persons help, the battle wouldnt be worrying in the slightest. [Yuuya-ojisama!] (Lutra) Yuuya completely deflected the two giant monsters attacks as he performed his signature. The ability created from the warrior who was, status-wise at the bottom of the barrel and was willing to show it to the whole world. Any anxiety she had was blown away as cheers rang out from the audience. It was as if everyone knew that she wouldnt lose with him here. Or rather, it could even be perceived as an exhibition. [Perfect timing. Its time to show off your newfound abilities.] (Yuuya) [Yes, Ill definitely do it.] (Lutra) Yuuya and Lutra stood back to back while facing each of the monster. The appearance of the two gigantic monsters facing off against the two warriors caught everybodys attention as her appearance was not just beautiful, but so was her movements. In fact, the most mesmerizing fact wasnt her abilities nor his, but the perfect collaboration between the two. [You would have lost if you hesitated. You performed perfectly.] (Yuuya) The key created by Yuuya, was the additional eight seconds from when Princess Aures first summoning had failed. If he hadnt found the monsters, then Lutra would had lost right after eight seconds. Although he had gone through so much trouble in that short amount of time, he had only earned her another few seconds. If she had hesitated even for a moment, then the key would have been gone. [I decided to win, even if it meant harming her. I didnt have the intention of killing her since I truly believe I was saved by her. Even if it was a lie. I had already decided a long time ago, to win without killing her. I was prepared from the beginning.] (Lutra) Yuuya let out a smile as he had witnessed the moment Princess Aure was sent flying If she had used her spike, Princess Aure would had definitely been blown to bits. Her spike was made of a special magical metal which could be shaped into anything its user wanted. This time, her spike was much rounder than usual making it more similar to a rod instead. Furthermore, her thrusts were usually slightly inclined towards the ground, but she had aimed it slightly higher this time, causing the impact against the terrain, the wall to be softened as some of the energy was wasted blowing Princess Aure away. If she had aimed lower, then she could have been killed instantly with the shock of being slammed on the ground. Lutra had made her preparations, both mentally as well as meticulously because of her conviction to not kill but defeat her sister. The battle dance performed by the princess and her knight, Lutra and Yuuya ended as the giant rhinoceros and cyclops began fading into blue particles. As it ended, Lutras strength was clearly transmitted to everybody present as the audience began to cheer and stood up in awe. [Lutra, wave to the audience. Its your first job as the heir to the throne.] (Yuuya) Lutra nodded as she turned to the audience, waving back with a dignified smile which riled up the audience further causing everyone to become even more enthusiastic in response. Her silver hair shone brightly in the sunlight as the setting painted a beautiful sight, signalling the end of the inheritance ceremony. It was the birth of the new queen. Volume 4 Chapter 21 - The old man enters the old man battlefield. Note: this chapter may be a little iffy since I had trouble understanding the chapter. Do let me know if there are areas that are confusing or require editing. With Lutras victory, the inheritance ceremony has come to an end. The right to the throne was given to Lutra and although she hadnt told me about her decision, Im sure that she would make the right choice. After waving to the audience, the audience cheers became even louder as Lutra had proven herself with her strength, as the second coming of Senki Renoir making her popularity rise higher than before. Even after exiting the ring together with ger, the cheers continued on. [I won. Yuuya-ojisama, its your turn now.] (Lutra) [Of course. Do you think that I would lose?] (Yuuya) [Fufu, thats true. I cant imagine that at all.] (Lutra) That was an overstatement as Ive lost countless times in my life until now Though I dont recall losing a single match ever since I reset my level. Lutras work wasnt over yet as there was still a ceremony to celebrate the new ruler of the Laluzulu kingdom later. However its preparations took awhile to complete as the victor wasnt known until the finals, thus another event was hosted to keep everyone occupied. It was a battle to determine the strongest knight in the kingdom. The strongest knights sent by their units as well as knights sent by the royal family would be competing in the tournament. Of course, I was being sent as Lutras knight. The rules of the battle were to land a hit on a vital point on the opponents body using a dull blade. This was the tournament that I won previous with a heavy heart as the rules made it possible. With these rules, ending the battle in one hit was possible as someone who focused on polishing his swordsmanship. This was how I was dubbed the Strongest Weakest Knight as someone who won the tournament, but could never win in a normal fight. This made me feel as if I had disrespected the knights while making them regret that they could not win the tournament. This was why I decided to overwhelm my competitors convincingly as the strongest knight. . . . The battle of the knights was about to begin in thirty minutes as me and Lutra parted ways in the coliseum. Lutra went to prepare for her ceremony while I went towards the waiting room. Right before we separated, Lutra grabbed my hand and stopped me before kissing me on my cheek. [Ma-.. Maybe, since I just won my match, I could share some of my luck with you. So, Yuuya-ojisama. Good luck.] (Lutra) Lutra began to walk away with red ears. [Another reason for me not to lose huh.] (Yuuya) Since Im her knight, I just couldnt betray my princesss expectations. Since I received a blessing from the goddess of victory, then I wouldnt be a man if I lost. . . . There were about twenty people who were considered the strongest knights in the kingdom competing in the tournament. The moment I entered the waiting room, everyones eyes turned to me. The competitors who had participated in the previous tournaments had looks of admiration, some had looks of hostility and people who directed their curiosity towards me. I walked towards a chair in the corner of the room and sat there as I observed everyone in the room. As expected of the knight order, only the cream of the crop was present as well as the personal knights of the other royals. Thats why I was burning with excitement. I look forward to the start of the tournament. . . . Since a knockout stage with twenty participants would take too long, the first four matches were qualifying matches with several people instead. Dividing its participants depending on their achievements and levels, we were divided into four groups of five participants. Each battle would be a battle royale and the last man standing would move forward to the knockout stage. Since the ring was too small for twenty people, the ring was currently being expanded and separated with partitions to allow the four groups to battle simultaneously. The audiences excitement reached its peak as the knights began walking onto the ring. Although this battle received a lot of attention, there was another reason for it. Since this tournament wasnt a sacred ceremony like the inheritance ceremony, placing bets was allowed as aristocrats and rich merchants began betting ridiculous amounts of money into the battles. Since large sums of money was involved in these battles, the audiences enthusiasm was increasing at an accelerated rate. By the way, I was allocated the number one and would be participating in group A. Since the number was allocated depending on the persons achievements, I was placed number one not due to my ability but my achievement as a previous victor. Since it was a gambling session recognized by the kingdom, a magic tool projecting the bets as well as the possible payout amounts for each group was used. Currently I was the third most popular knight while the most popular knight by a large margin was the vice leader of the fifth knight order in the group. Although it was more common to bet on the stronger participants aka the lower numbered participants, battle royales were valued differently. The best strategy for upsetting the tournament was to form a united front and defeat the favourites of the tournament. In addition to that, I was an outsider when it came to the other participants as the other four participants were all part of the knight order who were trained to cooperate, making it easy for them to form a team. It was painfully obvious that a one versus four battle was about to occur in my group which meant that the audience were less inclined to bet onto me. [Well, it could also be because of my class.] (Yuuya) Since the persons class was listed next to their name, my popularity was much lower due to my class as a magic knight. Since this was a tournament to determine the strongest knight, skills were allowed whereas magic wasnt. Since a magic knight was strictly inferior to a normal warrior in close combat, this was a huge handicap for a magic knight. The referees from each group began to confirm their respective participants as the battle started. . . . The battle has begun. In group A, the other four knights lined up in a semicircle around me without hiding the fact that I was the main target. The vice captain of the fifth knight order was an excellent commander while the other three looked oppressing. [Is fighting a magic knight in a four to one battle the pride of a knight?] (Yuuya) [Yuuya Grandwood, I admire you. Previously, the participant who was weaker than everyone stood above everyone else purely with his skill with the sword. It was someone who was adored and admired by everyone, including me.] I did think that he was familiar, it turns out that he was one of the squires who were watching me in the tournament. That young man has already become a vice-captain of a knight order. [Somehow, youve managed to become stronger than before. This is our only way to win I need to spare my knight order the humiliation of losing to a foreigner. It doesnt matter what methods we resort to, we will win!] With perfect coordination, the knights began closing in on me as the semicircle began to shrink. I was surrounded on all sides by the top knights, making it difficult to defeat even a single one of them. To top it all off, I wasnt able to show my full ability against them unlike the level fify monsters. It was difficult for me to defeat two level fifty monsters with Lutra, much less hide my true abilities against them for the tournament. However, my trump card wasnt shown then as I began to breathe deeply. The ability I uncovered when I face death in the eyes, and had honed for more than a decade. After obtaining the ability to perceive the blessing of the status in my body, I began to notice the white aura flowing and overflowing in my everyday life, gaining the ability to control it. By pulling my consciousness deep into my psyche, I forcefully pull out the white aura from my body and pushed it into my legs, pushing up my status. This was something I called opening the door, the only thing I would call my trump card. [Sorry.] (Yuuya) The vice captain of the knight order was blown away as he collapsed onto the ground. Opening the door and concentrating the power on my legs, I released the fastest Shukuji possible while thrusting my blade forward as quickly as possible with a single hand resulting in a dash that doesnt even get perceived by my opponents. Using this, I took out the vice captain while his subordinates were focused on surrounding me. [Vice captain!] [I-, I could even see it. Is that even possible?] [Dont panic, theres still three of us left.] I closed the door as the white aura was as exhausting as it was powerful. I would have to conserve my stamina for the battles after this as Ive already defeated the vice captain responsible for their cooperation. This battle can be won even without opening the door as I continued to walk towards my next target. . . . The qualifiers has been decided as the winner of each block has been confirmed. The winners for each block were me, Prince Alecks knight, the captain of the knight order and a young knight of the knight order. Every block ended as expected aside from block D as cries of joy and frustration could be heard. With this, the matches for the final knockout stages were announced with a projection magic tool. The participants for the first round was me and the captain of the knight order while Prince Alecks knight was battling against the young knight. Among the audience, foodstands were loudly advertising their food and alcohol as the final rounds were announced. People were running around placing bets on the matches while buying tickets to the actual matches themselves. [. That was dangerous.] (Yuuya) As expected of the elite knights of the Laluzulu Knight order. I was completely pushed to a corner. Having a numbers advantage in a battle was tremendous as I immediately took out the enemys leader and removing their chain of command. I would have lost otherwise as there were several dangerous moments even after defeating their leader. Since the allocated break was increased to an hour to allow the audience to place their bets, it was possible for me to return to the VIP seats to meet up with the girls while catching my breath. . . . Returning to my seat, the girls were still there as I realized that they were watching my battle. [Yuuya, that was amazing! Luna has never seen such a fast and powerful thrust!] (Luna) [Yes, youve never showed that to me either.. Yuuya, you cant explain that without saying that its a skill. Even so with your current status, the calculations arent right. Thinking about it, there has been several times youve showed us things that arent possible with your stats.] (Phil) As expected of Phil, she deduced it right away. [Right before I reset my level, I had obtained a power to increase my stats equal to an average person. Since it was something that couldnt be detected just by my status alone, it gave me the chance to defeat the vice captain immediately who had grasped the limit of my status.] (Yuuya) [What the. Thats amazing!? Yuuya-niisan, teach me that too!] (Til) I shook my head as I refused to explain the white aura for two reasons. [Luna gets it somehow. The moment Yuuya became fast, everything turned white!] (Luna) [Lies, I didnt see anything you know.] (Til) [Same for me.] (Phil) Shockingly, it seems Luna was able to see the white aura. The first reason why I didnt want to teach anybody about the aura, was because it was extremely dangerous to do so. It took a near-death experience for me to recognize the aura flowing out of my body. [If you cant see the aura, then I wont be able to teach you. Luna on the other hand might be able to do it.] (Yuuya) [Uhn! Yuuya, teach me!] (Luna) [Ughh, this is frustrating. Ill definitely learn to see it!] (Til) Til looked frustrated as she squeezed Lunas nose. [You may have the talent, but its still too early for me to teach Luna. If used incorrectly, you wont be able to move a single finger. Think back to what happened in Rumberg with the Killer Ape. That wasnt because I took too much damage from its attacks, but because I had overused the white aura.] (Yuuya) That was the second reason. You wouldnt be able to move after using it. Although there was a limit to how much you could use, it varied depending on your physical condition and strength. Unless you could gauge your own physical condition perfectly, it will be dangerous. [Yuuya, its too early but once Luna grows stronger, will you teach me?] (Luna) [Ah. Sure, I promise. If that time comes Ill teach Luna.] (Yuuya) [Hurray!] (Luna) I had told the girls to bet on me yesterday as I was familiar with the gambling culture. At the very least, I made sure to keep a reserve of cash we would need for our journey. However, it was a little worrisome as we had a large amount of money hence the amount we had placed was large as well. Since this was the biggest event of the kingdom, there were many aristocrats and rich merchants participating and placing large sums of money into the pool, which drastically reduces the amount we could earn by winning the bet. However, it was still a profit. Thats why the magic knights rating was low. However, unlike the qualifying round, the knockout stage consisted of one versus one battles. [Its time for me to head back. Ill do my best for the rest of the tournament. When I come back, Ill be the strongest knight.] (Yuuya) [Yuuya, do your best!] (Luna) [If you win, then you can get a nice private reward from me! Yuuya-niisan, Ill let you look at my chest every now and then.] (Til) [.Til. By a reward you mean a punishment right?] (Phil) [Hiiieee. Oneechan, forgive me its just a joke.] (Til) Its nice to hear that they are still full of energy. Ive gotten a good break before the final although its a shame I didnt get to meet Lutra. Lets be sure to win the two remaining matches convincingly. Volume 4 Chapter 22 - Epilogue: The old man goes drinking. Epilogue: The old man goes drinking. It was finally the final match of the tournament. My opponent was Leonhart, the personal knight of Prince Aleck. He had always accompanied Prince Aleck even during his journeys into the dungeon resulting in his high level along with the prince, however he wasnt just high-leveled. He had also joined the prince and his training with the sword, resulting in a similarly fast and sharp battle style. It could be said that he was the other half of the prince. [His blade is too honest.] (Yuuya) If he was battling a monster, then he wouldnt have any problems. However, against a human opponent that was capable of reading his attacks, his attacks wouldnt connect easily. Similarly to Prince Aleck, he lacked experience against other human opponents. His preliminary movement was minimal and he hadnt made that many unnecessary movements, however his movements were far too linear which was why I could defend against his attacks easily. On the other hand, Leonhart had problems reading my movements as he was consciously forcing himself to follow my movements. Everytime he tried to block my attacks, he was slowly losing his sense of balance as his movements became more and more limited until finally, his blade flew out of his hand into the air. [You got me, Yuuya-sama.] (Leonhart) The winner was decided as the referee announced. [The winner is, Yuuya Grandwood! With the title from his previous victory, the title of the strongest knight in the Laluzulu kingdom goes to the knight chosen by Princess Lutra, Yuuya Grandwood! The knight who triumphantly returned to the kingdom after saving his princess and overwhelmed the competition. He is no longer the Weakest Strongest Knight, he is officially the Strongest Knight!] The audience started a standing ovation as everyone recognized my strength in the competition. The earnings in the finals was 1.2 times your original bet. More than half of the audience believed in my victory rather than Leonhart. Leonharts handsome fact distorted as he forced out his voice. [I wanted to win, for that persons sake.] (Leonhart) [Youre strong. If I had battled you ten years ago instead, then I wouldnt have won. Youll win it next year.] (Yuuya) [I thought that would be the case this year. I never would have thought that youll have become even stronger as you age. Youre a monster However, I learnt a lot from this battle. Thank you very much for this valuable match.] (Leonhart) Leonhart bowed respectfully before leaving the ring. If Prince Aleck has a loyal subordinate just like him, then Im sure he would be safe. Interrupting my thoughts, the referee requested a speech for the audience. As I felt slightly annoyed at this, I answered without thinking. However, it wasnt too difficult to choose my words as there was only one thing to say here. [I dedicate my victory to my princess, Princess Lutra.] (Yuuya) It was extremely cringe-inducing and embarrassing, but I am Lutras knight. This was definitely something I had to do. It felt like the audience was riled up as their cheers became much louder, especially the women who let out loud pitched screams. However it just made me more embarrassed and I wanted to run away as soon as possible. . . . After exiting the ring, the ceremony to celebrate the new ruler had begun. For the ceremony, the new ruler would greet the royal family in the ring before exiting through a special gate leading to the city. and enter a gaudy carriage to perform a parade throughout the city. The audience would then return to the city where a city-wide celebration would begin. Just for today, the stores would be open all night long and the party would continue all the way till sunrise. This was the Laluzulu Kingdoms most renowned holiday as well as its number one tourist attraction as the city was filled with tourists. The ceremony began as Lutra entered the ring, followed by the flamboyant carriage for the parade. She was wearing an elegant white dress with full makeup and hair full of ornaments befitting a new queen. [Lutra, she look beautiful!] (Luna) [Uwaa, she looks just like a princess.] (Til) [I expected her to be beautiful with makeup but I didnt expect it to be this beautiful.] (Phil) Everyone was admiring Lutra who was fully dolled up, including me. It felt like we were reminded once again that her true identity was a princess. . Or rather, she was a queen now. That Lutra begun to speak as her words were fully audible by the entire audience with the magical loudspeakers. [There is something I want everyone to know. Ive won the succession ceremony and gained the right to inherit the throne. It is my genuine feelings that Im elated to be given this opportunity.] (Lutra) The voices of the audience could be heard congratulating Lutra as she continued her speech. [However, I am currently lacking as a queen. A true ruler isnt just about their strength. This country will not prosper just because I bested my siblings in a duel. This will not result in the happiness of the kingdom. Which is why I decided to concede the throne to my elder brother, Prince Aleck, and crown him the king of the Laluzulu Kingdom. His abilities and experience is what the Laluzulu Kingdom requires to prosper.] (Lutra) As Lutras speech ended, Prince Aleck appeared behind her wearing the crown, the proof of his succession. Although it was supposed to be a touching moment, the audiences response varied as some people did not support having the loser of the ceremony succeed the throne as it did not follow the Laluzulu tradition. [Just as Lutra as said, I will become the new king. However, this will only be a temporary arrangement until Lutra is ready to take over the throne. On the other hand, I intend to put my heart and soul into turning the kingdom into her ideal form. This is the end of our petty sibling rivalry. From this point on, we will combine our strength to make this country, and the people in it prosper from now until forever. Everyone, please lend Lutra, and I your wholehearted support.] (Prince Aleck) Someone somewhere began clapping their hands as the applause began to spread until the entire audience roared in support. There were even people who began admitting the fact that Prince Aleck would be a splendid king. So this is the answer that Lutra and Prince Aleck chose. It felt like there are still too many things lacking if Lutra succeeded the throne, which is why they decided that Prince Aleck would become the king and provide guidance to Lutra until the day she reclaimed the throne. I didnt think that Prince Aleck would be supportive of these conditions which felt way too beneficial to Lutra, however it felt like the right decision regardless. [Then, our party..] (Luna) [Lets celebrate the birth of a new Laluzulu Kingdom.] (Yuuya) Prince Aleck and Lutra lined up on the ring as they declared the birth of a new era as the people began to cheer, All hail the Laluzulu, all hail King Aleck, all hail Princess Lutra. When the special gate opened and the two of them entered the carriage, everyone began to rush out of their seats as the carriage headed towards the city. It was the beginning of a long night. [Lutra has gone on her way. Luna feels lonely.] (Luna) [She has always been with us hasnt she.] (TIl) [Kyuii..] Luna whispered in a low voice as Til and Eriks expressions sunk. Once again, everyone realised that we would be parting ways with Lutra. . . . After the ceremony, instead of returning to our room in the castle we decided to head out into the city to enjoy the festival in order to forget about our farewell with Lutra. The city was burning with a festive mood as the stores services were extremely good and were much more generous than usual. Thanks to our gambling in the coliseum, we had a large sum of money to spare as we bought several things. [Yuuya, that food in that stand looks extremely delicious!] (Luna) [Its a fruit that Ive never seen before.] (Til) [Its seasoning tastes just right.] (Phil) Everyone seemed to enjoy themselves, however it still felt a little forced as Lutras absence still left a large hole in the party. . . . After touring a majority of the city and a bit of shopping, we entered a bar. There were many shops which were full of people likely looking for a break from walking. We had entered the bar for a break, however the food and alcohol in the bar was much more delicious than we expected as we continued to eat to our hearts content. The alcohol in particular was amazing as I was drinking lager rather than my usual ale. Typically, lager was undrinkable due to its bad taste at room temperature but the lager here was surprisingly good. Furthermore the drink was served chill making it much more refreshing in this heat. [This meat, is delicious!] (Luna) [This coconut juice is so cold its cooling my entire body!] (Til) [Wheat based alcohol arent my specialty, but this is extremely delicious.] (Phil) We enjoyed the bars cooking and their drinks as we ordered their specialty, a beef stew made with cow innards called Laluzulu. It also went well with the alcohol. There are very few towns which rear livestock as a lot of meat was available in the dungeon. This meant that very few towns served animal visceras in their dishes. Regardless of the quality of ingredients they used, this stores cooking was without a doubt, delicious. As we talked about our plans for the immediate future, our stomachs were becoming swollen. WIth this, our adventure in the castle, has come to an end. Well be leaving this city after sending our greetings to our companions as well as paying a visit to Prince Aleck to check if he has gotten any leads on Princess Aures situation. We are adventurers after all. There isnt any reason for us to stay in a single place for too long. Our main topic for today were the matches that occured today as I began chatting with the girls. Our dinner was fun as we continued to chat while having good food and alcohol. However, it wasnt enough as everyone seemed to think so. It felt much emptier since Lutra wasnt around. It was at that moment. [Is it alright for me to have this seat?] I heard a soothing voice from behind me as we were currently seated at a six seat table, which meant that two seats were available. [Go ahead. We plan to continue enjoying ourselves for a while.] (Yuuya) [Looks like youre having fun even with just four people.] [Well, its enjoyable even with four people. But its still better if we had five Lutra.] (Yuuya) Even without turning back, I could recognise her voice. [Lutra!] (Luna) [You actually managed to sneak out!] (Til) [Kyu!] [Ill order a drink for you immediately.] (Phil) Everyone seemed to return to normal as compared to their forced expressions from earlier. [Ill prefer it if you stopped calling me Lutra since itll attract attention. Furthermore, my identity right now is Selene.] (Lutra) While pointing to her black hair, Lutra No, Selene smiled back. [Are you sure? Being here.] (Yuuya) [Yes, the parade has ended and Im already done greeting the nobles.] (Lutra) [I see. Im glad that well at least be able to have a farewell dinner for you. I didnt think we would have another chance to enjoy a drink like this with you for the last time.] (Yuuya) [Farewell? Why are you pushing me aside out of a sudden? I wouldnt want to be kicked out like this without my consent.] (Lutra) Lutra let out a mischievous smile. [Well welcome that idea anytime, but is it really okay?] (Yuuya) [Yes. Ive already talked to my elder brother. Im sure far too inexperienced nor do I know about the outside world. Which is why Ive been allowed some time. To explore the world and experience the vast world before I return to the Laluzulu Kingdom. Yuuya-ojisama, most important of all, I still want to continue travelling together with everyone. Is that okay?] (Lutra) [Ive already said it didnt I? Well welcome you with open arms.] (Yuuya) [Hurray, were back with Selene!] (Luna) [Well always need a tanker with us!] (Til) The glutton duo got up and hugged Selene as Erik landed onto Lutras head. It was a sight for sore eyes. It was great that we would still be able to travel with Lutra. [Oh right, I have a letter for Yuuya-ojisama from my elder brother.] (Lutra) I took the letter sent by Prince Aleck from Lutra as I looked to Lutra who seemed curious about its contents before opening up the letter. Just what does he think of me? Even if he didnt mind that I reached out to Lutra, I wouldnt lay a hand on a girl like her. Besides, I already have a lover. [Whats written in the letter?] (Lutra) [Its too early for you to read this letter.] (Yuuya) I stuck the letter in my pockets as she didnt have to read this. [Yosh, lets ring the bell and order more food. Oh, looks like Selenes alcohol has arrived. Just in time, lets have a toast.] (Yuuya) I raise the glass as the girls each raised their respective glasses while Lutra raised the glass tha the waiter just delivered. [Cheers!] (Everyone) It looks like we will continue to travel with this five man party from now on. I was so happy that I couldnt help but smile. Although there were several issues with this, lets forget everything for now and enjoy the moment and lucky for us, tonight is a good night for us to party till the morning. Volume 5 Chapter 0 - Prologue: The old is entrusted with a divine sword Prologue: The old is entrusted with a divine sword < Start of chapter > When I realized that Lutra was going to continue travelling with us as Selene, I couldnt help but feel extremely happy about it. Not just me but everyone seems felt the same way as Luna and Til, who were usually the ones to devour our food within seconds, had served the dish to Lutra instead. Even more surprising, that dish was a large bowl of chicken stew. [The last dish is for Selene to eat!] (Luna) [Im grateful for your consideration.] (Selene) Selene smiled brightly as she received the dish. As someone who had been together with us for a long period of time, she knew how special Lunas gesture was [Its great that Selene is finally going to be with us for sure. But it may become complicated now that my oneechans rival is back.] (Til) [Til, youve been saying that a lot recently. I wonder if youve started to develop an interest in romance? Continuously teasing me while watching Yuuyas reaction closely. Youre starting to develop a bad habit.] (Phil) [Ow- Ouchie, youve got it all wrong. Whats wrong with playing around with my own elder sister.] (Til) [I see. In that case please listen closely. If you inflict pain onto others then you should expect to be shot back. Speaking of yesterday night, while everyone was sleeping.] (Phil) Phil looked straight into Tils eyes with a smile and eyes which didnt look harmless at tall. Frankly speaking it was horrifying. [Wa-, Wa, Wa, Wait a minute, oneechan you noticed that!?] (Til) Tils face turned completely red as she began flailing her hands around. [Well.. What is this about?] (Yuuya) Truth was, both me and Phil had noticed it. Unlike Luna who slept like a pig, Phil and I were in a state of half-conscious in our sleep to keep a lookout for any potential assailants in the castle. However, I pretended that I didnt know anything in order to protect Tils purity. [Yuuya-niisan, Uhm, its.] (Til) [What are you talking about? I slept really well last night so I dont know what happened.] (Yuuya) [Eh, really. Thank god. Oneechan, make sure you never say a word!] (Til) [Thatll depend on your attitude from now on.] (Phil) [Grrr, Oneechan is a vicious person!] (Til) Til began scowling towards Phil as the two of them had a heartwarming relationship. Not only was Phil her older sister, but it seems that she had taken good care of her sister as well. [Its about time for us to head back. We have plans in the morning after all.] (Yuuya) Since the celebration was completed a while back, the new king had been officialized. However, we had several unrelated errands to perform before departing the city. At the very least, I hope to have a nap before the day begins. [Uhn. But before that, is dessert! Luna wants a super duper gigantic extra sweet pancake with lots of fresh cream! No, Luna wants three of them!] (Luna) [Uwa~, there are so many fruit-based desserts here. I want a mixed berry tart. No I dont want a cut, I want the whole thing!] (Til) [Having something sweet after a heavy meal like this sounds amazing. In that case, I would like one of your signature oversized parfaits with additional melon toppings please.] (Phil) Luna, Til and Phil ordered their desserts right after the meal. I could feel the heartburn in my chest just from listening to their names as all three of them ordered something that was meant to be shared among several people.. [.Ive been thinking about this, how does everyone eat this much but not seem to get fat from it.] (Selene) [Demihumans and Elves arent as proficient as humans in storing fats in their body.] (Yuuya) Since their bodies were built for efficiency, unlike humans, they were less prone to producing excess flesh that hindered their movements. They, like humans do store fat as well, however their fats were much easier to convert into energy thus making it much easier to burn. This was why no matter how much Luna ate, she never appeared to gain any weight. There was still a downside to this blessing though, as they would not be able to efficiently store energy in their body. Once they ran out of food, they were extremely vulnerable to starvation. Although that couldnt specifically be said as a disadvantage. [That Sounds really nice.] (Selene) Selene looked hesitant as she stared at the dessert section on the menu. She probably wanted to order a dessert as well but she was afraid of getting fat. [Its fine for you to eat more you know. Arent you going to be an adventurer together with us? In that case then well continue our training tonight.] (Yuuya) [ Thats true. I wont get fat so long as I keep my body active. In that case is it fine if I got the chefs signature cake?] (Selene) Selene asked for a normal portion of cake unlike a ridiculous amount like Luna. Since it felt uncomfortable to be the only one without dessert, I ordered the same dish as Selene. Although the sight of Selene continuing to death stare Luna who seemed to gobble down the mountain of sugar easily made me laugh out loud. . . . The next day, we returned to our room in the wee hours of the morning and took a quick nap before packing our belongings and heading towards the top floor of the royal castle. [The current Yuuya looks so cool!] (Luna) [Really. Its embarrassing wearing something like this.] (Yuuya) My current attire was the uniform worn only by the senior officers in the Laluzulu Knight Order, as well as a ceremonial uniform meant for battle. Thus, its design was fairly sophisticated and quite expensive. Since it was a battle uniform, its decorations were kept to a minimum as well as its material to reduce its users silhouette as much as possible. Thanks to its minimalistic design, it gave off an extremely dignified look. [Luna looks cute too. The outfit suits you.] (Yuuya) [Its too tight and hard to breathe. But if Yuuya says so then Luna likes it too.] (Luna) [Hey hey, what about me, what about me?] (Til) [Til looks cute too. If you went out like this, then people might mistake you as a princess.] (Yuuya) [Fu fu. Yuuya-niisan is incredibly sensible at times like this. Ill give you a free service. Luna, you should do a spin too, your skirt will twirl along with you! This will make any mans heart flutter! Although dont twirl too much, youll expose your underwear. My mother used to tell me that its much better if you can barely see it.] (Til) [If Yuuya likes it then Luna will do it too!] (Luna) Luna and Til began spinning around and twirling their skirts provided by the royal family which would be considered the finest and most fashionable clothing that any noble could wear. Luna and Til were wearing a red and green dress respectively which looked good on them as they looked much cuter than usual. [You look beautiful in that dress.] (Yuuya) [Really? I should wear this sort of clothing more often then.] (Phil) I complimented Phils dress as her face became completely flushed. Unlike the duo who wore fluffy and colourful dresses, she was currently wearing a sleek black dress which fit her small stature and although her chest area was slightly lacking, she was still extremely charming. [The two of you, its about time for us to head out. Were approaching the promised time.] (Yuuya) [Uhn. Understood.] (Luna) [If the leading role is late then itll be extremely lame. Lets hurry!] (Til) The two of them pulled my hands as Til reminded me of my role today. Lets pull off the best performance ever. . . . Guided by the servants, we headed towards the kings chamber where we could directly converse with the King. The servants entered the room ahead of us as they ensured that everything was prepared. [Now then, please enter this way.] [Ahh, Okay.] (Luna) After everything was prepared, I separated from the girls as they went to another door while I waited next to the front door. My turn came next as the front door opened shortly after. [Yuuya Grandwood is entering.] The servant raised his voice as trumpets were being played in the room. Following the servants instructions, I stepped into the room. At the back of the chamber, Prince Aleck.. I mean, King Laluzulu was sitting on the throne while Lutra was sitting next to him without her hairpin. The red carpet covered the path to the throne with numerous high profile nobles being lined up on either side, with the exception of Luna and the girls who were currently pretending to be my relatives. As I walked to the end of the red carpet, I started to kneel on one knee as I lowered my head. King Laluzulu nodded his head in satisfaction. [From this point on, Yuuya Grandwood will be appointed as an official knight of the kingdom, as well as the title of an honorary noble.] (King Laluzulu) This entire ceremony was only possible as King Laluzulu was finally appointed as the ruler. Although I had participated in the tournament for knights, I was merely Lutras knight in name as knights could only be admissioned into the tournament directly by the royal family. I was given the status of a noble, but aince I wasnt going to remain in the kingdom, the king avoided giving me land as a reward as I wouldnt be around to govern it. Instead, he decided to provide me a monthly wage to act as a knight and an honorary noble since it didnt come with any obligations to a land or any unnecessary work. Prince Aleck had informed me about his decision before the inheritance ceremony as a reward due to the fact that I was Lutras benefactor regardless of the outcome. And above all, this was necessary to bestow one of the divine treasures of the country, the Divine Sword. Unless I was an official knight of the kingdom, merely gifting me the sword wouldnt be possible. Truthfully I had received a similar proposal previously but I chose to decline as I wasnt able to stay by Selenes side nor did I feel like I had the ability to receive the blade. However, this time I will continue to protect Selene by her side and I would gladly receive the power that came along with the blade. I had zero reasons to decline. I still remember that day. After refusing the offer, Leonard continued to mumble on and on about how it was a waste that I refused it and that I would never be able to get a second chance for it. It was really noisy, but I had zero qualms about rejecting the gift and that had saved my life. It was because I had endured his complaints and was insecure about my inferior stats that gave me this second chance. A wave of nostalgia hit me as I wondered what could change Leonard this much? He was a good person which was why I accepted him as a disciple and even entrusted my back to him. I didnt want to limit his limitless potential and left the party the moment he thought about challenging the Tower of Trials. I still cant believe that he would say something as headstrong as taking Phil back by force with all his strength. [Raise your face, Yuuya Grandwood.] (King Laluzulu) [Yes your majesty.] (Yuuya) After a short delay, I raised my face immediately as I realised that my mind was drifting off. [Before I appoint you as a knight. Tell me. For what reason does your sword exist?] (King Laluzulu) [To protect my princess.] (Yuuya) [Are you willing to stay true to your word? To protect your princess even with your life?] (King Laluzullu) [Yes, I would.] (Yuuya) [Now, I officially appoint you as a knight of Lutra Laluzulu as well as the title of the Strongest Knight in the Laluzulu Kingdom. I shall bestow upon you the title, Knight of Oaths as well as the divine blade, Dainsleif.] (King Laluzulu) Following his words, Lutra walked down from the throne holding a sword with a pure white sheath. [My beloved Knight. Accept this blade. And swear on your life, that your words are true and pledge your loyalty.] (Lutra) I accepted the blade as I took Lutras hand and kissed her hand. [A pledge has been made here and the divine blade has been bestowed. The divine blade has been passed down to the strongest knight of the kingdom. The knight of Princess Lutra, the Knight of Oaths. Yuuya Grandwood. You are a knight, it is your duty to honour your title.] (King Laluzulu) [I understand, your majesty.] (Yuuya) Voices could be heard as an applause could be heard propagating throughout the chamber. Being entrusted with this sword as well as being officiated as a knight was something to be proud of. However, more than that, I had a strong urge to test out this Dainsleif since like Renoirs shield, it was a god-tier weapon. It was even better than Renoirs shield in performance as it originated from Scandinavian mythology. After the ceremony, we would have a lot to talk about during lunch regarding Princess Aures punishment as well as the organization behind the evolving monsters. It was impudent for an adventurer to talk to the king directly about matters such as this, however it was necessary. I continued to hold that thought as we headed for lunch. The organization which created the evolving monsters as well as Princess Aure were important pieces. Especially the former which felt extremely ominous. Volume 5 Chapter 1 - The old man begins his departure. After the ceremony had ended, I proceeded to the dining area as instructed by the newly crowned king Laluzulu. Due to the content of our conversation, the number of people present was kept to the bare minimum. In my case, only my party members were presented while King Laluzulu only had his second half, Leonhard and several bodyguards present. Our meeting was being conducted over a meal as the food was delicious as usual. However the silence in the room was deafening as the knights present in the room occasionally glanced towards our two beloved duo who despite their heavy meal last night, devoured their food heartily at the table. Just as our meal was about to be done, the first person to bring up the main topic for today was King Laluzulu. [After her recovery, Aure was arrested for her treason against the royal family. After conducting an investigation, we discovered several cases of money laundering as well as definitive proof of her betrayal. The person herself had revealed everything without any form of resistance. The monsters that she possessed were bought from an organization called Firoria Cartel. Weve also tried to make contact with her secret contact in the organization but the person was found dead in an alley. Most likely, once Aures plans were foiled, the organization decided to cut their losses and destroy any traces leading to them.] (King Laluzulu) [They moved really quickly. Even though it was to eliminate their own traces, it was far too quickly.] (Yuuya) Speaking of which, even with the incident in Rumberg back then, the defective guild leader whom was kept under tight supervision was quickly silenced as well. An enemy who couldnt be too careful that was quick, decisive and accurate in their actions. But it is to be expected if our opponent was the Firoria Cartel. [Its an extremely tight organization. Firoria Cartel. Knowing you Yuuya-dono. Would you happen to know anything about them?] (Yuuya) [I know them. Theyre an enemy that I know all too well.] (Yuuya) When I heard their name earlier, I was desperately trying to suppress my rage and it was the same for Phil. To the two of us, it was a name we could never forget. [Firoria Cartel is an organization which dwelled in the underworld, dealing with dirty work behind the scenes including assassinations, drug trafficking, and trading of slaves. It mostly consisted of adventurers who were fired from society due to their unrestrained behaviors, participating in crimes and other violations. They mostly operated in the southern countries. Which is why for Prince.. Sorry, your majesty to be oblivious of them isnt unexpected.] (Yuuya) [Its fine even if you call me Aleck. You can call me however you like. I see, its a southern organization then. But even if they belonged to the south, such a large organization wouldnt be difficult to catch. It looks like well be able to catch onto their tails far quicker than we thought.] (King Laluzulu) I shook my head. Since the organization seemed to be planning something big, then it wouldnt be difficult to grasp the scale of their operations. Even if their base of operations was out of the Laluzulu Kingdoms reach, it would be easy to obtain information about them just by following their messengers. [No, thats impossible. The organization has already been thoroughly crushed years ago. They were once the leading figure in the underworld as the main distributor of elven goods. They had imprisoned countless elven girls to manufacture Drop of the World Trees for them to sell all around the world while training them and selling them as slaves. Theyve even destroyed numerous elven villagers just to replenish their stocks. Due to the anti-aging properties of the Drop of the World Tree, nobles and even government officials had a hand in allowing their activities effectively giving them the freedom to do whatever they damn pleased.] (Yuuya) Treating elfs as a money-making machine was something Im not pleased to say out loud. [Then how was the organization enabled all around the world, destroyed by anyone?] (King Laluzulu) [It just so happened that an elven village which they targeted had issued a subjugation quest request to the guild. The elves tried to scrounge up all the wealth they had, but it was never a large amount which never attracted any adventurers. The problem became exasperated once word that a criminal syndicate was involved in the quest spread around which was why there wasnt any adventurers at first, however, a stroke of good luck had struck.] (Yuuya) I closed my eyes as I recalled the memories of those days over a decade ago. [Legendary elven adventurers and other respected figures had contributed their own wealth to the quest making the quest much more attractive than its risk. Those adventurers had made use of their own connections as well, gathering many powerful adventurers to fight for their cause. As a result, other adventurers decided to join in proclaiming to be justice by battling against the wrongdoers.] (Yuuya) I was part of the latter who participated in the quest. My former teacher was also present as I owed him a mountain of gratitude. Even with the possibility of being targeted by a criminal syndicate, it wasnt something I could refuse. [I see, if the government officials were already bought over, then the only hope left was to rely on the adventurers. By gathering the top adventurers from all over the world, then it was possible.] (King Laluzulu) [Thats right. For the bunch that targeted the elven village, they unexpectedly found themselves in a war against a large number of adventurers and as a result, found their main forces completely destroyed and their whole infrastructure collapsed. Afterwards, the syndicate decided to take revenge by retaliating against the adventurers who participated in the subjugation but the result was once again not what they expected as the adventurers collusion was thorough as they launched an attack against the syndicate before any assasination attempts could be performed. After the remnants of Firoria Cartel was wiped out, the organization was dissolved completely. The events of the quest is still fresh in mind as I was one of its participants.] (Yuuya) It was one of the worst battles Ive ever seen. Adventurers were prepared to lose their lives in battle due to their trade, however it was rare for us to have any experience in taking the lives of other humans. In so many ways, the battle against the syndicate was a much more of a nightmare than the defense of the elven village. I never want to experience that ever again. Ive built too much and have too many important people to lose now. [Yuuya-niisan, is that village] (Til) [Thats right, that village is both Tils and Phils hometown.] (Yuuya) [Its understandable that you cant remember anything. You were far too young back then. If back then, Yuuya and the other adventurers hadnt stepped in then everyone in the village would have been captured. Til and I would still be at their mercy even until today.] (Phil) The entire incident wasnt completely bad though as I ended up meeting Phil thanks to it. Thanks to that one incident, Phil had left the village in adoration of adventurers and one thing led to another, resulting in her being under my tutelage. [I see I understand now. Thanks to Yuuya-dono Ive gotten the full picture about Firoria Cartel. Ill be starting the investigation from this point on. Ill be sure to share any information we obtain with each other.] (King Laluzulu) [Please do so. If the organization was to be revived, then it wont be just another countrys problem.] (Yuuya) Firoria Cartel. The person who killed the head of the organization was me. Not only that but Ive already hindered their operations twice in Rumberg and now with Princess Aure. It wouldnt be surprising if I was already being targeted. . But why would the organization go out of their way to adopt the name of a deceased syndicate? In the underworld, your name was everything. Without a respectable reputation behind your name, people would never patronage your business. By using the name of a defeated criminal syndicate, you would only be defeated once more. That was how the underworld looked at it. Even if they accepted the negative aspects of picking up the name of Firoria Cartel, they would be exposing themselves to the dangers of the organizations past actions even if they were unrelated. Without sufficient information, we have no choice but to just keep our guard up against them. Moving onto the next topic.. [Then what will you be doing about Princess Aure?] (Yuuya) This was something that was also eating at my mind as she was someone Selene cared about more than I did. [Its regrettable for us to lose a valuable asset such as her. Which was why in exchange for her complete obedience, I decided to allow her to continue contributing to the kingdom. Under strict supervision of course. Lutra, youre fine with that too right?] (King Laluzulu) [Yes. Its nice to hear that aneue would continue to live. I was saved by her once. And above all, the Laluzulu Kingdom needs her ability.] (Selene) Both rationally and emotionally, both parties agreed that she was beneficial to the kingdom. [However, Aure is a stubborn person. She would rather lose her life than to work under me.] (King Laluzulu) [Ill persuade her. If it doesnt go well today, then she will never change her mind no matter how many times we try. Thats why we will confirm her decision today once and for all.] (Selene) Selene had made her decision as she would be leaving the city with us tomorrow. Today was her last chance to persuade Aure. [I understand. Ive been holding off on any decisions regarding her situation but I cant keep it that way forever. If she doesnt relent in a week then I have no choice but to proceed with her execution. Please let her know that.] (King Laluzulu.) [I see] (Selene) Although it sounded cold, I believed that his judgement was correct. Afterwards, the conversation proceed as normal aside from King Laluzulus declaration towards me that he would go so far as to utilize the entire kingdom to hunt me down if I attempted anything with Lutra with half-baked feelings. He even elaborated on it even though he mentioned something similar in his letter. I tried to reassure him that Phil was my lover and that I didnt intend on having multiple partners but his expression seemed convinced on something. . He didnt seem like it but he was really a full-fledged siscon. It feels like Ill have to be sincere when it came to Selene just so that I wouldnt be killed. [Yuuya-dono, I leave my younger sister to you.] (King Laluzulu) [Leave her to me. I made an oath earlier, that I am Lutras knight and I will protect her even at the cost of my life.] (Yuuya) [Thank you.] (King Laluzulu) King Laluzulu bowed his head towards me. My words were from the bottom of my heart. So long as I am Lutras knight, then I will be sure to fulfill my role. . . . Since we were done with our business, we proceeded to leave the castle. Weve been through a lot in the capital city of Laluzulu as it has been an intense experience the past few days. After purchasing the necessities and finishing our packing, we proceeded to board the raptor carriage. [Everyone, did you forget anything?] (Yuuya) [Nope, Luna is ready!] (Luna) [If there was something, then it would be Selene. Shes late.] (Til) [Itll take some time for her to talk to her sister If it doesnt go well.. Then it would be the last time they will end up speaking.. Lets just wait patiently.] (Yuuya) Although we were preparing for our departure, Selene was taking a different course of action from the rest of us as Selene had finally arrived along with several bodyguards thirty minutes later. This time however, she was dressed in her usual adventurer clothing rather than her royal clothing. Not only that, she had a shabby backpack as well as black hair. Above all, her facial expression looked relaxed. [How did your talk go?.] (Yuuya) [It went well. Its been decided that my elder sister will be helping my elder brother in managing the kingdom.] (Selene) [Just how did you do it? Im sure that having to work for King Laluzulu would be enough for her to be dissuaded.] (Yuuya) [Its a secret. Im glad though. Speaking of my sister, she was afraid that she would had been abandoned by me and was anxiously waiting.] (Lutra) Selene has really grown as she was now the one leading Princess Aure by the nose. With this, there truly isnt anything left for us here as we can leave with a clear mind. [Now then, lets depart. Well be heading towards Grannel first. Once we arrive there, well decide on our next course of action. Since there are multiple options for our next destination, Ill list out the possible destinations and everyone will get to vote for their favourite destination.] (Yuuya) At minimum, every single option would at least have a level 40 dungeon. There were several towns each with their own benefits and disadvantages. [Uhn. Luna wants somewhere with delicious meat! Luna wants to eat something like the Paradise Meat!] (Luna) [For me I want somewhere with delicious fruits and vegetables! Didnt you mention earlier that there was a special fruit somewhere!] (Til) [Lets go somewhere efficient for our level. As expected, the best thing would be to raise our level quickly.] (Selene) [I wish to defeat the three dragons to get the title! Its about time for us to challenge the next dragon in my opinion.] (Phil) Everyone listed their own opinions and there were several candidates that fulfilled several of their needs. However it was impossible to satisfy all of them, making it difficult for me to decide our next location. However, our party was amazing. I let out a laugh while signalling to raptor to leave. Im worried about Firoria Cartel however it was much more important for us to become stronger rather than researching and preparing ourselves for a preemptive attack. Furthermore, in order to do that we would have to do several preparations. Its still a long way, but our adventure continues. Well continue to journey into the unknown, and enjoy ourselves doing it. Volume 5 Chapter 2 - the old man finally decides on his destination. Once we arrived at Grannel, we headed over to the inn we stayed at previously and decided to have a meeting to decide our next destination. Although I asked everyone for their preferences earlier, there wasnt an option to satisfy everyone. There wasnt a clear cut correct option as every destination had their own pros and cons. After a long wait, our drinks and dishes had arrived. Especially our main dish, a whole roasted chicken. The Paradise Bird was one of Grannels specialties however there were many other monsters that dropped delicious chicken meat in the city. [Uwaa, it has so much volume to it.] (Til) [Yuuya, it looks delicious, its juice is sparkly!] (Luna) [Its another delicious chicken found in Grannel. Its a whole roasted Surprise Chicken. If you cut open its belly like this. Bingo. The delicious umami of the chicken will spread throughout its entire body.] (Yuuya) For Beef (Average) and Pork (Average), they typically dropped in chunks of meat wrapped in tree bark and weighed about 2 kilograms. However, for birds they typically dropped chicken meat. Their necks were cleanly cut off and their skin and feathers were plucked off. Even its internal organs were cleanly removed. This meant that you would be presented with a clean whole chicken making specific dishes possible. For this dish, the chicken was stuffed with various ingredients, rice, spices, and seasonings instead of its internal organs. [Now then, Ill begin cutting up its meat.] (Phil) I could feel my expectations rise as the gravy within the chicken began to flow each time Phil cut through its flesh. Phil proceeded to portion out the meat and handed out equal portions to everyone. [Is it time to eat? Luna wants to eat it quickly!] (Luna) [Uhn uhn, Im gonna start drooling if I dont.] (Til) [Youre right. Lets start eating then.] (Yuuya) Just as I said that, the duo began stuffing their cheeks full of meat and rice with satisfied expressions. It looks delicious so I should start eating as well. This is good. Its crispy skin was coated in a delicious sweet sauce. It was truly the ideal way to enjoy a whole roasted chicken as even the rice stuffing was appetizing. Not only was the rice piquant, it was mixed with sliced pickles making its taste not as heavy and easier to eat. [Looks like this dish is a huge success. It both looks great and tastes great. I have to try to replicate this dish.] (Phil) [I agree, it feels like a truly wild and interesting dish. It might even taste better in the middle of the dungeon when were surrounded by nature.] (Selene) Even Phil and Selene liked the dish. I could agree with their opinions as this definitely felt like a dish that you would enjoy more around a bonfire in a camp. If this tasted this delicious despite being Chicken (Average), I wonder how good it would be using Chicken (Excellent)? Its a shame that we couldnt replicate it with the Paradise meat as the Paradise meat only dropped a cut of thigh meat and breast meat. [Ah Luna. Its unfair of you to get seconds for yourself!] (Til) [It is fair. The first to get seconds is the winner.] (Luna) After emptying her plate, Luna immediately reached out to grab the leftovers from the main dish. Watching this, Til tried to stuff down the food remaining on her plate to grab a portion of the leftovers. She looked extremely creepy but at the same time it was a cute sight. It felt like I was being rejuvenated watching them. . . . Aside from the roasted chicken, we enjoyed several other dishes until our dinner ended. Now, it was about time to bring up the main topic. [Everyone, its time for us to decide on our next destination. Unlike our past few destinations, there arent any urgent circumstances for us so we have the freedom to head to any town we like. Lets try to choose our next location with an appropriate reason.] (Yuuya) [Uhn. Understood.] (Luna) [I can feel the tension rising right now.] (Til) The duo began to lean onto the table. [The first option is the village of snow and ice, Kritarus. Its one of the villages on the northern mountains. Both its city and dungeons are covered in snow It is also one of the locations where we can learn the art of blacksmithing as well as the place where we can obtain the materials required for blacksmithing. Well also be able to make one of the strongest weapons possible using the materials from the Temple of the Primal Flame. There are also unique foods such as the Silver Rabbit Meat. Although trying to hunt down a Silver Rabbit in itself is a difficult feat.] (Yuuya) [Hurray! Its Lunas new dagger! And delicious meat!] (Luna) As expected, Luna was the first person to respond as it was a highly favoured destination for her. Furthermore I wanted to obtain the blacksmithing skills and items present there. With the ability to blacksmith, I would be able to synthesize equipment and items using special materials. However, since it was only to the extent of synthesizing equipment, it had limits when compared to an actual blacksmith. It would be impossible to perform finer adjustments and affecting the equipments center of gravity. However, there was a bug present in the game that made it possible to strengthen weapons using specific materials. In fact, Lunas new weapon would be made abusing that bug. I hoped to create the weapon as soon as I got my hands on the materials but that dungeon had a recommended level of 41 making it an impossible task to challenge early. [Are you saying that rabbits are edible?] (Selene) [Eeeh, Selene are you saying that you have never eaten rabbit meat? Its extremely delicious! Its one of my favourite foods!] (Til) [It is one of the elves most hunted prey since it was similar to chicken meat, but less pungent and more tender. It is also a better source of protein and much more interesting to cook with although it is much more difficult to obtain.] Phil) [That sounds interesting, I cant wait to try it.] (Selene) Ive eaten it several times myself and it was delicious. It was even considered a luxurious dish in several towns plus I wanted to find out how delicious its unique drop would be. However the only problem was, the Silver Rabbit had one of the fastest speed among all the monsters that existed in exchange for giving a large amount of experience. Even adventurers who possessed Presence Detection wouldnt be able to capture it as it would escape the moment you entered a two-hundred radius around it. Its fur had a unique characteristic that made it resilient against physical damage, reducing any physical damage by 70% as well as a Super Reaction which allows it to sense and react to any long distance attacks. This caused the monster to be considered a Phantom Monster as it was impossible to come across one, much less defeat it. In the game, it was highly likely that not a single person managed to obtain the monsters meat drop. On the other hand, this meant that even after the respawn period, there were probably a large number of them running around the dungeon. If we managed to find a way to defeat them, then we would be able to level at a speed far beyond common sense. [Speaking of which, in Kritarus, it is likely that one of the three elemental dragons, the Ice dragon lurks in one of its dungeons.] (Yuuya) [Yuuya-ojisama, youre making it sound like we will not be attempting the dragon in the town.] (Selene) [Even if we head to Kritarus, we cant challenge it. If we tried to, then we would die a hundred percent. Thats why, well move on to the next option.] (Yuuya) The Corona Dragon was strong, however the Iceshell Dragon, Aldovaris was much stronger. The difficulty rating of the battle was four point five out of five with ice-resistant equipment and five out of five without it. The highest rating a boss battle could get was five, however even among those bosses Aldovaris was one of the more difficult battles. It was said that the battle required a minimum of two resetted characters. [Uhn. In that case, well raise our levels a bunch and challenge afterwards!] (Luna) [Well be staying in Kritarus for quite awhile, most likely two or three months. If we become strong enough within that period, then Ill consider it.] (Yuuya) Truth is, if we were to defeat enough of the Silver rabbits, we could shorten our stay there by a large margin. As difficult as it was to defeat it, the monster provided ridiculously high amounts of experience, a unique meat drop as well as a unique material used for fur coats which provided one of the highest resistances against Water (Ice). If we were to challenge Aldovaris in our visit there, then the Silver Rabbit is a monster we must defeat to have a chance to survive. But Ill be keeping that information to myself as I myself wasnt sure if the strategy I had would be successful in hunting the monster. [The next option, is Phil and TIls hometown, the elven village. There is actually a hidden dungeon present there.] (Yuuya) [Eeehh? Lies. Ive never heard about that before.] (Til) [Which is why its a hidden dungeon. There is your long awaited unique fruit present in that dungeon and its recommended level is 42. Since its a hidden dungeon, the monsters are there for us to hunt and it is also the lair of the final elemental dragon, the Roaring Thunder Dragon, Tempest. The merit of this destination is, both you and Phil will get to visit your hometown.] (Yuuya) This is the second location, the elven village. In the past when I accepted the request to protect it from Filoria Cartel, I didnt have my memories nor did I perform any investigation but it was an important location where many events were held. The hidden dungeon was one of the special events and was a dungeon where you could get special benefits by clearing it. [Uh.. Ill have to refrain from that.] (Til) Til who ran away from her village had a difficult face as aside from Phils regular letters, their families would most likely be upset once she returns. [Til, dont affect the decision due to your own personal reasons.] (Phil) [But okaasan will definitely be furious! But on the other hand, there are fruits Fruits.] (Til) Til was conflicted however I still had a suggestion. The benefits from clearing the dungeon wasnt small, plus comparing Tempest and Aldovaris, Tempest was the better option. [The last option was the underwater city of Lunaria which was filled with advanced dungeons. The monsters that appeared there generally provided large amounts of experience as well as a variety of item drops. Thanks to this, the adventurers there are dispersed across the different dungeons making it always possible for us to hunt monsters. It is a stable location for level fourty adventurers to raise their level. Since its an underwater city, whether its in the dungeon or outside the dungeon, it is filled with seafood. The shellfish that you could harvest their leaves a large impression.] (Yuuya) There arent that many adventurers who managed to reach the level forty range. Thus with the large number of dungeons and scarce number of adventurers spread throughout the dungeons, the monsters in each dungeon were less likely to be hunted. Normally, the respawn period for the dungeons in a city were synchronized, however this town was different. Each dungeon had their own respawn period making it the perfect hunting ground to raise your level. In addition the equipment stores there sold equipment especially suited for high levelled adventurers befitting of their wealth. The entertainment industry in that town was also flourishing. [There are several other options but these were the best options.] (Yuuya) The village of Snow and Ice, Kritarus, the Elven village and the underwater city Lunaria. These were the three locations that we could head to. [I think that the elven village would be better. Although Kritarus seems to be the most attractive option, if Aldovaris is too difficult for us to fight then it would be better for us to become stronger at the elven village then head to Kritarus.] (Selene) [Luna chooses Kritarus! It has delicious meat and strong weapons! Plus with blacksmithing not just Luna but everyone will become stronger too!] (Luna) [I choose Kritarus too! Its not because Im afraid of okaasan at all!] (Til) [I choose the elven village as well. The reason is the same as Selenes. Plus it would be nice to show everyone in the village that Til is lively and doing well. My bad, Im getting my personal feelings involved as well.] (Phil) Til made an extremely reluctant face towards Phil as everyones opinions was divided into two. [In that case, lets head to the Elven village first since someones vote was nulled due to personal reasons.] (Yuuya) [Aahhhhhh, Yuuya-niisan is a devil!] (Til) Til began to pout as she stared at me. Meanwhile, Luna tapped Tils shoulders. [Calm down and eat this.] (Luna) Luna placed the strawberry from the dessert into Tils mouth as Til reluctantly chewed on it. However she still continued to stare at me with a hateful look. I wasnt doing this just to bully her but it looks like I cant help it. Ill get her a dessert before we depart tomorrow. Til was a simple person who could be appeased with her favourite sweets. . . . The next day, we entered the guild building in Grannel to check for any exclusive requests or letters sent to us. This was one of the services provided by the guild for adventurers. Apparently, a letter was sent to Phil from her village as she had informed her family about her new guild card number due to her level reset. It looks like I should inform my acquaintances about my new guild number as well as they could be sending letters and the like to my old number. After looking at the letter, Phil folded it neatly and placed it in her pocket. [Now then, Yuuya. Lets head to Kritarus instead. If you think about it, it would actually be the better option. Now the votes are reversed. Lets send our information and achievements towards Kritarus and make that our next base of operations.] (Phil) [Just what was written inside that letter?] (Yuuya) She had blatantly changed her opinion from yesterday as if she did not want to return to the village. Til sneaked behind Phil and pulled out the letter from her pocket as her eyes widened. [Yuuya-niisan. As expected Kritarus is the best! It has snow everywhere after all!] (Til) [Wait, what does snow have to do with anything?] (Yuuya) TIl clearly went crazy. [Yuuya-ojisama, i think itll be the best for us to follow their instructions.] (Selene) [Well, Im fine either way.] (Yuuya) [Hurray! Meat! Looking forward to it!] (Luna) In the first place, I brought this up since I was fine with all three locations. [Now then, its decided. Ill head over there and apply for the Kritarus guild to take note of our arrival.] (Phil) Phil immediately left for the counter. This is suspicious.. Ill have to ask her for the reason afterwards. Regardless, the next destination was Kritarus. Since it was my first time heading there in the flesh, Im looking forward to seeing what kind of town it actually is. Volume 5 Chapter 3 - The old man wields the divine sword. We began our journey on our dependable Raptor carriage to the village of snow and ice, Kritarus. After passing through the road east of Grannel, we began heading towards the northern mountains. At our current pace, we would most likely arrive within five days, which was half the time a normal horse carriage would take. As usual, I was on the horseman seat while Luna was sitting on my lap leaning her back onto my body. [Yuuya, its starting to feel cold.] (Luna) [Youre right. Itll only get colder from here. Lets stop by a store to get some winter clothing later.] (Yuuya) Luna was much more forceful than usual in leaning her body onto mine. It was already the second day since we left Grannel but the chilly northern winds have already started to blow as she swiftly moved her tail up from under her crotch and hugged it. [Its so fluffy and warm~.] (Luna) That was extremely cute. [That looks nice and warm.] (Yuuya) [Uhn. In that case, Luna will share the warmth with Yuuya.] (Luna) Just as she said that, she turned around with her tail in front of her and kept it between my stomach and her body before hugging me like a koala. While pressing her tail onto my body, her face was resting onto my shoulder. [Its warmer than I thought. Plus its really fluffy.] (Yuuya) [Foxes are awesome. Because its Yuuya, Luna will share the fluffiness and warmth.] (Luna) [Thank you for that. By the way, remember to put on your hoodie. Itll keep your ears warm.] (Yuuya) [Okay.] (Luna) Luna was currently wearing Phils hand-tailored fox-hoodie. Since Lunas ears were extremely sensitive, she prepared the hoodie for Luna to prevent sand and dust from affecting her ears. It also served well as a winter clothing. [Now Luna is perfect.] (Luna) She looked so strange that I smiled unintentionally. [Now then, its time to pick up the pace otherwise we wont make it by tomorrow.] (Yuuya) In response to my thoughts, Raptor began to accelerate while letting out a loud cry. Eventually, we began to overtake one carriage after another. As expected, our Raptor carriage was just great. . . . We arrived in an open field on one of the mountains and prepared to set up camp. As I was taking out the tent from my bag, Phil began to prepare dinner by taking out her mobile cooking kit as usual. [Oneechan, what are we having today?] (Til) [Since weve been having nothing but meat recently, Im thinking of preparing some seafood instead. Since we still have plenty of shrimp (Average), Im going to be making shrimp pilaf for dinner.] (Phil) Shrimp meat dropped in large chunks of meat that was clearly not from a shrimp however its taste was equally thick and rich. Just listening to Phil mention shrimp pilaf is making me hungry. [Luna loves meat but shrimp is great too!] (Luna) [Me too!] (Til) [Truthfully, I have never tried eating shrimp meat. This will be my first time.] (Selene) [Well it is quite unhealthy compared to standard dishes.] (Yuuya) [That isnt the case. The main reason is the geography of the land. Shrimp can only be obtained from the sea and because it is an ingredient that spoils quickly, its difficult to transport it all the way to the Laluzulu Kingdom. There werent any merchants who have a Magic Bag that were doing this either.] (Selene) [Speaking of which, Ive never eaten it either until I met Yuuya-niisan. My village was located in the middle of the mountains too.] (Selene) This was the reason for the spike in the Magic Bags price. With the ability to transport fresh seafood deeper inland while retaining its quality, this would allow them to monopolise the distribution of seafood inland. The main problem wasnt the lack of willing merchants, but the lack of ability to distribute. [Now then, I cant let everyone down tonight since its Selenes first time after all.] (Phil) [Thank you for your consideration. I look forward to it.] (Selene) Itll surely be an amazing dish since its Phil afterall. Suddenly, Lunas fox ears began to twitch. [Uhn. Luna found something. Two hundred metres ahead, one monster. Feels like a deer. Its walking slowly without making a sound.] (Luna) Most monsters detection abilities ranged were about fifty metres with some exceptions. In the case for Presence Detection, it will start moving once you enter its range. One characteristic that every monster with Presence Detection had, was their high level. This deer monster was likely one of them and a strong monster at that. [It might be a natural monster, or a dungeon monster that strayed from its dungeon. Does anyone want to do a light exercise before dinner?] (Selene) [Luna wants to go too!] (Luna) [Of course, I will go too!] (Til) I shook my head despite the duos enthusiasm. [No, let me go alone this time.] (Yuuya) [Yuuya-niisan, why would you be going alone.] (TIl) [This blade is as sacred as it is cursed. Theres a rumor saying that once this blade is drawn, if it is returned to its scabbard without bathing in the blood of its enemies then the blade will bring about its owners downfall. Selene, how was this blade treated by the royal family?] (Yuuya) [It was an ancient heros precious blade. A story was passed down about how the hero drew Dainsleif and defeated thousands of monsters in order to protect the Laluzulu Kingdom. However, nobody knows about its true ability. Its been passed down to the best knights of the kingdom and returned once they retired or slain in combat. At the very least, none of the knights has been able to draw the blade in the past few hundred years. This was why the blade is just a testament to being the best knight of the kingdom. However, I believe that Yuuya-ojisama will be the one to draw the blade. If it is truly a blade capable of defeating over a thousand monsters, then it is a tremendous power boost if you could draw it.] (Selene) The sacred blade Dainsleif was only a sword in name in the game. It was just displayed in the royal castle as an antique and cannot be obtained. However there were several rumors floating around it. In the library for the game, there were several written scriptures about the blade. By sacrificing your life, you will obtain an undefeatable power. Never draw the blade, lest you turn into a beast. A blade that shines in blood, is nothing but a curse blade. The blade was never available to the players, however several players managed to datamine the game files and discovered hidden data about the blade. Due to this, the player base was convinced that the blade would one day be available in a future event. .The reason this sword was being treated as a divine sword was likely due to the flow of time. With the heros feat of destroying a horde of monsters, the details were forgotten over time and all that was left was the amazing feat of destroying a horde of monsters as well as the myth that no one would be capable of pulling the sword out of the sheath. [In any case, It is entirely possible that I will lose my sanity drawing the blade and end up cutting everyone unintentionally. If my abilities were multiplied several-fold and I attacked any of you without hesitation, then are any of you confident of surviving that? Youre free to tag along if you are confident of doing so.] (Yuuya) [Impossible. Luna will die if Yuuya seriously attacked.] (Luna) [Its even more impossible for me you know!] (Til) [Then both of you will stay here.] (Yuuya) [But Luan doesnt want you to try something so scary in the first place.] (Luna) Luna pulled onto my sleeves with a worrisome look as I looked at her while stroking her head. [Dont worry about that. According to the legends, Ill be able to sheathe the blade once it is soaked in blood. Ill only draw the blade if I find the prey. Even though its dangerous, I cant overlook the possibility that I might become stronger with this blade. Luna, Im sure you understand what Im trying to say.] (Yuuya) [Luna understands but dont overdo it.] (Luna) [Of course I wont.] (Yuuya) This blade might end up being extremely valuable as insurance once I test it out since it could be our saving grace in a worst case scenario. I was confident that the blade would have been implemented in the game, so I am sure that there would be some way of using the blade effectively. . . . After inquiring Luna about the monsters location, I hung my black magic sword and Dainsleif on the sides of my waist and ran in its direction. Even if I appraised the item, in its sealed condition, only its name as well as its sealed state would be revealed. I immediately sharpened my senses as I felt a wave of bloodlust crawl around my body. Looking at the direction of the bloodthirst, I saw it. There was a monster hiding behind a gigantic tree. Judging from its black mottle fur and level, this was a monster I was familiar with. [Its a Darkhorn Deer. A huge one.] (Yuuya) It was level forty two and among the deer-type monsters, Darkhorn Deers was the strongest although its size wasnt the largest. It mainly went after prey which stumbled into its range of Presence Detection and erasing its presence. The moment its prey shows an opening, it would rush forward with its horn while using Horn Crush, gouging its prey and finishing its prey in a single hit. It also possessed exception attack power and agility making it an extremely dangerous monster. Parties that lacked a Thief capable of using Presence Detection often have accidental deaths due to this as it would be easy for a common person to walk past it unknowingly. I expected the Darkhorn Deer to approach me as I proceeded into its range alone. Utilising its overwhelming leg strength, it jumped from left to right so as to avoid being detected while closing the distance. Three jumps until it was within my attack range. Its time to see if I possessed the qualification to pull the sword. With my hand on the handle, I began to wiggle my finger as the blade slid out of the sheath smoothly without any sound. It was a beautiful but ominous blade. Just like the black magic sword, it was a curved sword that specialises in cutting. However, its special feature was its red pattern engraved into its silver blade as if the blade possessed its own blood vessels. Suddenly, its red pattern began to shine. [GAHHHHHHHHHHHHHH!] (Yuuya) Its bloodthirst overwhelmed me as I screamed in pain. I hate it I wan blood I want to kill.. The red vessels in the blade began to extend to the handle and to my arms as negative emotions began to fill up my mind. Even though it felt like my mind was overtaken, I felt strangely conscious. It was as if the fiery passion in my mind and my rational will was in perfect harmony. My enemy suddenly approached me as it used its Horn Crush one step away from my range and approached me without any preliminary movement. With my current status, I couldnt dodge it at this distance as I adjusted my stance to deflect the attack. However, rather than following my battle pattern, my body jumped to the side as it followed my natural instincts. As a result, I dodged an attack that shouldnt be possible. The Darkhorn Deer was a cowardly monster as it began to run the moment it realised it couldnt win the battle. After its Horn Crush missed, it continued to run at full speed without losing any time. The Darkhorn Deers specialty was its agility and attack power, with both values being drastically higher than mine making it impossible to run after it. However, my body didnt listen to my voice of reason as I ran after the monster, quickly catching up to it. Then, a thrust utilising the full momentum of the rush sunk into the neck of the beast. The beasts shriek echoed throughout the area as my wrists continued to turn rapidly, widening its wound. [GAAAAAAAAAAAAAAAAH] (Yuuya) I let out a war cry as I felt my primal urges become stronger and stronger. Even though the enemy was killed and the blade was soaked in blood, the bloodthirst wasnt dissipating at all. As I let out the war cry, I saw small bird perched onto the tree branch as I kicked up the trunk of the tree and began running vertically towards the bird and swung my blade, slicing it into two. Immediately afterwards, I scanned my surroundings to look for the next life as I found a small mouse, jumping off the tree and thrusting my blade forward. My body wasnt listening to me at all. I could reason and think as much as I wanted, but my body was dominated by my instincts, following the urge to take every single life around me. This cant go on, at this rate.. If the girls came to find me because I was late, theyll all get killed. No matter how hard I tried, all my willpower amounted to, was just grinding my back teeth But that alone was a matter of life or death. Behind my molars was a special item that could recover any abnormal status effect, an Elixir. As a solo adventurer, the moment you are inflicted with any status abnormality in a dungeon, whether it be paralysis, a curse, petrification etcetera, you will die without a doubt. In the event that occured, I prepared the Elixir behind my teeth and made its container easily chewable so that they could be ingested without any effort. Just as that happened, the fiery heat in my body began to dissipate as the red vessels eroding my arms began to disappear and I began to regain control of my body. Thankfully, my condition was considered an abnormality as I stabbed Dainsleif into the ground with all my strength. [Just, what in the world is this.] (Yuuya) I sat away from the blade which lost its ominous red glow standing in the ground. [Sigh.] (Yuuya) Suddenly, I heard a dull sound as my bones began to break and I began vomiting blood. A sharp pain began to run through my body from my knees as I began to scramble around, quickly chugging down a recovery potion. Afterwards, I quickly took out the appraisal item from my magic bag and looked towards Dainsleif. Previously I couldnt read any information besides the fact that it was sealed, but what about now? [I see, so thats what it was.] (Yuuya) I finally understood the mystery that was Dainsleif. Firstly, the reason why none of the knights before me from the Laluzulu Kingdom could unsheath it was because you required both high physical and magical stats in order to pull it out of its scabbard. Putting aside the physical requirement, for knights whose profession resulted in a decrease in magic power, it was a value that they would never be able to reach unless they cleared the Tower of Trials and reached the upper level limit. Secondly, Dainself itself had such a high performance that even god-tier equipment wouldnt have the same raw stats that it had. Lastly, it provided a special effect. Status Infliction:Berserker. All stats are tripled until every living thing in the area is destroyed. Condition will be removed once everything is killed. Once the effect ends, damage proportional to the duration of Berserker will be inflicted. [It is practically useless No one would use it even if it was implemented into the game..] (Yuuya) Until all life in the vicinity is snuffed out, the user would continue to attempt to kill it with all of its strength regardless of its will. Just like before, I killed not only the monster, but even the birds and mice in the area. Im glad that Luna or Til didnt tag along as Im sure that even your own allies would be designated as a target. If that was the only downside, then solo players would use it but the backlash from the Berserker state wasnt something to laugh at. Based on the damage I took earlier, it seems that I would take about one percent of my health in three seconds, which meant that it would be an instant death if it didnt end within three hundred seconds. Furthermore, there was no way of surviving this damage by using a recovery item Although, tripling all stats was extremely attractive. Even magic enhancements couldnt perform any buffs to this extent. [ It may be a good thing if I never have to pull out Dainsleif. Its far too unfriendly to use.] (Yuuya) In exchange for a tremendous power boost, the blade cant be put into its scabbard until it has shed sufficient blood. More specifically, in exchange for tripling your stats, the abnormal status will continue until all surrounding life is killed and the amount of backlash received is proportional to the duration of the condition. As for its usage, the blade can only be used in a situation where everyone but me is annihilated. Or when everyone has escaped the vicinity with a Return Stone. Both are equally difficult to think about. [Looks like this will be the absolute last trump card. Until then, itll stay in my magic bag.] (Yuuya) After making my decision, I put Dainsleif back into the bag and replaced it with my treasured longsword that I kept in my bag the entire time. Looking towards where the Darkhorn used to be, I saw its item drop, the Darkhorn. It was a popular ingredient for conducting medicine. Its about time for me to head back. Im hungry and Im sure everyone is worried about me. After returning to camp, I told everyone that I couldnt pull Dainsleif out of its scabbard. Even though she didnt know anything, Im sure that Selene would deeply regret gifting me such a dangerous item. Volume 5 Chapter 4 - The old man visits the town of ice and snow After returning to camp safely, I thoroughly enjoyed the dinner made by Phil. Selene who got to try the taste of shrimp meat for the very first time was satisfied as well. Afterwards, we continued with our usual routine as I started the evening training session with Luna and Selene. Currently, I was having my sparring session with Luna which took place at the end of our training as our surroundings was illuminated by several magic torches. Recently, although Ive been forced to draw out about 60% of my strength however Luna would still be bitter everytime she lost. I dodged Lunas all-out thrust with her wooden sword and struck her shoulder while walking past her, causing her to lose her balance and fall onto the floor. The time for the match was over. [Time is up.] (Yuuya) Just as I said that, Luna who was trying to get back up forcefully, fell back down to the ground and sat up with rugged breaths. [Muu, ever since Yuuya started attacking, not a single attack has landed.] (Luna) There were actually several stages to this sparring battle. For the first stage, I allowed Luna to attack me as much as she wanted without retaliating for her body to memorise her attacking pattern through pure muscle memory. For the second stage, I only launched counter attacks whenever she showed any balant gaps in her defense while attacking as this would lead to unnecessarily reckless attacks and bad habits to form. For the first two stages, Luna had successfully landed a single attack onto me and now we were in the third stage. In a sense, this was the real battle training stage as I had finally begun to move freely in our battles. Although it might seem similar to the second stage, in the second stage I had only seized the initiative in specific situations based on Lunas breathing however in the third stage I began to take the initiative to create favourable situations for myself instead. [Yuuya-ojisama, Luna, that was a good battle. Ill begin treating your wounds. Recovery Heal.] (Selene) Selene who had been observing the mock battle rushed over as she began treating Lunas cuts and bruises with her recovery magic, Heal. Luna turned towards me with a sunken expression. [Yuuya, I remember everything from our battles and it is already the fourth match. At this rate, I wont have enough hands for everything.] (Luna) [Youre right, you did complete the first few stages perfectly. However it might still be better for you to have the initiative instead for the next battle.] (Yuuya) Since her battle style was completely reliant on her ability to land critical hits, our main goal was to polish Lunas battle style which relied on Assassinate. Her accuracy on her thrust was high but the main objective was for Luna to be able to land a critical hit in any situation with any of the nine slashes. However her usage would be half-baked at best if she was to attempt all nine slashes in one go, thus I made her increase her repertoire of slashes one at a time. Currently, she was capable of landing three slashes consistently with a critical: The thrust, the sideway slash (S) and the upward slash (Ϥ). It was about time for her to try the downward slash, either using the diagonal downward slash (Ф) from her right or straight downwards. It was arguable if she should even practice this due to her small stature but it was still necessary to increase the number of her attacking patterns. [Then can you teach me straight away.] (Luna) [Thats a no. Anymore than this will affect your performance tomorrow. Ill only start teaching you tomorrow.] (Yuuya) [Uhn. Then Luna will do her best starting tomorrow. I will definitely land one on a serious Yuuya!] (Luna) This girl was a genius. Im sure that she would master everything in less than two years. In fact, her talent was enviable as this mock battle match that we were having everyday was already starting to bear fruit. Although this match was primarily for Luna, it also served as my training. My speed and strength was currently much higher compared to my pre-reset status and it was embarrassing to admit that I had trouble adjusting to my current speed. My speed during my battles currently were in fact much slower than I was actually capable of as I wouldnt be able to utilise my techniques that required proper form. [Selene, Luna. This will be the end of our training for today. You can go ask Phil for some hot water for you to wash your body.] (Yuuya) [Understood, Yuuya-ojisama.] (Selene) [Lunas covered in sweat!] (Luna) The two girls headed towards our tent while it was time for me to spend some time practicing my slashes. [Divine blade Dainsleif.. I want to control it somehow.] (Yuuya) After some consideration, I realized that there were numerous disadvantages for me to use the sword, but it was also possible to make use of it effectively. Once I draw the blade, itll never return to its sheath until all life around me is snuffed out. However, reflecting on my state after drawing the blade, I was completely focused on the nearest lifeform to my body and that focus hadnt changed until the target I was focusing on, was killed. This meant that if I drew the blade when I was extremely close to the enemy, I would be able to focus on killing my enemy without worrying about attacking my own allies. I would be able to use the blade and defeat my target then immediately ingest the Elixir I kept at the back of my molars. However, it was still dangerous to follow my assumptions just from one experiment. Ill have to have several more tests. The next side effect was the damage incurred when I recovered from the Berserk state. It wasnt a steady flow but a large chunk of damage released proportional to the duration of the Berserker status. This meant that it would be an undeniable immediate death if I failed to defeat the opponent within three hundred seconds. In other words, based on the condition of my body and health, I would be able to calculate how long I could maintain the Berserker state in any given time. Plus I would be able to remove it by ingesting the Elixir behind my molars if the situation was unfavourable. [In any case, Ill have to try it out a few times. That is how I can become stronger.] (Yuuya) The corners of my mouth began to raise as I swung my sword. This was a great discovery, aside from discovering Dainsleifs performance. Just by entering the Berserker state, I would be able to triple my status but I wouldnt be able to utilise the techniques I learnt from experience. Afterall, I cant even utilise my techniques properly without reducing my speed with my current status. Despite this, the sensation on my body when I moved three times my maximum speed still remains as I continued to swing my blade. If I am able to acclimate myself to the Berserker state and be accustomed to swinging my blade with my full power at triple the speed, it might become easier for me to utilise my current speed. Above all, I want to relive that sensation once more. . . . After performing my exercises, I wiped my body and changed my clothes before returning to the tent. Since the magic tent wasnt large enough for five people, we prepared two tents, one for me and Phil and one for Luna, Til and Selene. [Youre finally back.] (Yuuya) [Yeah. Keep this a secret from Selene but, I managed to pull Dainsleif out of its sheath. However] (Yuuya) I told Phil everything about Dainsleif as well as my thoughts about how I could utilise it to fight at three times my usual speed. [So you had such an experience, it makes sense why you ended up practicing this late into the night.] (Phil) Phil definitely knew me well after being together for a long time. [However, its a shame. I thought it was finally time but if youre tired for tonight..] (Phil) [Dont worry, I have plenty of energy left.] (Yuuya) I pulled Phil into my embrace as we didnt have any time alone at the inn despite being in a relationship. Luna was satisfied with the two-three split we did with the magic tent however if we were to get a seperate room at an inn, she would remind us that we could rent a large room and begin to call Phil out for being careless. She doesnt seem to read the atmosphere well as we couldnt just say out loud that we wanted a separate room together. [Im glad. Lets do some extra tonight.] (Phil) [I intend to.] (Yuuya) I intend to savour tonight as I leaned in to kiss Phil . . . The next morning, we left early in the morning after having breakfast. Looking into the carriage from the coachman seat, I could see Phil half-asleep as she started to yawn. Erik who was sitting on Tils head was also adorable as it yawned right after Phil. [Oneechan, you enjoyed last night a wholeee lot right.] (Til) Til began her usual old-man jokes as she made a joke that would have sent a fist to her face if she was a male. [Til, I hope you enjoy your porridge boiled thoroughly with plenty of moss since you love vegetables.] (Phil) [Oneechan, Im sorry I understand my mistakes now.] (Phil) And she was shut down as usual. Luna was tilting her head as she doesnt seem to understand the conversation and entered the coachman seat. She didnt intend to do anything as she immediately headed towards my lap and began to take a nap while leaning onto my body. Since the weather has been becoming colder as we continued north, it was nice to have Luna this close as her body temperature was naturally high. I took out an Elixir from my magic bag as I crushed it, turning it from a small tablet into powder as I pulled out one of my back molars. This was a special molar that could be placed behind my molars created by a dwarven blacksmith which allows me to store the powder into it and chewing onto the molar would cause its contents to pour out. I returned the molar back into its original position. The number of elixirs I had left was three and it was difficult to replenish. Since it was capable of curing all kinds of status ailments, it was extremely valuable and wasnt obtainable from the market. This means that I can only draw Dainsleif if I could instantly kill all the creatures in my vicinity as it would be a waste to use my Elixir everytime I wanted to test it out. [Yuuya, how much longer until we arrive?] (Luna) [Lets see.. Well be arriving much earlier than expected, around tomorrow evening since our carriage is much stronger and faster than a regular raptor carriage. Plus our raptors are trying their best.] (Yuuya) This was the same for the Raptor which has been with me for god knows how long. Our new addition was much faster than a usual Raptor as well. Since I was feeling bored, I reached out and held onto Lunas tail. At this moment, something cracked as Lunas doll which was kept in my magic bag was spat out of the bag completely split into two. I immediately stopped the carriage as I scanned the surroundings for any hostile presence. I couldnt detect anything in the area at all, much less anything hostile. The nature of the magic bag made sure that whatever that was stored within would never age or change. However there were exceptions to this. .The dolls made from Grannel could break after nullifying a curse. Looks like the dolls do indeed have the same effect in reality as they did in the game. [Yuuya, Lunas doll is..] (Luna) [Its completely broken now. Im sorry.] (Yuuya) [Yuuya doesnt need to apologise. Actually, Luna is glad. Yuuya said that if Luna and Yuuya loved each other then it would work. If it broke means Luna protected Yuuya.] (Luna) [Thats right, thank you Luna.] (Yuuya) I stroked her head. In any case, I never expected to be protected by her doll rather than Selenes doll instead. In the game, the dolls would only break if any bad flags were to occur. Does that mean that someone just tried to curse me. [Yuuya, if we ever get close to Grannel, then we can get another doll. Luna wants you to have a Luna doll.] (Luna) [I want to do that too. I plan to ask if it could be repaired too.] (Yuuya) I signalled Raptor to continue our journey. If the doll did break due to a curse, then someone might be targeting me at this moment. The most likely candidate right now would be Filoria Cartel. If it was indeed a curse then the caster would most likely be dead. Curses were extremely powerful spells that posed a risk towards the caster if the spell failed. Especially since there were very few items that could inflict curses, it is highly unlikely that I would be cursed again. Although lets be safe and look out for anything in our vicinity. . . . Afterwords, I revealed the situation during dinner. As planned, I taught Luna her fourth slash while Phil tried to repair the broken Luna doll. The night continued as usual until [Uggg, its so cold. Yuuya-niisan. Its freezing. Only for now, Til-chan will give you permission to hug her.] (Til) Til hugged my body while being wrapped in a blanket. Our destination was on the mountain, causing our surrounding temperature to decrease drastically as snow began to fall. [If you feel cold then you could just return back to the carriage.] (Yuuya) [Im tired of the carriage! In the first place why is Erik and Luna so comfortable! Even though their clothes are much thinner than mine!] (Til) [Kyu!] [Foxes are fluffy~.] (Luna) Erik was a faerie dragon with feathers while Luna had her fluffy fox tail to keep her warm. [Contrary to them, Elves were vulnerable to both cold and heat.] (Yuuya) [The temperature at the village is just too perfect! Its comfortable all year long!] (Til) As Til mentioned, the elven village was a warm place that stayed that way all year long, making it an extremely fertile land where you could harvest crops all year long. [Now then, we have finally arrived at the village of Snow and Ice, Kritarus. This is our destination.] (Yuuya) It was a medium sized village lined with brick houses with chimneys in the roof. There were also countless goats grazing on the fields. [Hurray! Lets hurry up and buy some warm clothing! Just like those people over there! Then some warm drinks and a delicious warm meal!] (Til) Til looked envious of the villages who were walking around in thick fur coats. [Yuuya, what delicious food are there in Kritarus?] (Luna) [According to the guild receptionist, one of the item drops in the dungeon, the Torotoro cheese was delicious. It was good enough that people would visit here just to try it. The best way to eat it was to grill meal with the cheese in a pan.] (Yuuya) [We must definitely eat it! Luna loves eating cheese!] (Luna) [Kyu!] (Erik) [That sounds great. It sounds warm. Yuuya-niisan lets hurry!] (Til) I let out a bitter smile as I signal to Raptor. When we enter the town, well immediately try out their special cheese hotpot. Now then, I wonder what kind of amazing things will we encounter in this city. Volume 5 Chapter 5 - The old man runs on the snow Sorry for the long absence, I tried to finish the chapter but I barely got through most of this chapter after posting the previous chapter and was caught up with IRL stuff and the translations had to slow down and it might be slowed down even further as I have my priorities elsewhere. I hope you guys understand and I wish everyone a merry Christmas. We finally arrived at the village of Snow and Ice, Kritarus. Although it was possible to get some form of winter clothes in Grannel, since it was a warm city all year long, it wasnt possible to get any decent winter clothing in the city. Adventurers were capable of gaining heat and cold resistances as we leveled up but the cold weather was still chilly. [Raptor, its amazing how youre always energetic even in this weather.] (Yuuya) I stroke my partners head as he was not only fast, but also resistant to the weather as well. Normally, reptiles were beings that were sensitive to temperature changes and did not appear in dungeons where the temperature was extremely low, but raptors were the exception. Even during the game, adventurers often used Raptors as mounts when travelling around the game. Thinking back, if the mounts were unusable in cold weather then it might become frustrating for the players. That might even explain why Raptors were the exceptions since they were designed that way. Its interesting that such a meta-defining concept was implemented thanks to the game. Tils teeth began to chatter as she was shivering from the cold weather until she couldnt withstand the weather and tightly hugged Luna from behind. Luna quickly lowered her fox tail due to the sudden surprise. [Luna, youre sooooo warm~~~.] (Til) [So cold, let go of me Til.] (Luna) Luna was flailing around trying to get Til to let go but Til was relentless as she stretched out her hands towards her tail trying to grab it. It felt like their friendship might be at risk at this rate. Lets be sure to get some winter clothing for Til as soon as possible. . . . After leaving Raptor at the towns stable, we went towards the shopping district where we got everyone a set of winter clothing that consisted of a thick fur jacket, boots that went halfway up our shins and a hat that covered our ears. Considering the effectiveness of our current equipment, it was too difficult for us to remove them in favour of a comfortable set of clothing so we wore the clothing over the equipment instead. Our jacket was made using the fur of a reindeer-type monster, the Snow Caribou. It was extremely soft, had an extremely high heat retention and was waterproof as well, making it extremely suitable for winter clothing. It was Kritarus special product that was often exported. Its quality was as high as its price. Even though equipment and clothes made from monster materials were often more expensive than normal materials, this time itss price was still a notch higher than that. Even if we were to compromise and got ourselves a normal fur coat, then we would realise our mistakes very quickly, especially in the dungeon. [Fuu, this coat is amazing. Its so warm.] (Til) [I agree. However, its extremely thick and heavy, making it hard to move my arms. It might affect our accuracy when using our bows. Im also worried that the hat might be dulling my sense of hearing since its covering my ears Although it might be better than completely losing any feeling of my ears to frostbite and being able to shoot the bow.] (Phil) [Uhn. Im worried about that too. I might be able to get used to it once I fire a hundred arrows though. Since Im feeling sluggish now, I might do that right after dinner.] (Til) Til loved playing pranks and tricks onto us but when it came to work, she was extremely critical and constructive, especially with regard to bows and dungeon explorations. [Us front-liners have to practice fighting the snow as well.] (Yuuya) [Uhn. Luna will do her best!] (Luna) [It certainly feels that way. Im not too sure if Ill be able to move well in this environment.] (Selene) Ill have to remember to check everyones condition before we enter the dungeon. [Now that were done with the clothes, lets start worrying about our food.] (Til) [Before that, we have to head to the guild first. We have to confirm the transferring of details for Grannel and change our base of operations to Kritarus before tomorrow otherwise our exploration tomorrow will be shortened.] (Yuuya) [Ughh, the cheese hotpot looks so far away~~] (Til) The sulky Til reluctantly threw a piece of candy into her mouth as she settled down quickly. I want to eat the cheese hot pot as soon as possible too so lets hurry up. . . . We finally completed the tedious procedures in the guild however it was a little unsettling that there were only several adventurers in the guild. After visiting our inn and leaving our luggage in our room, we entered a reputable store in the city which served a delicious mellow cheese hot pot. [Cheese, cheese!] (Til) [Sticky sticky!] (Luna) [Kyu!] The boisterous duo and Erik were restless due to hunger while chanting Cheese pot cheese pot as the waitress arrived before quickly bowing and headed back to the kitchen. [Im extremely sorry but weve run out of Torotoro cheese for tonight. We cant serve the cheese hot pot for tonight.] (Waitress) [What about tomorrow? Will it be available tomorrow?] (Yuuya) [Currently there isnt an estimated time as to when we can serve it. We wont be able to give you an exact time.] (Waitress) Luna and Til looked like the world was about to end. [Isnt it possible for you to get the item? Since the monster respawn every week, shouldn it be possible for you to get the item from any adventurer who happen to come across the item? Are there any special circumstances ?] (Yuuya) [A month ago, the Grand Ice General spawned in the dungeon and adventurers have stopped entering the dungeon. That is why we havent been able to get any monster drops for the past month.] (Waitress) I didnt expect a general-tier monster to appear in the city. Coupled with the small number of adventurers and the unusually high cost of the Snow Caribou fur jacket, I was convinced. [I understand. In that case, could you serve us your recommendations? Also, please order us an appropriate amount since these children could eat an extremely large amount. Well need about enough food for seven people.] (Yuuya) [I understand. Ill immediately prepare your order for seven portions.] (Waitress) The waitress bowed and left. [Ughh, Yuuya-niisan, my stomach is completely in the cheese pot mood you know. I wont be satisfied like this.] (Til) [..Luna is disappointed too. Even though Luna has been looking forward to it..] (Luna) [I feel the same way, but if there really was a general-class monster that spawned, then it cant be helped.] (Yuuya) [its true. If a normal adventurer tried to enter the dungeon, it would practically be suicide.] (Phil) [Yuuya-ojisama, Phil-san.The two of you seem to understand the situation. Just what is the Grand Ice General?] (Selene) [General-class monsters were in other words, considered a boss monster. Its a boss that specialises in speed and wanders the dungeon while mounted on its horse. With its ridiculously high speed while mounted, you would immediately be eliminated if you happened to encounter it. In otherwords, you would be hunting in a situation where you would never know if the monster would appear out of nowhere. Furthermore, it has a troublesome characteristic where it would never disappear even if a week has passed. In fact, it would only disappear after two months.] (Yuuya) Normal bosses would never leave its room. However, the general-class monsters were different. It was already extremely difficult to fight a boss monster without having the opportunity to recover your stamina and strength as well as making other preparations for the battle in front of the room. The fact that the generals were all level 45 made it even more difficult. In addition, dungeon bosses were a certainty in entirely from its spawn location, characteristic and behaviour. However the general-class monsters would only spawn with a small percentage chance in advanced dungeons above level 40. Which meant that for two months, the dungeon would effectively be considered a wild dungeon. In another sense, it was a natural disaster. [Uhn. In that case, we can go and defeat it! Well go into the dungeon and hunt it and we will return immediately for the cheese hot pot afterwards! Well be able to find the Torotoro cheese and eat the cheese hot pot!] (Luna) [That does sound like a good plan. Fufufu, Ill even kill a dragon for the hot pot!] (Til) Their hatred towards their obstacles was horrifying as they were full of motivation. [Thats impossible. The general-class monsters cant be defeated by a single party. Its stamina and physical strength is too much and even its natural recovery rate is too high for a single party to deal enough damage. With our current power, we wont be able to keep up with its recovery if we tried to reserve our resources. And even if we fought at full power and managed to inflict any significant damage past its recovery, that was only the first step to defeating it. We need at least two other parties.] (Yuuya) [Yuuya, is it impossible even if Luna assassinates?] (Luna) [It is impossible even if you do. It also has absolute firepower.] (Yuuya) That was another terrifying aspect of the general-class. [Were in a horrible situation. The other adventurers seem to have taken a holiday until the Grand Ice General dissappears next month, making it suicide for us to enter the dungeon until then.] (Phil) [If we head to the guild there will most likely be an Ice Grand General subjugation quest for us. This town relies on selling winter clothing using Snow Caribou fur and the Torotoro Cheese for its signature dishes. Although there were still several other specialities in Kritarus, it is highly unlikely that the town is in a good economic state after two months.] (Yuuya) Either they have already failed to subjugate the Ice Grand General, or they simply werent able to muster the forces to subjugate it. Regardless, it might be possible to defeat the monster if we participated in a subjugation quest. [In that case, our answer is simple. We eat for the day, train at night in the snow and head over to the guild tomorrow!] (Til) [We have no other choice. If we dont take that chance then we might never be able to change the situation. We wont be able to enter the dungeon for another month.] (Phil) It stings a little that I wont be able to quickly get the blacksmithing skill and the blacksmithing tools but it wouldnt be ideal for us to wait an entire month here, similarly it would be impossible for us to explore the dungeon and risk annihilation if we came across the Ice Grand General. [Looks like our food is here.] (Yuuya) [Uhn. It looks delicious. Other than cheese pot, there are many other things!] (Luna) [Ill endure with just this for now. Lets hurry up and beat the Ice Grand General and enjoy the cheese pot to celebrate!] (Til) In colder areas, sweet foods and rich dishes were the go-to dishes. The food that were being served was a prime example as we were served a large lump of reindeer meat covered in a thick sauce. It was a shame that we couldnt eat the cheese pot, but this looked good as well. . . . After a good nights rest, we began to make our way towards the guild building. The moment we entered through the buildings front door, the receptionist lady immediately dashed over to us. [Weve been waiting for your arrival! The party that managed to defeat a dragon, Twilight House! Everyone, the guild has been waiting for a strong party such as you to arrive!] (Receptionist) Without even a chance to breathe, we were immediately directed to the guilds meeting room as the staff seemed extremely desperate. SItting in the meeting room was an executive from the guild as well as the guild leader himself as he greeted us personally. [Welcome to Kritarus. After receiving notice of your arrival, weve received and reviewed your partys amazing achievements ever since your formation. And there are even two celebrities, Phil who was one of the key members of Leonards party as well as Yuuya who overwhelmed his competition in the Laluzulu Kingdom, earning himself the title of the strongest knight with ease! The fact that youve arrived in Kritarus at this timing must have been fate.] (Guild Leader) [You dont have to force yourself to raise your spirit for us Looking at your behaviour I guess you desperately want us to defeat the Ice Grand General. If there is a hefty reward for it, then I will most definitely participate. However, there must be at least two other high-level parties for us to defeat it.] (Yuuya) The guild must be hard pressed to defeat the Ice Grand General as fast as possible due to the pressure from the city. After all, it was a critical economic issue for the city if the monster continued to exist. [Yuuya-dono, your worries are not unwarranted, but they are unnecessary since we already have two veteran parties reserved for the mission.] (Guild Leader) [In that case why would you go so far just to recruit us as the third party?] (Yuuya) [That was indeed one of the reasons. However we still decided to greet you personally since we knew Yuuya-dono and Phil-sama extremely well.] Guild Leader) He knew us extremely well? What did that mean? Our conversation was interrupted as the door to the meeting room was opened abruptly. What appeared was.. [Lyle!? Its been such a long time.] (Yuuya) [Ouhh, Yuuya. You look much older than before But somehow you seem much more refreshed than you look. What did you do? Im extremely curious.] (Lyle) Lyle was a huge dragonoid who used to be the Thief that was in our party together with Leonard and Phil and as far as I know, the worlds number one adventurer in that position. He was the number one person when it came to surviving encounters, a Survival Specialist. Without him, our party would had been annihilated countless times. [Many things happened. If youre here, does that mean the Leonard is here as well?] (Yuuya) [No, that isnt the case. Our party was disbanded a long time ago. Right now, Im the leader of my own party, Dragon Knight. Weve built a pretty good reputation if I do say so myself.] (Lyle) Just as he said that, he pointed behind him where three large dragonoids appeared. It was a party that consisted of dragonoids that were decently powerful as I couldnt see their levels. They must have been at least level forty-two. As far as their equipment and composition was concerned, they were a well-balanced party with one vanguard, one wizard, one healer and one thief. Behind them, was the second party participating in the subjugation. [Nice to meet you. I am Kurushatta, the leader of the Wild Tigers. Yuuya-dono, Ive wanted to meet you at least once in my life.] (Kurushatta) [Nice to meet you, Im Yuuya. The leader of the Twilight Home.] (Yuuya) Wild Tiger was a pretty famous party as Ive heard about them as well. [The fact that both Dragon Knights and Wild Tigers arrived at the same time must not be a coincidence. The two of you must have been nominated for the quest.] (Yuuya) Even though the monster requires a minimum of three parties, there was no reason for them to call over two famous parties when a third party was required. I couldnt understand the rationale behind that as they must have known that they had to wait for a third party to appear. [It was a blunder on our part as we informed them about our situation. However the situation had taken a turn for the worse.] (Guild Leader) Beads of sweat began to appear on the guild leaders forehead as Lyle let out a sigh. [Actually, aside from Dragon Knights and WIld Tigers, the Silvermoon Knights were called over as well. However, do you remember their leader, Bogar?] (Lyle) [Ahh. His strength was the real thing, however, his personality was the worst. Ive heard rumors about him in the past and his actions were never pleasant whenever we met.] (Yuuya) The Silvermoon Knight was an extremely old party and they could be among the top five most accomplished parties in the world. However, contrary to their names, their behaviours were that of scum as they stole, killed, harassed and other hateful things that were looked down upon. [They threw their name away and left us out to dry. When they first arrived at Kritarus, they tried to supplement their strength with the local adventurers around the city and fought against the Ice Grand General before we arrived in the city. I can only guess that they wanted to take the credit for the subjugation quest by themselves.] (Lyle) [And the result was complete annihilation?] (Yuuya) [Thats right. Thanks to that, we were forced to wait for this entire time and the guild had lost many of their local adventurers as well as the higher-levelled adventurers in the area. The situation couldnt have been any worse.] (Lyle) [I can sympathise with the situation.] (Yuuya) Adventurers were people with huge egos. I knew countless idiots who wanted to gain the upper hand against their rivals, going way beyond their capabilities trying to accomplish a task and gain popularity for themselves. [The fact that you arrived here was a huge relief. If its a party with both you and Phil, then Im sure that we can do it. If you hadnt arrive by now, then I would have pulled out from the request.] (Lyle) [Likewise, if youre here, then Im sure that it is possible. Similarly, if its you and the WIld Tigers, then Im sure that it is possible to defeat the Ice Grand General.] (Yuuya) Its been awhile since Ive had to participate with several parties to defeat a boss. A raid battle after such a long time. However the balance of a raid battle was fragile as the situation could turn sour extremely quickly. With the two parties here,rather than a misfortune, we might be extremely lucky that we arrived during the period when the Ice General was here. We will definitely defeat it and obtain its exclusive item drops along with the subjugation reward. Also, I wouldnt like to throw our cooperation into disarray but for raid bosses such as the Ice Grand General, the contribution for each party was calculated and special items are given to the party with the most contribution to the battle. Naturally, not just us but the other two parties were also eyeing that reward. We proceeded to our strategy meeting as we spent the entire morning planning for the battle. Everything, was for us to defeat the boss with these three parties.